ID: 1035133250

View in Genome Browser
Species Human (GRCh38)
Location 7:156675296-156675318
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 216}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133250_1035133265 25 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133265 7:156675344-156675366 CTGTGACCCACTTTAGGGGTGGG No data
1035133250_1035133264 24 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133264 7:156675343-156675365 CCTGTGACCCACTTTAGGGGTGG No data
1035133250_1035133260 19 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133260 7:156675338-156675360 AGGGTCCTGTGACCCACTTTAGG No data
1035133250_1035133256 -4 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133256 7:156675315-156675337 GAGACGAGGGTGCCTCTCACAGG No data
1035133250_1035133258 0 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133258 7:156675319-156675341 CGAGGGTGCCTCTCACAGGAGGG No data
1035133250_1035133266 26 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133266 7:156675345-156675367 TGTGACCCACTTTAGGGGTGGGG No data
1035133250_1035133261 20 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133250_1035133257 -1 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data
1035133250_1035133262 21 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133250 Original CRISPR TCTCCAAAGACGGAGGGAGC CGG (reversed) Intronic