ID: 1035133249

View in Genome Browser
Species Human (GRCh38)
Location 7:156675295-156675317
Sequence CTCCAAAGACGGAGGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 184}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133249_1035133262 22 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133249_1035133256 -3 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133256 7:156675315-156675337 GAGACGAGGGTGCCTCTCACAGG No data
1035133249_1035133261 21 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133249_1035133258 1 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133258 7:156675319-156675341 CGAGGGTGCCTCTCACAGGAGGG No data
1035133249_1035133260 20 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133260 7:156675338-156675360 AGGGTCCTGTGACCCACTTTAGG No data
1035133249_1035133266 27 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133266 7:156675345-156675367 TGTGACCCACTTTAGGGGTGGGG No data
1035133249_1035133265 26 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133265 7:156675344-156675366 CTGTGACCCACTTTAGGGGTGGG No data
1035133249_1035133264 25 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133264 7:156675343-156675365 CCTGTGACCCACTTTAGGGGTGG No data
1035133249_1035133257 0 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133249 Original CRISPR CTCCAAAGACGGAGGGAGCC GGG (reversed) Intronic
900415462 1:2532581-2532603 CTCCAAAGCCTGCGGGAGCAGGG - Intergenic
900457300 1:2783517-2783539 CCCCAAGGAGAGAGGGAGCCGGG - Intronic
900802398 1:4745485-4745507 CTCCACAGAAGGAGGGGGCCTGG + Intronic
901453140 1:9348408-9348430 CTCTGAAGGCTGAGGGAGCCTGG - Intronic
902525884 1:17057097-17057119 GTCCAAAGACTGAGAGAGTCTGG - Intergenic
903780590 1:25817860-25817882 CTCCCAGGACACAGGGAGCCTGG - Exonic
905186589 1:36201527-36201549 CTCCAAAGGCTGAGTGAGCCAGG - Intergenic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
905659808 1:39712796-39712818 CTCCTAAGACTGAGGGAACTGGG - Intronic
906448397 1:45922780-45922802 CTACAGAGTCGGTGGGAGCCAGG - Intronic
907525585 1:55052270-55052292 TTGGAAAGACGGAGGCAGCCTGG + Exonic
907811126 1:57871082-57871104 CTCCAAAGAGGCAGGGATCCTGG - Intronic
908175322 1:61549928-61549950 ATCAAAAGACAGAGTGAGCCAGG - Intergenic
912557968 1:110529934-110529956 CTCCAGAGACAGAGACAGCCAGG - Intergenic
912625613 1:111203189-111203211 CTACAAAGAGGGAAGGAGCAGGG + Intronic
916399640 1:164432799-164432821 AGCCAAAGATGGAAGGAGCCTGG + Intergenic
918423823 1:184388108-184388130 CTCCGTAGAGGGAGGGAGCAGGG - Intronic
918439027 1:184547095-184547117 CACCAAAGTAGGAGAGAGCCTGG + Intronic
919083293 1:192891621-192891643 CAGCAAAGACAGGGGGAGCCTGG - Intergenic
919523451 1:198618124-198618146 CTCCAGAGACTGAGGCAGGCAGG + Intergenic
922211460 1:223489871-223489893 CTCCATAGGCGGATGAAGCCTGG - Intergenic
922345902 1:224696149-224696171 CTCCAAAGATGGGAGGAGCCTGG - Intronic
922529511 1:226333543-226333565 CTTCAAAGACGGAAGCATCCTGG - Intergenic
923483109 1:234403179-234403201 GTCCCAAGATGGAGGGAGCCAGG - Intronic
1068290777 10:54999611-54999633 CTTCAGAGATGGTGGGAGCCAGG + Intronic
1073046373 10:100641343-100641365 CCCTAAAGACTGAGGGAGCATGG - Intergenic
1073458541 10:103652324-103652346 CTGCAAAGTCTGGGGGAGCCAGG - Intronic
1073487567 10:103829595-103829617 GTGCAAGGACGGAGGGAGGCAGG + Intronic
1077007025 11:363221-363243 CTCCCCAGACGGTGGGGGCCGGG - Intergenic
1077007122 11:363538-363560 CTCTCCAGACGGTGGGAGCCGGG - Intergenic
1077007240 11:363915-363937 CTCCCCAGACGGTGGGGGCCGGG - Intergenic
1084091217 11:66880390-66880412 CCCCAAAGCCGAAGGGAGCAGGG + Intronic
1084416838 11:69037370-69037392 CTCCCAAGACGGAGAATGCCTGG - Intergenic
1084431242 11:69112527-69112549 CACCAGAGCCTGAGGGAGCCAGG - Intergenic
1084746072 11:71170740-71170762 CTCCAAAGAGGCAAGGAGCTGGG + Intronic
1089055315 11:115580260-115580282 CTCTAAAGAGGGAGGGAGTTTGG + Intergenic
1089642964 11:119859695-119859717 CACTAAAGACGAAGGGATCCAGG + Intergenic
1090006988 11:123011482-123011504 CTCCAATGATGGAGGGTGTCGGG + Intergenic
1091566926 12:1655620-1655642 CTCCTCAGACCGAGGTAGCCAGG - Intergenic
1091777537 12:3194308-3194330 CTCCAGAGAGGGAGGTACCCTGG + Intronic
1092193801 12:6537286-6537308 CTGCAAAGAAAGAGGGAGCGGGG - Intronic
1096439773 12:51631157-51631179 TCCCACAGAGGGAGGGAGCCTGG - Intronic
1099727291 12:86448180-86448202 TTCCATAGAAGGATGGAGCCTGG + Intronic
1099972280 12:89512646-89512668 CTCCAGAGGCTGAGGGAGGCGGG + Intronic
1103402174 12:120650524-120650546 CGGCACAGACGGAGGGAGGCTGG + Intronic
1103411050 12:120711211-120711233 ACCCAAAGAGGGAGGGAGGCCGG - Intronic
1104218385 12:126757636-126757658 CTACAAAGATGGAGAGAGTCAGG + Intergenic
1104230922 12:126883243-126883265 CTCCAAAGGGAGAGGGTGCCTGG + Intergenic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104810594 12:131617915-131617937 CTCCAGGCACGCAGGGAGCCAGG + Intergenic
1107861063 13:44661278-44661300 CTGGAAAGATGGAGGCAGCCAGG + Intergenic
1109291256 13:60478087-60478109 CTCCAAAGACTGAATGAACCAGG - Intronic
1111676995 13:91399449-91399471 CCTCCAAGACGAAGGGAGCCGGG - Intronic
1113591812 13:111506724-111506746 CCCCAAAGAGGAAGGGAGACAGG - Intergenic
1113876559 13:113598222-113598244 CCCCAAAGACAGCGGGAGGCAGG + Intronic
1117843294 14:59883087-59883109 GTCCATAGACAGAAGGAGCCTGG - Intergenic
1121813739 14:96913436-96913458 CTCACAAGATGGAAGGAGCCTGG + Intronic
1122205884 14:100147718-100147740 CTCTCAGGACGCAGGGAGCCTGG + Intronic
1123765812 15:23477581-23477603 CTTCATAGTCGGGGGGAGCCTGG + Intergenic
1124566683 15:30822104-30822126 CTCAGTAGAGGGAGGGAGCCAGG - Intergenic
1126136503 15:45397378-45397400 CTCCAGAGAGGGACGGAGGCTGG + Intronic
1126845384 15:52755248-52755270 CTCCAGGGATGGAGGGAGCCGGG - Intergenic
1127703907 15:61528384-61528406 CCCCAAAGAGTGAGCGAGCCAGG + Intergenic
1130550676 15:84888417-84888439 CTCCACAGACGGTGGGTGCATGG + Intronic
1131524399 15:93141492-93141514 CTGCAAAGTCGGGGTGAGCCTGG - Intergenic
1131956617 15:97742805-97742827 CTCCAAAGCCTTAGGAAGCCTGG + Intergenic
1132662528 16:1068030-1068052 GTCCAGAGACAGAGGGAGCTGGG - Intergenic
1132891524 16:2207130-2207152 CTCCAAAGTCCCAGGGTGCCTGG - Intronic
1133212776 16:4272473-4272495 CTCCAAGGAAGGAGGGTCCCGGG + Intronic
1134430402 16:14199212-14199234 CTAAAAAGGCGGAGGGAACCAGG - Intronic
1136551189 16:30983454-30983476 CCCCAAAGAGGGAGGGCTCCTGG + Intronic
1138093708 16:54195983-54196005 GTCCAGAGAGGGAGGGAGGCAGG + Intergenic
1138456242 16:57122370-57122392 CTCCAAATAAGGTGGGAGTCTGG - Intronic
1139583063 16:67884658-67884680 CTCCATAGAAGGAGGGAGAAGGG - Intergenic
1139821769 16:69726682-69726704 CTCCAGGAAGGGAGGGAGCCTGG + Exonic
1140068469 16:71628772-71628794 CTAGAAAGACTGTGGGAGCCTGG + Intronic
1140144803 16:72296184-72296206 CTCCAAGGAGGGGGTGAGCCAGG + Intergenic
1140306119 16:73804888-73804910 CACCAAAGAGGGAGGGAGGGAGG + Intergenic
1142875467 17:2849608-2849630 CTCCAAAGGCTGAGGGGGCCTGG - Intronic
1143459107 17:7089129-7089151 CAATAAATACGGAGGGAGCCGGG + Intergenic
1144745231 17:17609475-17609497 AGCCACAGACGGAAGGAGCCTGG + Intergenic
1146410967 17:32584592-32584614 CTCCAAAGGCTGAGGCAGGCAGG - Intronic
1148455572 17:47809278-47809300 CTCCAGAGACAGAGGCTGCCGGG + Intronic
1149186135 17:54000140-54000162 CCCCAATGATGGAGGGAGCAAGG - Intergenic
1149207664 17:54267206-54267228 CCCCAAAGACAGAGGGAGGCGGG + Intergenic
1152108977 17:78346755-78346777 CTCCACAGAAGGATGGTGCCCGG + Intergenic
1152570787 17:81120471-81120493 CTCCAAGGCCGCAGGGAGGCCGG + Exonic
1154959357 18:21292521-21292543 TGCCAAAGACTGAGGGAGGCAGG - Intronic
1157260705 18:46173831-46173853 CTCAACAGAAGGAGGGAGCGCGG + Intronic
1157359170 18:46962917-46962939 CCCCGAGGCCGGAGGGAGCCTGG + Exonic
1157360164 18:46968844-46968866 CCCCGAGGCCGGAGGGAGCCTGG + Exonic
1157360765 18:47022436-47022458 CCCCGAGGCCGGAGGGAGCCTGG + Exonic
1157361754 18:47028351-47028373 CCCCGAGGCCGGAGGGAGCCTGG + Exonic
1160797112 19:950681-950703 CTCCAAGGTCGGAGGGACCAAGG - Intronic
1160879125 19:1311556-1311578 CGCCAAAGACGAAGGCAGCCGGG + Intergenic
1163458715 19:17423906-17423928 CTGTAAAGACTGAAGGAGCCAGG + Intronic
1163562584 19:18029005-18029027 CTAAAAAAAAGGAGGGAGCCAGG + Intergenic
1164958476 19:32406235-32406257 CTCCAAGGACAGGGGCAGCCGGG - Exonic
1165490150 19:36118757-36118779 CTCCAAGGTGGGAGGGAGCGCGG + Intronic
1166948773 19:46412929-46412951 CTCCAAAGAATGAGGCAGTCGGG + Exonic
1168254839 19:55159642-55159664 CTCCAAATCCGGAGGGAGGATGG + Intronic
926286669 2:11494159-11494181 CTCCAAAGTGGGAGAGAGGCTGG + Intergenic
927856978 2:26533984-26534006 CTACAAACAAGGAGGGACCCTGG - Intronic
927920870 2:26970969-26970991 CGCCAAGGCCGGAGGGAACCCGG - Intronic
929986266 2:46736041-46736063 CTCAAAAGAGGGAGGGAGAGAGG - Intronic
932399875 2:71473024-71473046 GGCCAAAAAGGGAGGGAGCCAGG - Intronic
932768847 2:74489352-74489374 CCCCAAGGCTGGAGGGAGCCTGG + Intronic
935264761 2:101384751-101384773 CTCGAAAGACTGAGGCAGCAGGG + Intronic
936151966 2:110026988-110027010 CTCCCAAGGCAGAAGGAGCCTGG + Intergenic
936192712 2:110344425-110344447 CTCCCAAGGCAGAAGGAGCCTGG - Intergenic
937498519 2:122451038-122451060 CACCAAAGAGGGAGGCAGGCTGG - Intergenic
937821281 2:126313632-126313654 ATCCAAACAAGGAGGGAGGCAGG + Intergenic
941670130 2:168284069-168284091 TTCCCAAGGCAGAGGGAGCCTGG + Intergenic
942189042 2:173453231-173453253 CTGCTCAGAGGGAGGGAGCCAGG + Intergenic
947517262 2:230816842-230816864 CTCACAAGAAGTAGGGAGCCAGG + Intronic
947952533 2:234160611-234160633 CTCCAATGTTGGAGGGGGCCTGG - Intergenic
948351610 2:237345594-237345616 CTTTAGACACGGAGGGAGCCAGG - Intronic
948542807 2:238702395-238702417 CTCCCAGGAAGGAGGCAGCCGGG + Intergenic
948645623 2:239401827-239401849 CTGCTCAGGCGGAGGGAGCCCGG + Exonic
1170089450 20:12574353-12574375 CTCCAAAGAAGTTGGCAGCCTGG + Intergenic
1170709073 20:18774024-18774046 CTCAAAAGAGAGAGAGAGCCTGG + Intergenic
1171156723 20:22881105-22881127 CTCCAAGGATGGAGGAAGGCAGG + Intergenic
1176047844 20:63101946-63101968 CTCCCAAGACGGAGGGCACCGGG - Intergenic
1179801784 21:43814649-43814671 CTGCGGAGAGGGAGGGAGCCAGG + Intergenic
1182105276 22:27684780-27684802 CTCCAAAGAGGGAGGATGCTGGG + Intergenic
1182423143 22:30258082-30258104 GTCCTGAGACGTAGGGAGCCGGG + Intergenic
1183718931 22:39550945-39550967 CGCCAAGGAGGAAGGGAGCCAGG + Intergenic
1184164304 22:42718842-42718864 CCCCAAAGAAGGAGGCAGCTGGG + Intronic
1184449171 22:44572800-44572822 CTCCAAAGAAGGTGGGAGAGTGG + Intergenic
1184696661 22:46143195-46143217 CTCCAAAGTCTCAGGGAGCCAGG + Intergenic
1185413250 22:50697012-50697034 CTGCCAAGCCCGAGGGAGCCTGG + Intergenic
949107097 3:212621-212643 CTGCAAAGCAGTAGGGAGCCAGG - Intronic
949903492 3:8839040-8839062 CTCCACAGTCGGAGTGGGCCAGG + Intronic
950579638 3:13853885-13853907 CTTCAAGGCAGGAGGGAGCCTGG + Intronic
950580433 3:13858425-13858447 CTCCAGAGACTGAGAGACCCAGG - Intronic
954082939 3:48223200-48223222 CTCCAGAGAGGAAGAGAGCCAGG - Intergenic
956644979 3:71446449-71446471 CCCTAAGGAGGGAGGGAGCCAGG + Intronic
956749328 3:72333721-72333743 CTCCAAAGGAGGAGGGAGAAGGG + Intergenic
957269154 3:78006615-78006637 TTCCAAAGACGGTGTCAGCCAGG - Intergenic
957897857 3:86446785-86446807 ATCCAAAGACTTAGGGAGACTGG + Intergenic
960351142 3:116594627-116594649 CTCCAAGGAAGCAGGAAGCCAGG - Intronic
960635738 3:119782647-119782669 CTCCAAGGACTGTGGGAGCTGGG + Intronic
961364946 3:126393886-126393908 CTCCCAAGATGGAAGGAGCAGGG - Intergenic
968066129 3:195760709-195760731 CTGCAAGGATGGAGAGAGCCAGG + Intronic
968335157 3:197907314-197907336 ATCCAAAGATGTAGGGAGACAGG - Intronic
968628180 4:1637417-1637439 CTCGAGGGACAGAGGGAGCCTGG + Intronic
969230447 4:5826781-5826803 CTGCAGAGAAGGAGGGAGCCAGG - Intronic
969448143 4:7257135-7257157 CTCCAGGGCCCGAGGGAGCCCGG - Intronic
970213779 4:13737679-13737701 GGTCAGAGACGGAGGGAGCCAGG + Intergenic
970522374 4:16898754-16898776 CTCCAGAGAGGGAGGGAGGTTGG + Exonic
975736821 4:77389230-77389252 CCCCAAAGTAGGAGGGACCCGGG + Intronic
977356996 4:95958380-95958402 CTGCAAAGACGTATAGAGCCAGG + Intergenic
979766760 4:124472755-124472777 ATCCAAAGACTTAGGGAGACTGG + Intergenic
986340462 5:6784695-6784717 CTTTAGAGAAGGAGGGAGCCAGG + Intergenic
987756487 5:22103269-22103291 CTCCTAAGACAGACAGAGCCAGG - Intronic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
990718598 5:58667462-58667484 ATGAAAAGATGGAGGGAGCCTGG + Intronic
999731621 5:154479791-154479813 GTCCAAAGACAGAGGGAGAAAGG + Intergenic
1000706031 5:164513050-164513072 CTCCACAGAGGGAGCGAGCTTGG + Intergenic
1001421105 5:171587890-171587912 CCCTATAGAGGGAGGGAGCCTGG + Intergenic
1001849593 5:174951978-174952000 CCCCAAAGACGAAAGGGGCCTGG + Intergenic
1001868756 5:175131593-175131615 CCTGAAAGACGCAGGGAGCCTGG - Intergenic
1002445176 5:179286321-179286343 CTCCAAGGAGGCAGGGAGGCTGG - Intronic
1006863459 6:37189415-37189437 CTTCAAAGACAGAGGGAAACAGG + Intergenic
1006914689 6:37586569-37586591 CTGCTAAGAGGGAGGGAGCTTGG - Intergenic
1007107612 6:39294511-39294533 AGTCAAAGACGGAAGGAGCCTGG + Intergenic
1007286049 6:40748226-40748248 CACCAAAACCAGAGGGAGCCTGG - Intergenic
1007747551 6:44052195-44052217 TTCCAAAGACGGATCCAGCCAGG + Intergenic
1012391528 6:98746593-98746615 ATCCAAAGGCAGAGGGAGCTGGG - Intergenic
1015739625 6:136439917-136439939 CTTCAAAGAAGGAGCGAGACCGG - Intronic
1016407108 6:143742290-143742312 CTCAAAAGAGGGAGCGAGACAGG - Intronic
1018899245 6:168043044-168043066 CTACACAGCCGGAGGGACCCAGG - Intronic
1018920622 6:168169879-168169901 GTCCAAAGAAGGAGGGACCAGGG - Intergenic
1019504918 7:1385962-1385984 CTCCTATGCCGCAGGGAGCCAGG + Intergenic
1019658962 7:2213169-2213191 CTTCAAAGAAGGCGGGACCCCGG + Intronic
1021998375 7:26201730-26201752 ATCCGAAGGGGGAGGGAGCCGGG - Intronic
1024135839 7:46407066-46407088 CTCCTAAAACAGAGGGAGCCTGG + Intergenic
1030585721 7:111416513-111416535 CTCCAAAGACAGAGGGAAAGTGG - Intronic
1030791439 7:113733961-113733983 CTCCAAGGAAGGAGGGGGACTGG + Intergenic
1034564177 7:151900100-151900122 CCCCAAGGCAGGAGGGAGCCTGG - Intergenic
1034788618 7:153947758-153947780 CTCCAAAGGCAGAGGCAGCCGGG - Intronic
1035133249 7:156675295-156675317 CTCCAAAGACGGAGGGAGCCGGG - Intronic
1035227366 7:157441133-157441155 TTCCAAAGGCTGAGGAAGCCAGG + Intergenic
1035526089 8:314510-314532 CTGCTCAGAGGGAGGGAGCCTGG + Intergenic
1037090821 8:14915747-14915769 CTCCAAAAAAGCAGGGAGGCAGG - Intronic
1037848198 8:22303501-22303523 CTCCAGAGACTGAGGGAGGTGGG - Intronic
1039476155 8:37840375-37840397 CTCCAAAGACGGGGGAGGCTAGG + Intronic
1041906741 8:63040739-63040761 TTCCAAAGATGGAGGAAGCTGGG - Intergenic
1044625515 8:94232563-94232585 CTCCAAAGAGGCAGGAAACCAGG + Intergenic
1045865296 8:106858365-106858387 CTCCTAAGAGGGGTGGAGCCAGG + Intergenic
1047301680 8:123618827-123618849 ATCCAGAGAGGGAGGGAGCAAGG - Intergenic
1047537540 8:125733470-125733492 CTGCTCAGTCGGAGGGAGCCTGG - Intergenic
1049152981 8:141047524-141047546 CTCAAAAGGAGGAGAGAGCCTGG + Intergenic
1049344115 8:142129334-142129356 TCCCAAAGTCGGAGGGAACCCGG + Intergenic
1051068320 9:13131822-13131844 CTCCAAAGACTGAGGGAGCTGGG - Intronic
1056255479 9:84795152-84795174 CTCCAAAGACAGAGGGAAGTGGG + Intronic
1056475672 9:86948740-86948762 CTCCAGAAGCAGAGGGAGCCGGG + Intergenic
1058091656 9:100812743-100812765 CTTCAAAGATGAAGGGAGGCGGG + Intergenic
1062690328 9:137838121-137838143 CTCCCAGGACTGACGGAGCCTGG - Intronic
1189280223 X:39816002-39816024 CTCCCTGGACTGAGGGAGCCAGG + Intergenic