ID: 1035133249

View in Genome Browser
Species Human (GRCh38)
Location 7:156675295-156675317
Sequence CTCCAAAGACGGAGGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 184}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133249_1035133266 27 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133266 7:156675345-156675367 TGTGACCCACTTTAGGGGTGGGG No data
1035133249_1035133257 0 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data
1035133249_1035133264 25 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133264 7:156675343-156675365 CCTGTGACCCACTTTAGGGGTGG No data
1035133249_1035133262 22 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133249_1035133260 20 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133260 7:156675338-156675360 AGGGTCCTGTGACCCACTTTAGG No data
1035133249_1035133261 21 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133249_1035133256 -3 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133256 7:156675315-156675337 GAGACGAGGGTGCCTCTCACAGG No data
1035133249_1035133265 26 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133265 7:156675344-156675366 CTGTGACCCACTTTAGGGGTGGG No data
1035133249_1035133258 1 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133258 7:156675319-156675341 CGAGGGTGCCTCTCACAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133249 Original CRISPR CTCCAAAGACGGAGGGAGCC GGG (reversed) Intronic