ID: 1035133250

View in Genome Browser
Species Human (GRCh38)
Location 7:156675296-156675318
Sequence TCTCCAAAGACGGAGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 216}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133250_1035133260 19 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133260 7:156675338-156675360 AGGGTCCTGTGACCCACTTTAGG No data
1035133250_1035133258 0 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133258 7:156675319-156675341 CGAGGGTGCCTCTCACAGGAGGG No data
1035133250_1035133257 -1 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data
1035133250_1035133261 20 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133250_1035133256 -4 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133256 7:156675315-156675337 GAGACGAGGGTGCCTCTCACAGG No data
1035133250_1035133265 25 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133265 7:156675344-156675366 CTGTGACCCACTTTAGGGGTGGG No data
1035133250_1035133262 21 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133250_1035133266 26 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133266 7:156675345-156675367 TGTGACCCACTTTAGGGGTGGGG No data
1035133250_1035133264 24 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133264 7:156675343-156675365 CCTGTGACCCACTTTAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133250 Original CRISPR TCTCCAAAGACGGAGGGAGC CGG (reversed) Intronic
900415463 1:2532582-2532604 GCTCCAAAGCCTGCGGGAGCAGG - Intergenic
900465536 1:2823593-2823615 TCTCCTAAGAGGGAGGCAGGAGG - Intergenic
900671569 1:3857789-3857811 TCTTCCAAAACGGAGGGTGCAGG + Intronic
904044834 1:27603036-27603058 AATCCAAAGGCGGAGGGAGGGGG + Intronic
905465750 1:38151795-38151817 CCTATAAAGACGGAGGAAGCTGG - Intergenic
905659809 1:39712797-39712819 ACTCCTAAGACTGAGGGAACTGG - Intronic
905696722 1:39980030-39980052 TGTACAGAGACGGAGGGAGGGGG - Intergenic
907592682 1:55690747-55690769 TTTCCATAAAAGGAGGGAGCTGG - Intergenic
907759543 1:57343799-57343821 TCCCCAAAAGCTGAGGGAGCTGG + Intronic
912625612 1:111203188-111203210 ACTACAAAGAGGGAAGGAGCAGG + Intronic
915544128 1:156586332-156586354 GCTCCAGAGAAGGAGGGAGTTGG - Intronic
916843392 1:168623941-168623963 TCTCCACAGAAGGAGCAAGCGGG - Intergenic
918423824 1:184388109-184388131 CCTCCGTAGAGGGAGGGAGCAGG - Intronic
919824155 1:201492044-201492066 GCTCCCAAGAAGGAGGGAGAGGG + Intronic
919837174 1:201582963-201582985 TCTCCAAAGACTAGGGGAACAGG - Intergenic
920679964 1:208064796-208064818 TCTCCAGAGCGGGAGTGAGCAGG + Intronic
921783157 1:219192834-219192856 TCTTAAAAGATGGAGGGAGTAGG + Intronic
922637165 1:227185645-227185667 TCTACAGAGACAGAGGGAGGGGG - Intronic
923682020 1:236126138-236126160 TCTTCAAAGAGGGAGAGGGCAGG - Intergenic
923703389 1:236321376-236321398 TCTGCAAAGACTGAGAGAGGTGG + Intergenic
1063369630 10:5512632-5512654 TCTCCAAAGGCGCACGGAGGAGG - Intergenic
1067314819 10:45151455-45151477 TATCCAAAGACTGAGGGAGGTGG + Intergenic
1067970816 10:50968419-50968441 TCTCCTAGGAAAGAGGGAGCAGG - Intergenic
1068319592 10:55394059-55394081 TCTTCAAAGAGGGAAGGGGCTGG - Intronic
1068647298 10:59481826-59481848 TTTCCAAAAAGGGAGGGTGCAGG - Intergenic
1068792240 10:61040639-61040661 TCCCCACAGGCTGAGGGAGCCGG - Intergenic
1069834868 10:71302092-71302114 CCTCCACAGACGGATGGAGTCGG - Exonic
1071237067 10:83661529-83661551 TGTCCAAAGACTGAGAGAGGTGG - Intergenic
1071938688 10:90561710-90561732 TCTCCAAAGACTCAGAGAACTGG - Intergenic
1072054579 10:91741386-91741408 TTTCCAAATAGGGAGGGAGAAGG - Intergenic
1075961071 10:126568092-126568114 TCTCCACAGCCAGAGGGAGGAGG + Intronic
1076198262 10:128536450-128536472 TGTCCAGAGAGGGACGGAGCAGG + Intergenic
1077007026 11:363222-363244 TCTCCCCAGACGGTGGGGGCCGG - Intergenic
1077007123 11:363539-363561 TCTCTCCAGACGGTGGGAGCCGG - Intergenic
1077007241 11:363916-363938 TCTCCCCAGACGGTGGGGGCCGG - Intergenic
1078332411 11:10436145-10436167 TATTGAAAGACAGAGGGAGCAGG + Intronic
1078547351 11:12255980-12256002 TCTCCAAAGCCACAGAGAGCAGG - Intronic
1078986779 11:16605460-16605482 TGTCCAAAAACGGGGGGAGGGGG + Intronic
1080723345 11:34870751-34870773 TATCCAGTGACTGAGGGAGCAGG - Intronic
1084091215 11:66880389-66880411 TCCCCAAAGCCGAAGGGAGCAGG + Intronic
1084746071 11:71170739-71170761 TCTCCAAAGAGGCAAGGAGCTGG + Intronic
1084751816 11:71209128-71209150 TCACCACAGATGGAAGGAGCTGG + Intronic
1084970089 11:72766710-72766732 TCTCCCAAGACCCAGGGAGATGG + Intronic
1085695955 11:78704961-78704983 TCTGCAGGGACAGAGGGAGCTGG - Intronic
1085726599 11:78960358-78960380 TTTCCAAAGACAGTGGAAGCGGG + Intronic
1086437098 11:86792240-86792262 TCCCCAAGGACGGAGGAAGTTGG - Intronic
1087622057 11:100554009-100554031 TCTCCAAAGAGGGGAAGAGCCGG - Intergenic
1090839352 11:130475075-130475097 TCTCCAAAGACTGAGTGTGGTGG - Exonic
1091703528 12:2679243-2679265 GCTCCAGAGAGGGAGGGACCCGG - Intronic
1092193802 12:6537287-6537309 GCTGCAAAGAAAGAGGGAGCGGG - Exonic
1094293220 12:28875008-28875030 TCTACACACACTGAGGGAGCCGG + Intergenic
1101277723 12:103220699-103220721 TCAGAAAAGAGGGAGGGAGCGGG - Intergenic
1101307786 12:103546876-103546898 TCTCCAAAGACACAGGGACACGG + Intergenic
1102340915 12:112121022-112121044 CCTCAAAAGACAGAGGGAGCTGG + Intergenic
1103459704 12:121093900-121093922 TCTCCACAAGCCGAGGGAGCCGG + Intergenic
1103564445 12:121808422-121808444 TCTCCAAAGCTGGAGTGAGGTGG - Intronic
1104366868 12:128185988-128186010 TCTCCAAAGGCAGAGAGAGCGGG - Intergenic
1104476251 12:129072884-129072906 TCTTCAAAGACGGACGGCGTGGG + Exonic
1105763104 13:23531521-23531543 TCCCCACAAACAGAGGGAGCCGG - Intergenic
1105826133 13:24125264-24125286 TCTCCTAACACGGCGGGAGAGGG + Intronic
1107895350 13:44956394-44956416 TTTCCAAAGACAGAGGGTGGGGG + Intronic
1111044538 13:82797238-82797260 TGTCCAAAGGCTGAGGGAGTTGG - Intergenic
1111573589 13:90119324-90119346 TTTCTAAAGACGGAAGCAGCTGG - Intergenic
1111676997 13:91399450-91399472 TCCTCCAAGACGAAGGGAGCCGG - Intronic
1113280343 13:108781603-108781625 TCTCCAAAGACAGAGAGCTCTGG + Intronic
1114493902 14:23119571-23119593 TTTTCAAAGTCGGAGGGAGGAGG - Exonic
1115603967 14:34982150-34982172 GCTCCAAAGACGAAGCGGGCTGG + Intronic
1117165577 14:53029374-53029396 TCTCCAAATACTGAGGTAACTGG - Intergenic
1117183696 14:53217886-53217908 TCTCCACAAGCAGAGGGAGCTGG + Intergenic
1119693199 14:76692748-76692770 TCTTCAAAGAGGGAGGCAGAGGG - Intergenic
1121134356 14:91481643-91481665 TCTTCAAAGACCGAAGGAGTTGG + Exonic
1121418970 14:93799001-93799023 TCTTGAAAGAGGGAGGGAGAGGG - Intergenic
1122627581 14:103092097-103092119 TCTCCAAGGTCGTGGGGAGCTGG + Intergenic
1125050612 15:35294229-35294251 TCTTCAAGGACTGAGGGAGTAGG - Intronic
1126845385 15:52755249-52755271 TCTCCAGGGATGGAGGGAGCCGG - Intergenic
1129156320 15:73720515-73720537 TATCCAAGGATGGGGGGAGCTGG - Intergenic
1131158511 15:90089674-90089696 TTTCCACAGTTGGAGGGAGCTGG - Intronic
1132662529 16:1068031-1068053 CGTCCAGAGACAGAGGGAGCTGG - Intergenic
1134875059 16:17690776-17690798 TCACCAAGGAGGGATGGAGCTGG + Intergenic
1139508112 16:67409747-67409769 TCTCCAACGACGTAGCCAGCTGG + Intronic
1139528013 16:67528541-67528563 TCTCCAGAGCCCGAGGGATCTGG + Intronic
1139583064 16:67884659-67884681 ACTCCATAGAAGGAGGGAGAAGG - Intergenic
1141019835 16:80484864-80484886 TCTCCAAAAACGGAGTGCTCTGG + Intergenic
1141693838 16:85611036-85611058 TCTCCAAGGAAGAAGGGAGTAGG + Intergenic
1142419821 16:89963341-89963363 TCTGCAAACAAGGCGGGAGCAGG - Exonic
1143459106 17:7089128-7089150 TCAATAAATACGGAGGGAGCCGG + Intergenic
1143880546 17:10026495-10026517 TCCCCAACCACGGAGGCAGCTGG + Intronic
1144150597 17:12439666-12439688 TGTACAGAGACAGAGGGAGCGGG + Intergenic
1149207662 17:54267205-54267227 TCCCCAAAGACAGAGGGAGGCGG + Intergenic
1149947096 17:60941037-60941059 TCTCCAAAATCTGAGGTAGCTGG - Intronic
1150520889 17:65865930-65865952 TCTACACAGCCGGTGGGAGCTGG + Intronic
1151179655 17:72317778-72317800 TCTCCAAAGAGTCAGGGAGTAGG + Intergenic
1155423585 18:25682344-25682366 TCTCCTAAGAAAGAGTGAGCAGG - Intergenic
1155925905 18:31654991-31655013 TATTCAAAGAAGGAGGGAGAAGG + Intronic
1156366046 18:36428389-36428411 CCTCCAAAGATGGAGGAAGGGGG - Intronic
1156466182 18:37349016-37349038 TCTCCAAAGGTGGAATGAGCTGG + Intronic
1156507635 18:37608508-37608530 TCTTCAGAGGCTGAGGGAGCTGG + Intergenic
1157244528 18:46041584-46041606 TCTCCAAGGTTGGAGGGACCAGG + Intronic
1160112041 18:76042301-76042323 TCTCCTAAGCCAGAGGTAGCAGG + Intergenic
1160672681 19:373715-373737 TGTCCAGAGAAGGAGGTAGCTGG + Intronic
1160879124 19:1311555-1311577 TCGCCAAAGACGAAGGCAGCCGG + Intergenic
1161680926 19:5679448-5679470 TCCCCAGAGGCGGAGGGAGGAGG + Intronic
1162555360 19:11383053-11383075 CCTCCAAGGGCGGAGGGAGGGGG - Intronic
1162760866 19:12887441-12887463 TCTCCAAAGAAGGAGAGACTTGG + Intergenic
1164958477 19:32406236-32406258 TCTCCAAGGACAGGGGCAGCCGG - Exonic
1165803719 19:38567849-38567871 CCTCCAAAGAAGGAGGAAGCTGG + Exonic
1166226406 19:41398268-41398290 TCTCCAAACCCTGAGGGAGAAGG - Intronic
1166682517 19:44777793-44777815 TCTCCAAAGGGGGCGGGGGCTGG - Intergenic
926097441 2:10091370-10091392 TCCCCACAGGCTGAGGGAGCAGG - Intergenic
929788859 2:45009761-45009783 TGCCCAAAGAGGGAGGGAGGAGG + Intergenic
930621314 2:53646781-53646803 TGTACAAAGACAGAGGGAGAGGG + Intronic
932692181 2:73922277-73922299 TCCCCAAAGACTGAAGGAGCTGG + Intergenic
933713979 2:85346880-85346902 TGACCAGAGACGGATGGAGCTGG - Intronic
934166099 2:89295863-89295885 TGTACAAAGACAGAGGGAGGGGG + Intergenic
934201177 2:89886593-89886615 TGTACAAAGACAGAGGGAGGGGG - Intergenic
935234726 2:101128934-101128956 TTACCATAGAGGGAGGGAGCAGG + Intronic
935264760 2:101384750-101384772 ACTCGAAAGACTGAGGCAGCAGG + Intronic
935522184 2:104121462-104121484 TCTGGAAAGACGGTGGAAGCTGG + Intergenic
935824655 2:106932886-106932908 TCTCCAGAGCAGGAGGGTGCAGG + Intergenic
936585688 2:113756227-113756249 TCTCTAGGGGCGGAGGGAGCGGG - Intronic
940971137 2:159898221-159898243 TCTCGAGAGACTGAGGCAGCAGG - Intronic
942219398 2:173754808-173754830 TCTGCATGGACAGAGGGAGCAGG - Intergenic
942429852 2:175898969-175898991 TCTGCAAAGACTGATGGAGATGG - Intergenic
942547982 2:177084334-177084356 TCTGCAGAGAGGGAAGGAGCTGG + Intergenic
943060559 2:183038196-183038218 TCTCCTAAGGCGGAGGTCGCGGG - Exonic
944748052 2:202678245-202678267 TATACAGAGACGGAGGGAGTGGG + Intronic
945628483 2:212240349-212240371 TCTCTAAAGACGAAGGGGGCAGG + Intronic
1169236311 20:3932722-3932744 GCTCCTAAGATGGAGGGAGGCGG + Exonic
1170866467 20:20162185-20162207 TCTGCTAAGAGGGAGGCAGCAGG - Intronic
1170946453 20:20895319-20895341 TCTCAAAATAGAGAGGGAGCAGG + Intergenic
1171304284 20:24091956-24091978 TCTCCAGAGATGGGAGGAGCTGG - Intergenic
1171973481 20:31578953-31578975 TCCCCGAAGGCTGAGGGAGCCGG + Intergenic
1173831458 20:46091819-46091841 TCCCCGAAAGCGGAGGGAGCCGG - Intergenic
1174611756 20:51802763-51802785 TCTCCAAGGACTGAGATAGCTGG - Intergenic
1176047845 20:63101947-63101969 ACTCCCAAGACGGAGGGCACCGG - Intergenic
1176065072 20:63190242-63190264 TCTCCAAAGATGGTGGCAGGTGG - Intergenic
1177439467 21:21101913-21101935 TATCCAAAGACAGTGAGAGCTGG - Intronic
1178538601 21:33430628-33430650 TCTGTAGAGACGGAGGGAGGGGG + Intronic
1181531597 22:23520592-23520614 TCTAGAAAGAAGGAGGGAGTAGG + Intergenic
1182105275 22:27684779-27684801 CCTCCAAAGAGGGAGGATGCTGG + Intergenic
1184164302 22:42718841-42718863 TCCCCAAAGAAGGAGGCAGCTGG + Intronic
1184233176 22:43169285-43169307 GCTCCTGAGAGGGAGGGAGCTGG - Intronic
949758384 3:7439872-7439894 TTTGGAAAGACAGAGGGAGCTGG + Intronic
950958446 3:17079661-17079683 TCACCAAAGACGGAGGGTTGGGG - Intronic
952090910 3:29884493-29884515 TCTCCAAAGACAGAGAAAGAGGG - Intronic
952573127 3:34741839-34741861 TCTCCAAGGAGTGAAGGAGCAGG - Intergenic
955591107 3:60536721-60536743 TCTCCGAAGTGGGAGGGAGATGG + Intronic
956749327 3:72333720-72333742 ACTCCAAAGGAGGAGGGAGAAGG + Intergenic
960464793 3:117984257-117984279 TGTCCAAAAAAGGAGTGAGCAGG - Intergenic
960635737 3:119782646-119782668 CCTCCAAGGACTGTGGGAGCTGG + Intronic
960662905 3:120080287-120080309 TCTCCAAAAAAGGTGGGAGGAGG + Intronic
961364947 3:126393887-126393909 GCTCCCAAGATGGAAGGAGCAGG - Intergenic
968719235 4:2187772-2187794 TCTCAACAGAAGGAGGGAGTGGG + Intronic
969484938 4:7466930-7466952 TCTCCAAAGAGAAAGGCAGCAGG - Intronic
970328847 4:14957772-14957794 TCTCCACAGAAGGAGGAAGGAGG + Intergenic
973146264 4:46831009-46831031 TCCCCACAGGCTGAGGGAGCCGG - Intronic
975736819 4:77389229-77389251 TCCCCAAAGTAGGAGGGACCCGG + Intronic
976266529 4:83190584-83190606 TCTCCAAGGAAGAAGGGAGAAGG + Intergenic
977751934 4:100620353-100620375 TGTACAGAGACAGAGGGAGCAGG + Intronic
978092421 4:104734168-104734190 TCTCTAAAGACTGAGTGAGCAGG - Intergenic
979761106 4:124405879-124405901 GCTTTAAAGACGGAGGAAGCGGG + Intergenic
979834140 4:125340493-125340515 TCTCCAGAGACTGAGGCAGGAGG - Intronic
980698704 4:136395316-136395338 TCCCCACAGGCTGAGGGAGCCGG - Intergenic
981429943 4:144646544-144646566 ACTCCAGAGACAGAGGGAGGTGG - Exonic
981980384 4:150784675-150784697 TGTACAGAGACAGAGGGAGCGGG - Intronic
985563483 5:603665-603687 TCTGCTCAGACAGAGGGAGCTGG - Intergenic
986008129 5:3684940-3684962 TCCCCAGAGACAGAGGGACCAGG - Intergenic
986438160 5:7755596-7755618 TCTGCAAAGACAGAGGAGGCAGG + Intronic
990516413 5:56534875-56534897 TCTCCAGAGATGGAGGGTGGGGG - Intronic
991065158 5:62416574-62416596 TCTCCAAATACTGAGGGTTCGGG + Intronic
993939321 5:94040002-94040024 TCTCCTAAGACAGAGTGGGCTGG + Intronic
994197329 5:96935432-96935454 GCTCGAAGGACCGAGGGAGCGGG - Intronic
995738569 5:115329790-115329812 TGTACAGAGACAGAGGGAGCGGG - Intergenic
998114084 5:139523423-139523445 TCACCAAAGCCTGAGGGAGAAGG + Intergenic
998527740 5:142858007-142858029 TCTCCAAAGAGAGAGGGAGAGGG + Intronic
998761540 5:145437744-145437766 TCTCTAAAAACAGAGGGAGAGGG - Intergenic
999931840 5:156441972-156441994 TATCCAAGGAAGGAGGTAGCAGG + Intronic
1000197536 5:158973902-158973924 TGGCAAAAGACTGAGGGAGCTGG - Intronic
1001843518 5:174901490-174901512 TCCCCACAGGCTGAGGGAGCTGG - Intergenic
1002581270 5:180210727-180210749 TTTCCAAAGACCTAGGGAGCAGG + Intergenic
1004499722 6:16198481-16198503 TCCCCACAGGCTGAGGGAGCCGG + Intergenic
1004647897 6:17580701-17580723 TCTCCGCAAACCGAGGGAGCCGG - Intergenic
1006381888 6:33703518-33703540 TCTCCAAGGCTGTAGGGAGCAGG + Intronic
1006499782 6:34450799-34450821 TGTCCAAAGGCGGAAGGAGGAGG + Intergenic
1008276857 6:49551916-49551938 TCTGCAAAGAGGGTGGGAGTGGG + Exonic
1008960717 6:57262808-57262830 TCTAGAAAGACGGTGGAAGCAGG - Intergenic
1012186953 6:96230195-96230217 ACTCCAAAGAGGGAGAGAGAGGG - Intergenic
1012391529 6:98746594-98746616 CATCCAAAGGCAGAGGGAGCTGG - Intergenic
1018920623 6:168169880-168169902 TGTCCAAAGAAGGAGGGACCAGG - Intergenic
1019790157 7:3006775-3006797 TCTGGAAAGAGGGAGGGAGTGGG + Intronic
1021420672 7:20442115-20442137 ACTCCAAAGAGGCAGGCAGCTGG + Intergenic
1023299590 7:38755360-38755382 ACTCCACAGACAGAAGGAGCTGG + Intronic
1024382279 7:48711233-48711255 TCTTCAAAGGCGAAGTGAGCTGG - Intergenic
1026650708 7:72213775-72213797 GCTCCAAACAGGGAGGGAGAAGG + Intronic
1027286196 7:76648025-76648047 TCCACAAAGACGGAAAGAGCTGG + Intergenic
1028727132 7:94100862-94100884 TCCCCACAAACAGAGGGAGCCGG - Intergenic
1029124305 7:98286259-98286281 TCACCAAGGACAGAGGGGGCTGG - Intronic
1031528582 7:122850451-122850473 TCTCCAAAGCTGGAGGCAGTTGG - Intronic
1031532637 7:122894949-122894971 TTTCCACAGACGGTGGGGGCAGG + Intergenic
1031855241 7:126914763-126914785 TCCCCAAGGATGGAGGGAGTGGG + Intronic
1032502775 7:132412449-132412471 TGGGCAAAGACGAAGGGAGCAGG + Intronic
1033233981 7:139623781-139623803 TCTCCAGAGTCAGAGGGGGCTGG - Intronic
1034788619 7:153947759-153947781 TCTCCAAAGGCAGAGGCAGCCGG - Intronic
1035133250 7:156675296-156675318 TCTCCAAAGACGGAGGGAGCCGG - Intronic
1035168699 7:157006140-157006162 CCTCCGCAGACGGAGGGCGCGGG - Intronic
1037189491 8:16105652-16105674 TCTGCAAATACTGAGGGAGATGG - Intergenic
1037345996 8:17902015-17902037 TCTGTAAAGAAGGAGGCAGCAGG + Intronic
1037848199 8:22303502-22303524 ACTCCAGAGACTGAGGGAGGTGG - Intronic
1040610265 8:48976825-48976847 TCTCCAAAGACAGAAGGAAGGGG + Intergenic
1041906742 8:63040740-63040762 CTTCCAAAGATGGAGGAAGCTGG - Intergenic
1042401927 8:68359747-68359769 CCTACAAAGACCGAGGGTGCAGG - Intronic
1044261205 8:90124684-90124706 TGTCCAAAGAATGAGAGAGCTGG + Intergenic
1050260961 9:3840688-3840710 TCTCCAAGGACAAAGGGACCAGG - Intronic
1051068321 9:13131823-13131845 CCTCCAAAGACTGAGGGAGCTGG - Intronic
1051498909 9:17755907-17755929 TCTCTAAAGACTGAGACAGCTGG + Intronic
1055673906 9:78635392-78635414 TCTTCAAAGAAGGTGGGAGGAGG + Intergenic
1056255478 9:84795151-84795173 TCTCCAAAGACAGAGGGAAGTGG + Intronic
1056475671 9:86948739-86948761 TCTCCAGAAGCAGAGGGAGCCGG + Intergenic
1056718777 9:89055686-89055708 TCTCCCAAGCAGGAGGGGGCTGG + Intronic
1056913975 9:90729442-90729464 TCTCCGCAAGCGGAGGGAGCCGG - Intergenic
1057556870 9:96095136-96095158 TTTCCAAATACGGGGGGTGCAGG + Intergenic
1057855311 9:98596769-98596791 CCTCCAAACGCGGAGGCAGCTGG - Intronic
1058954574 9:109933628-109933650 TCTTCAAAGATAAAGGGAGCTGG - Intronic
1058983951 9:110194981-110195003 TCCCCAAAGAGGTAAGGAGCTGG + Intronic
1059822598 9:117990694-117990716 TCGCCAAGGACGCAGGGGGCAGG - Intergenic
1061310876 9:129761686-129761708 TCTCCAGAGACAGAAGGAGAGGG - Intergenic
1061649000 9:132031046-132031068 TTTCCAAAGACTGAGGAAGTGGG + Intronic
1061931837 9:133837066-133837088 TGTCCAAAGTCACAGGGAGCAGG - Intronic
1203454927 Un_GL000219v1:157594-157616 TCTCCAACGCCAGAGGCAGCAGG - Intergenic
1185506556 X:635510-635532 TCCCCACAGCCGGAGGGAGGAGG - Intronic
1187874702 X:23794599-23794621 TCTCCCAAGCCAGAAGGAGCAGG + Intergenic
1187913697 X:24133487-24133509 TCTAAAAAGGGGGAGGGAGCAGG - Intergenic
1188736614 X:33725709-33725731 TGTCCAAAGGCGAAAGGAGCGGG + Intergenic
1188958247 X:36460313-36460335 ACTCCAAAGAAGGAGAGAGTGGG + Intergenic
1194756035 X:97741194-97741216 TCTCCAGAGAGGGAGGGAAGAGG - Intergenic
1199349058 X:146778434-146778456 TCTCCAAAGATGGTGGGAGATGG - Intergenic
1199483028 X:148318915-148318937 TGTCCCAAGAAGGATGGAGCAGG - Intergenic