ID: 1035133247

View in Genome Browser
Species Human (GRCh38)
Location 7:156675292-156675314
Sequence CAAAGACGGAGGGAGCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 253}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133247_1035133256 0 Left 1035133247 7:156675292-156675314 CCTCCCGGCTCCCTCCGTCTTTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1035133256 7:156675315-156675337 GAGACGAGGGTGCCTCTCACAGG No data
1035133247_1035133258 4 Left 1035133247 7:156675292-156675314 CCTCCCGGCTCCCTCCGTCTTTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1035133258 7:156675319-156675341 CGAGGGTGCCTCTCACAGGAGGG No data
1035133247_1035133266 30 Left 1035133247 7:156675292-156675314 CCTCCCGGCTCCCTCCGTCTTTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1035133266 7:156675345-156675367 TGTGACCCACTTTAGGGGTGGGG No data
1035133247_1035133262 25 Left 1035133247 7:156675292-156675314 CCTCCCGGCTCCCTCCGTCTTTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133247_1035133261 24 Left 1035133247 7:156675292-156675314 CCTCCCGGCTCCCTCCGTCTTTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133247_1035133260 23 Left 1035133247 7:156675292-156675314 CCTCCCGGCTCCCTCCGTCTTTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1035133260 7:156675338-156675360 AGGGTCCTGTGACCCACTTTAGG No data
1035133247_1035133265 29 Left 1035133247 7:156675292-156675314 CCTCCCGGCTCCCTCCGTCTTTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1035133265 7:156675344-156675366 CTGTGACCCACTTTAGGGGTGGG No data
1035133247_1035133264 28 Left 1035133247 7:156675292-156675314 CCTCCCGGCTCCCTCCGTCTTTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1035133264 7:156675343-156675365 CCTGTGACCCACTTTAGGGGTGG No data
1035133247_1035133257 3 Left 1035133247 7:156675292-156675314 CCTCCCGGCTCCCTCCGTCTTTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133247 Original CRISPR CAAAGACGGAGGGAGCCGGG AGG (reversed) Intronic
900384624 1:2404580-2404602 CAGAGACGGAGGAGGGCGGGGGG - Exonic
900391577 1:2436169-2436191 GAAGGAAGGAGGGAGCAGGGAGG - Intronic
901775550 1:11558428-11558450 CAAAGTGAGAGGGAGGCGGGTGG - Intergenic
902403805 1:16172395-16172417 GGAAGACGGGTGGAGCCGGGTGG - Intergenic
902979122 1:20110376-20110398 AAAAGACAGAGGAGGCCGGGTGG + Intergenic
903238277 1:21964878-21964900 CAAAGACCGAGGGAGCTGAGAGG + Intergenic
903349643 1:22710341-22710363 CGAAGCCGCAGGGACCCGGGTGG + Intergenic
903359070 1:22765715-22765737 GAAAGACTGAGGCAGCCTGGGGG - Intronic
904044836 1:27603040-27603062 CAAAGGCGGAGGGAGGGGGAAGG + Intronic
905813801 1:40932280-40932302 CACAGACTGAGGGAGCCCAGGGG - Intergenic
906130751 1:43453831-43453853 CAAAGGCGGCGGGCGGCGGGCGG + Exonic
907220641 1:52904837-52904859 CCAGGATGGAGGGAGCAGGGTGG + Intronic
907417769 1:54326357-54326379 CAAAGAGGAAGGGATGCGGGAGG - Intronic
907525586 1:55052273-55052295 GAAAGACGGAGGCAGCCTGGTGG + Exonic
912395852 1:109343406-109343428 CTGAGAGGGAGGGATCCGGGAGG - Intronic
912558269 1:110531771-110531793 GAAAGACCAAGGGAGCAGGGAGG - Intergenic
916189311 1:162163603-162163625 GAAAGAGGGAGTGAGCCGTGTGG + Intronic
916652310 1:166843665-166843687 CAAAGACGCAGGGATCTCGGGGG - Intronic
917447276 1:175117054-175117076 CAAGGACGGAGAGACCAGGGAGG + Exonic
918423821 1:184388105-184388127 CGTAGAGGGAGGGAGCAGGGTGG - Intronic
919809377 1:201399244-201399266 GAGCGCCGGAGGGAGCCGGGAGG - Intronic
921309135 1:213825396-213825418 GGAAGAGGGAGGGAGCAGGGAGG + Intergenic
923092404 1:230750528-230750550 TAGAGTCGCAGGGAGCCGGGGGG + Intronic
923604045 1:235427315-235427337 GAAAGAGGTAGGGAGCCGGAAGG + Intronic
1062957422 10:1549442-1549464 GAAGGAAGGAGGGAGACGGGAGG + Intronic
1062961341 10:1575758-1575780 CAGAGACCGAGAGAGCCTGGCGG + Intronic
1063511145 10:6646733-6646755 GAAAGAAGGAGGGAGGGGGGAGG - Intergenic
1064354365 10:14604186-14604208 CAAAGACGAGGGGCGCGGGGAGG - Intronic
1067799487 10:49349292-49349314 GAGAGAGGGAGGGAGCCGGGAGG + Intergenic
1068551719 10:58414947-58414969 CCAAGAAGGAGGGAGAAGGGAGG - Intergenic
1069779617 10:70946410-70946432 CAAGGAGTGAGGGAGCAGGGGGG + Intergenic
1070092463 10:73301381-73301403 AAAAGACAGAGAGAGCAGGGAGG - Intronic
1070392795 10:75985723-75985745 CAGAGATGGAGGGAGGTGGGAGG + Intronic
1070436448 10:76398273-76398295 AACAGAGGGAGGGAGCTGGGGGG - Intronic
1070562638 10:77579260-77579282 CAAAGCAGGAGGGATCAGGGAGG + Intronic
1070773626 10:79097251-79097273 CAAAGATGGAGGTGGCCGGTGGG - Intronic
1070774464 10:79101691-79101713 CAGGGAGGGAGGGAGGCGGGTGG + Intronic
1072271411 10:93780683-93780705 CAAAGACGGTGGGAGCTGTCTGG - Intronic
1072718967 10:97769310-97769332 CAGAGATGGATGGAGCCAGGTGG - Intronic
1076629877 10:131846116-131846138 CCAAGACGGAGGGAGGAGGTTGG - Intergenic
1076930728 10:133530019-133530041 CACAGTCGGAGGCAGCAGGGAGG + Intronic
1077272221 11:1686732-1686754 CAGAGAAGGAGGGAGGAGGGAGG - Intergenic
1077272307 11:1686994-1687016 CAAAGAAGGAGGGAAGAGGGAGG - Intergenic
1078285564 11:9951130-9951152 GAAAGATTGAGGGAGCAGGGAGG + Intronic
1078986714 11:16605202-16605224 GAAGGACGGAGGGCGCCGGCTGG + Intronic
1081787127 11:45755658-45755680 CAGAGGCGGAGGGAGCGTGGGGG + Intergenic
1082807246 11:57458963-57458985 CAGAGACGCAGGGAGCCCCGCGG + Intergenic
1083693763 11:64428899-64428921 CAGAGCTGGAGGCAGCCGGGAGG - Intergenic
1083697334 11:64451684-64451706 CAAAGGCCGAGGGAGCTGAGAGG - Intergenic
1083925550 11:65803965-65803987 GAGAGGCGGAGGGAGCCGGCTGG - Intergenic
1084957191 11:72697697-72697719 CACAGAGGGAGGGAGCAGGTTGG - Intronic
1085726602 11:78960362-78960384 CAAAGACAGTGGAAGCGGGGAGG + Intronic
1089642965 11:119859698-119859720 TAAAGACGAAGGGATCCAGGAGG + Intergenic
1091383444 12:77693-77715 CACGGTCGGAGGGAGCCGGCTGG - Intronic
1092530672 12:9342147-9342169 CTGAGACCGAGGGTGCCGGGTGG - Intergenic
1092660337 12:10732001-10732023 CAGAGATGGAGGGAGACAGGAGG - Intergenic
1095811772 12:46379621-46379643 CAAAGACTGAGGGAGTGGAGGGG - Intergenic
1096801980 12:54116471-54116493 TAAAGACTGAGGGAGGCAGGCGG + Intergenic
1096847982 12:54418465-54418487 CAAAGACTGAGGGGGTCGGAAGG - Intronic
1099972282 12:89512649-89512671 CAGAGGCTGAGGGAGGCGGGCGG + Intronic
1102864737 12:116365315-116365337 CAAAGAAGGAGGAAGAAGGGAGG - Intergenic
1104134365 12:125923367-125923389 CACAGAAGGAGGGAGCAGAGAGG + Intergenic
1104945891 12:132414778-132414800 CAGAGGCTGTGGGAGCCGGGAGG + Intergenic
1105210247 13:18253158-18253180 CAAAGTCCGAGGGATCAGGGTGG + Intergenic
1105607780 13:21941605-21941627 CAAAGTCCGAGGAAGCCGAGAGG + Intergenic
1107788502 13:43977829-43977851 AAAAGAGGGAGGGAGGGGGGAGG - Intergenic
1107895353 13:44956398-44956420 CAAAGACAGAGGGTGGGGGGTGG + Intronic
1108396571 13:49996769-49996791 CCTTGGCGGAGGGAGCCGGGTGG - Intronic
1111676993 13:91399446-91399468 CCAAGACGAAGGGAGCCGGGCGG - Intronic
1112487765 13:99835281-99835303 CACAGAAAGAGGTAGCCGGGTGG + Intronic
1112562214 13:100525121-100525143 GAAAGGCGGATGGAGCAGGGAGG + Intronic
1114734795 14:25033292-25033314 TAAAGATGGAGCGAACCGGGTGG - Intronic
1115028244 14:28766859-28766881 CAAAGGGGGGGAGAGCCGGGCGG - Intergenic
1115502876 14:34064916-34064938 CAAAGTCGGAGGAAGCTGAGAGG + Intronic
1118046790 14:61978757-61978779 CAGTGAGGGAGGGAGCCAGGTGG - Intergenic
1121279053 14:92686885-92686907 CTAAGACGGAGGGAGTGGGCCGG + Intronic
1121293297 14:92794806-92794828 CACAGAGGGAGGGAGGCTGGAGG - Intronic
1121358315 14:93232876-93232898 CACGGGCGGAAGGAGCCGGGAGG + Intergenic
1121532234 14:94663166-94663188 CAAAGGCCGAGGGAGCTGAGAGG - Intergenic
1121541230 14:94728219-94728241 CAAAGCCCCAGGGAGCTGGGAGG + Intergenic
1121674160 14:95738952-95738974 CAAAGGCAGTGGCAGCCGGGAGG + Intergenic
1122198682 14:100108752-100108774 CAAAGTCACAGGGAGCGGGGCGG - Intronic
1122926362 14:104904706-104904728 CAAAGGAGGAGGGAGGAGGGAGG - Intergenic
1122942219 14:104986435-104986457 CAAGGCCGGCGGGAGCTGGGGGG + Exonic
1124104644 15:26726086-26726108 CACAGCTGGAGGGAGCTGGGAGG + Intronic
1124618808 15:31262350-31262372 CAAAGACCGTGGGTGCCAGGAGG - Intergenic
1124685178 15:31776476-31776498 CAAGGAAGGAGAGAGTCGGGAGG - Intronic
1126359398 15:47830642-47830664 CAAGGAGGGGGGCAGCCGGGTGG + Intergenic
1128780065 15:70353427-70353449 GAAAGACGGAGGAAGGAGGGAGG + Intergenic
1130275400 15:82473556-82473578 CTAGGACAGAGGGAGCCTGGGGG + Intergenic
1130467760 15:84200951-84200973 CTAGGACAGAGGGAGCCTGGGGG + Intergenic
1130496505 15:84472591-84472613 CTAGGACAGAGGGAGCCTGGGGG - Intergenic
1130590052 15:85205549-85205571 CTAGGACAGAGGGAGCCTGGGGG + Intergenic
1130813525 15:87406727-87406749 CAAAGAGGGAGGGAGGGAGGGGG + Intergenic
1131229711 15:90651127-90651149 CAAAGGCCGAGGGAGCTGAGAGG - Intergenic
1131870475 15:96758450-96758472 CAAAGACAGACGGAGCCCCGTGG + Intergenic
1131874178 15:96787214-96787236 CAAAGCCGGTGGGAGGCGGCGGG - Intergenic
1132619083 16:855916-855938 CAAAGCCAGGAGGAGCCGGGTGG - Intronic
1132750058 16:1453467-1453489 CCAAGAAGGAAGAAGCCGGGGGG + Intronic
1133334959 16:5000964-5000986 CAAAGACGGAGGGTGGAGAGGGG + Intronic
1133416330 16:5609865-5609887 CAGAGACGGTGGGGGCGGGGTGG + Intergenic
1133973102 16:10580819-10580841 CAGAGCCGCAGGGAGGCGGGCGG - Intergenic
1134430401 16:14199209-14199231 AAAAGGCGGAGGGAACCAGGAGG - Intronic
1136100588 16:27992637-27992659 CAAAGGCTGAGGGAGCCGAGAGG - Intronic
1136996633 16:35195296-35195318 CAAAGAGGGCGGGAGCGGTGAGG + Intergenic
1138599230 16:58045254-58045276 CAAGGACGGGGGCAGCCGCGTGG + Exonic
1139082746 16:63544215-63544237 AAAAGAAGGAGGGAGAAGGGAGG + Intergenic
1140738276 16:77918494-77918516 CAAGGAGGGAGGGAGACAGGTGG - Intronic
1140896811 16:79331842-79331864 CAGAGAAGTAGGGAGCCAGGTGG - Intergenic
1141729598 16:85812752-85812774 CAAAGGCTGAGGGAGCCCAGAGG + Intergenic
1142352669 16:89587184-89587206 CACAGACTGAGGGGGCGGGGAGG - Intronic
1142363938 16:89640020-89640042 CACAGTGGGAGGGAGCCTGGGGG - Intergenic
1142395135 16:89828010-89828032 GAACGCGGGAGGGAGCCGGGAGG - Intronic
1142667958 17:1473262-1473284 CAAAGAAGGAGAAAGCCTGGAGG + Intronic
1143524366 17:7463535-7463557 CAATGACAGAGGGGGCTGGGTGG + Exonic
1143719788 17:8801430-8801452 CAGTGAGGGAGGGAGCCTGGAGG - Intergenic
1145413708 17:22695282-22695304 CCAAGCCGGAGGGAGGCGGAGGG - Intergenic
1145414459 17:22703483-22703505 CAAAGCCAGAGGGAGGCGGAGGG + Intergenic
1146262594 17:31431744-31431766 CGAAGACTCAGGGAGCTGGGTGG - Intronic
1147158631 17:38558413-38558435 CACGGACGGATGGACCCGGGTGG + Intronic
1147629699 17:41921897-41921919 CAAAGACGCAGTGAGCTGGGTGG + Intronic
1147934827 17:44005418-44005440 CAAGGTCGGAGGGAGGAGGGCGG + Intronic
1148211072 17:45808998-45809020 TAATGATGGAGGGAGCAGGGAGG + Intronic
1148793039 17:50184276-50184298 CAGACTAGGAGGGAGCCGGGAGG + Exonic
1150645688 17:66976314-66976336 GAAAGACAGAGGGAGGAGGGAGG - Intronic
1151717054 17:75836264-75836286 CAAAGAGGCAGTGAGCAGGGAGG + Intronic
1152147530 17:78577236-78577258 CCAAGGTGGAGGGAGCAGGGAGG - Intronic
1152294127 17:79456769-79456791 GAAAGACCGAGAGAGCCGGCCGG - Intronic
1153591213 18:6675752-6675774 CAAAAAGGGTGGGAGCAGGGAGG - Intergenic
1153884270 18:9448957-9448979 CAAAGACTGAGGGAGCTGAAAGG + Intergenic
1156507637 18:37608512-37608534 CAGAGGCTGAGGGAGCTGGGAGG + Intergenic
1156723826 18:40103393-40103415 GAGAGAGGGAGGGAGACGGGTGG - Intergenic
1157098785 18:44711247-44711269 GAGAGAGGGAGGGAGGCGGGAGG - Intronic
1157391489 18:47307136-47307158 CTAAGAGGGAGGGAGCAGGGTGG + Intergenic
1158008577 18:52702193-52702215 CAAAGTCTGAGGAAGCAGGGAGG - Intronic
1158494100 18:57938090-57938112 AAAAGGCTGAGGGAGCTGGGAGG - Intergenic
1159622011 18:70649856-70649878 CAAAACAGGAGGGAGCGGGGAGG - Intronic
1160537742 18:79604009-79604031 GAAAGCCTCAGGGAGCCGGGCGG - Intergenic
1160585522 18:79911504-79911526 CTAACAGTGAGGGAGCCGGGCGG - Intronic
1160779276 19:870759-870781 CATGGAGGGAGGGAGCCGTGTGG + Intronic
1160779294 19:870805-870827 CATGGAGGGAGGGAGCCGTGTGG + Intronic
1160779312 19:870851-870873 CATGGAGGGAGGGAGCCGTGTGG + Intronic
1161288118 19:3479125-3479147 CAGAGTGGGAGGGAGCCTGGGGG + Intronic
1161415803 19:4145676-4145698 CCAAGGAGGAGGGAGCAGGGAGG + Intergenic
1163547524 19:17948647-17948669 CAAAGGCGGAGGGGGATGGGAGG + Intergenic
1164732468 19:30516765-30516787 TAGAGACGGAGTGTGCCGGGAGG + Intronic
1165779486 19:38423943-38423965 CAAGGATGGTGGGAGCAGGGAGG + Intronic
1166223240 19:41378790-41378812 CAAAGAGGGAGACAGCAGGGTGG - Intronic
1166398849 19:42462903-42462925 GAAAGAGGGAGTGAGCTGGGGGG + Intergenic
1166569248 19:43783223-43783245 GAGAGACGCAGCGAGCCGGGCGG - Intergenic
1168163925 19:54533667-54533689 CAAGGACAGCGGGAGACGGGGGG + Intronic
1168468233 19:56621101-56621123 CAGAGAGGGAGGGAGGAGGGAGG - Intronic
925610011 2:5694436-5694458 CAAAGGCAGAGGGGGCGGGGCGG + Exonic
925719534 2:6813699-6813721 GAAAAAGGGAGGGAGCGGGGAGG + Intergenic
929188508 2:39120121-39120143 GAATGCCGCAGGGAGCCGGGGGG - Intronic
931470772 2:62536019-62536041 CAAAGGCTGATGGAGCTGGGAGG + Intergenic
932579294 2:72983120-72983142 CCTAGACGGAGGAAGCAGGGTGG + Intronic
932768850 2:74489355-74489377 CAAGGCTGGAGGGAGCCTGGTGG + Intronic
934650703 2:96089786-96089808 CAAAGACGGAGGGTGGAGGGTGG + Intergenic
941225136 2:162838812-162838834 GAAAGAGGGAGGGAGCTGTGGGG + Intergenic
943734121 2:191335126-191335148 CTAAGACGCCTGGAGCCGGGAGG + Intronic
945238366 2:207653632-207653654 CAGAGAGGGAGGGAGAGGGGAGG + Intergenic
947082039 2:226409745-226409767 GAAAGAGAGAGGGAGCGGGGAGG + Intergenic
947718444 2:232353192-232353214 AAAAGAGTGAGGGAGCCGGAGGG - Intergenic
948121687 2:235535599-235535621 CAAAGACCCTGGGGGCCGGGCGG + Intronic
949020603 2:241739101-241739123 CAAAGACGGAGGGGGCCATGGGG - Intronic
1168995487 20:2129811-2129833 CAGAGGAGGAGGGAGCCGGCTGG + Intronic
1169546804 20:6658763-6658785 CAAAGAAGGAGGGAGCTGCATGG + Intergenic
1170332326 20:15227359-15227381 GAAAGAGGGAGGGAGAAGGGAGG - Intronic
1171794731 20:29557994-29558016 TAAAGACTGAGGGAGGCAGGCGG - Intergenic
1171853727 20:30326271-30326293 TAAAGACTGAGGGAGGCAGGTGG + Intergenic
1172900212 20:38329202-38329224 AACAGAGGGAGGGAGTCGGGGGG + Intronic
1174763477 20:53229654-53229676 CAAAGAGGAAGGGAGCTGAGGGG - Intronic
1174796621 20:53527833-53527855 CACAGACTGAGGGAGGAGGGAGG + Intergenic
1176047841 20:63101943-63101965 CCAAGACGGAGGGCACCGGGCGG - Intergenic
1176056529 20:63151837-63151859 GAGAGCCAGAGGGAGCCGGGTGG + Intergenic
1176213665 20:63938530-63938552 CATAGCCGGGGGGAGCGGGGAGG - Intergenic
1176281734 20:64317094-64317116 CACGGTCGGAGGGAGCCGGCTGG + Intergenic
1176684545 21:9837057-9837079 CAAAGGCGGAGGGAGGCAGAGGG - Intergenic
1178121387 21:29473716-29473738 CACAGACAGAGGGAGCAGGGAGG - Intronic
1178583823 21:33856895-33856917 CGATGACGGAGGGAGAGGGGAGG + Intronic
1179732353 21:43374846-43374868 CACAGAAGGAGGGAGACAGGAGG - Intergenic
1180766005 22:18346245-18346267 CAAAGTCTGAGGGATCAGGGTGG - Intergenic
1180780308 22:18516133-18516155 CAAAGTCTGAGGGATCAGGGTGG + Intergenic
1180813024 22:18773454-18773476 CAAAGTCTGAGGGATCAGGGTGG + Intergenic
1181199202 22:21207770-21207792 CAAAGTCTGAGGGATCAGGGTGG + Intergenic
1181400563 22:22648087-22648109 CAAAGTCCGAGGGATCAGGGTGG - Intergenic
1181702544 22:24629185-24629207 CAAAGTCCGAGGGATCAGGGTGG - Intergenic
1203227623 22_KI270731v1_random:87136-87158 CAAAGTCTGAGGGATCAGGGTGG - Intergenic
949953321 3:9247584-9247606 CAATGACCCAGGGAGCTGGGTGG - Intronic
950113483 3:10435306-10435328 CAAATAAGGAGGAAGCAGGGGGG + Intronic
950429872 3:12944552-12944574 CAAAGACGAGGCGAGCCGGAGGG - Intronic
950464960 3:13148270-13148292 CACAGAGGGAGGGAGGAGGGAGG + Intergenic
950739524 3:15039079-15039101 CAAATACAGAGGGAACTGGGGGG + Intronic
955047048 3:55370293-55370315 CAGAGACGGAGCGAGCCTGCAGG - Intergenic
955247426 3:57239294-57239316 CAAGGGCTGAGGGAGCAGGGAGG - Intronic
956644981 3:71446452-71446474 TAAGGAGGGAGGGAGCCAGGCGG + Intronic
961034378 3:123632223-123632245 CAGAGACAGAGAGAGCTGGGAGG - Intronic
961280421 3:125762304-125762326 GAAAGACAGAGGGAGATGGGAGG - Intergenic
961362625 3:126377618-126377640 CAAAGACGGAGGCACTGGGGAGG - Intergenic
961821833 3:129579150-129579172 GAAAGAAGGAGGGAGGAGGGAGG + Intronic
964295650 3:155230396-155230418 CCAAGAAGGAGAGAGCCAGGTGG - Intergenic
969114072 4:4860389-4860411 CGCAGAGGGAGGGGGCCGGGTGG + Intronic
972731641 4:41800789-41800811 CTAAGAGGGAGAGAGCCAGGAGG + Intergenic
975624094 4:76324993-76325015 CAAAGACTGAGGAAGCTGAGAGG - Intronic
977870184 4:102081699-102081721 GAAAGAGGGAGGGAGGAGGGAGG + Intergenic
980450030 4:132958760-132958782 CAAAGCCGGCAGGAGCTGGGAGG + Intergenic
982000310 4:151015780-151015802 CGAAGGCGGAGGCAGCCGCGCGG + Intergenic
982635059 4:157885409-157885431 AAAAGAGGGAGGGAGAAGGGGGG + Intergenic
984686939 4:182679727-182679749 TTGAGACGGAGAGAGCCGGGCGG + Exonic
996100977 5:119445603-119445625 GAAAGAAGGAGGGAGCGGGAAGG - Intergenic
997377886 5:133410351-133410373 CCAAGACGGAGGGAGCCCAGAGG - Intronic
997528037 5:134566069-134566091 CAGACATGGAGGGAGCCTGGTGG - Intronic
998214044 5:140223942-140223964 CAAAGGCTGAGGGAGCTGAGAGG + Intronic
999727077 5:154446197-154446219 GAAAGAAGGCGGGAGCCGGCAGG + Exonic
1001290319 5:170452683-170452705 TAAAGGCAGAGGGAGCAGGGTGG - Intronic
1002017505 5:176336803-176336825 CAGAGACAGAGGCAGGCGGGTGG - Exonic
1005940671 6:30557157-30557179 CAGAGACGGAGGGAGGCAGTTGG + Exonic
1006006078 6:31002703-31002725 CAAAGACTGAGGGAGCTGAGAGG - Intergenic
1006932849 6:37697922-37697944 AAGAGAGGGAGGGAGGCGGGAGG - Exonic
1007121586 6:39386709-39386731 TAGAGACGGAGGAAGCCTGGAGG - Intronic
1012064638 6:94534835-94534857 GAGAGAGGGAGGGAGCGGGGAGG + Intergenic
1013491059 6:110646589-110646611 CAACGGCGGAGGGGGCGGGGAGG + Intronic
1018613132 6:165662425-165662447 AAAAGAGGGAGGGGGCGGGGGGG + Intronic
1018920620 6:168169876-168169898 CAAAGAAGGAGGGACCAGGGTGG - Intergenic
1019959693 7:4448932-4448954 CAAAGACAGAGAGACCAGGGAGG + Intergenic
1020092447 7:5349188-5349210 CAAGCACGCAGGGAGGCGGGAGG - Intronic
1021710391 7:23410463-23410485 TAAACATGGAGGGAGCAGGGTGG + Intronic
1022220911 7:28312506-28312528 CAAAGGGGGAGGGAAGCGGGTGG + Intronic
1023834652 7:44061036-44061058 CCAAGCCGGAGGGAGCCCTGAGG - Exonic
1026104439 7:67409985-67410007 CAGAGAGGGAGGGAGGAGGGAGG - Intergenic
1026147833 7:67763086-67763108 CAAAGACCAAGGGAGCTGAGAGG + Intergenic
1026388728 7:69878266-69878288 CTAAGGTGGAGGGAGCGGGGAGG + Intronic
1029182228 7:98711219-98711241 CAAAGACAGAGGGAGTCAGCCGG - Intergenic
1030319585 7:108150973-108150995 CAAGGAAGAAGGGAGCTGGGGGG - Intronic
1030884620 7:114922474-114922496 CTGAGCCGGAGGGAGGCGGGAGG + Exonic
1032583470 7:133125351-133125373 CAAAGATGGTGGGAGGTGGGTGG + Intergenic
1033732924 7:144195929-144195951 CAGAGACAGAGGGAGCCAGCCGG + Intergenic
1033743776 7:144294509-144294531 CAGAGACAGAGGGAGCCAGCCGG + Intergenic
1033750125 7:144355088-144355110 CAGAGACAGAGGGAGCCAGCCGG - Intergenic
1034609190 7:152349629-152349651 CAAGGAGGGAGGGAGCAAGGAGG + Intronic
1034788616 7:153947755-153947777 CAAAGGCAGAGGCAGCCGGGAGG - Intronic
1035133247 7:156675292-156675314 CAAAGACGGAGGGAGCCGGGAGG - Intronic
1035354775 7:158270502-158270524 CATAGGCAGAGGGAGCCAGGGGG - Intronic
1035757107 8:2042894-2042916 AAAAGACGGAGGGAGGCGGTGGG - Intergenic
1039428345 8:37505498-37505520 CACAGAAGGAGGGAGGCTGGGGG + Intergenic
1040053278 8:43035974-43035996 CAAAAAAAGAGGGAGCGGGGTGG - Intronic
1040552018 8:48445073-48445095 CAAAGAAGGAGAGAGACGGGAGG + Intergenic
1044765078 8:95562997-95563019 TAAAGACGGAGGAAGCCAAGTGG + Intergenic
1047689355 8:127335572-127335594 CTAAGACAGAGGGAGCCATGTGG - Intergenic
1048257771 8:132918138-132918160 CAGAGACGGAGAGAACCGGTGGG + Intronic
1048527064 8:135212971-135212993 TAAAGACAGAGGGAACAGGGAGG - Intergenic
1048990840 8:139759263-139759285 CAAAGCCGGAAGGGGCGGGGAGG + Intronic
1049384747 8:142337560-142337582 TCAAGACTGAGGGAGCCGCGGGG + Intronic
1049504482 8:142988487-142988509 CAAAGGCTGAGGGAGCTGAGAGG - Intergenic
1049643324 8:143725192-143725214 GAGAGAGGGAGGGAGCGGGGAGG + Exonic
1053791528 9:41689568-41689590 TAAAGACTGAGGGAGGCAGGCGG + Intergenic
1054153631 9:61625203-61625225 TAAAGACTGAGGGAGGCAGGCGG - Intergenic
1054179933 9:61901582-61901604 TAAAGACTGAGGGAGGCAGGCGG + Intergenic
1054473413 9:65556331-65556353 TAAAGACTGAGGGAGGCAGGCGG - Intergenic
1054657659 9:67679559-67679581 TAAAGACTGAGGGAGGCAGGCGG - Intergenic
1056255481 9:84795155-84795177 CAAAGACAGAGGGAAGTGGGAGG + Intronic
1061846446 9:133391120-133391142 CCAGGACGGAGGGAGGTGGGGGG + Intronic
1062409104 9:136413189-136413211 CAAAGGCGGTAGGAGCCAGGAGG + Intronic
1185576022 X:1172881-1172903 CAAGGACGGAGGTACCCGCGTGG + Intergenic
1187449074 X:19381242-19381264 CAAAGCGGGAGGGAGCAGGGTGG + Intronic
1194996357 X:100595505-100595527 TCAAGATGGAGGGAGCTGGGTGG - Intronic
1195006486 X:100690482-100690504 GAAAGACGGAGGGAGACAGGAGG + Intronic
1195941948 X:110174374-110174396 GAAAGAGGGAGGGAGGGGGGAGG - Exonic
1199295748 X:146156531-146156553 CAAAGAAGGAGGGAGGATGGGGG - Intergenic
1200124316 X:153806088-153806110 CAAAGACGGCCGGATCCGTGAGG - Exonic
1200804489 Y:7418942-7418964 CACACACAGAGGGAGCTGGGGGG - Intergenic
1201058052 Y:10015496-10015518 GAAGGAAGGAAGGAGCCGGGGGG + Intergenic