ID: 1035133252

View in Genome Browser
Species Human (GRCh38)
Location 7:156675302-156675324
Sequence CCCTCGTCTCCAAAGACGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133252_1035133264 18 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133264 7:156675343-156675365 CCTGTGACCCACTTTAGGGGTGG No data
1035133252_1035133266 20 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133266 7:156675345-156675367 TGTGACCCACTTTAGGGGTGGGG No data
1035133252_1035133258 -6 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133258 7:156675319-156675341 CGAGGGTGCCTCTCACAGGAGGG No data
1035133252_1035133261 14 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133252_1035133262 15 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133252_1035133260 13 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133260 7:156675338-156675360 AGGGTCCTGTGACCCACTTTAGG No data
1035133252_1035133268 25 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133268 7:156675350-156675372 CCCACTTTAGGGGTGGGGAGAGG No data
1035133252_1035133256 -10 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133256 7:156675315-156675337 GAGACGAGGGTGCCTCTCACAGG No data
1035133252_1035133257 -7 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data
1035133252_1035133265 19 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133265 7:156675344-156675366 CTGTGACCCACTTTAGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133252 Original CRISPR CCCTCGTCTCCAAAGACGGA GGG (reversed) Intronic
900086777 1:902352-902374 CCCTCGTCTCAGAGGAAGGACGG + Intergenic
910312155 1:85836004-85836026 TCCTCATCTCCAAAAACGAAGGG + Intronic
1062838721 10:652977-652999 CCCACGTCCCCAAAGACCAAGGG + Intronic
1063369633 10:5512638-5512660 ACCTCATCTCCAAAGGCGCACGG - Intergenic
1072540893 10:96397250-96397272 CCCTCGTCTCCACGGACAGCCGG - Exonic
1076646277 10:131957206-131957228 CCTTCATCTCCACAGGCGGACGG - Intronic
1083001749 11:59298593-59298615 ACCCTGTCTCCAAAGAAGGAAGG + Intergenic
1084315298 11:68342328-68342350 CCCTCTTCTCCAAAGGGGAAAGG - Intronic
1086096284 11:83053083-83053105 CCCTGGGCTCCATAGATGGAAGG + Intronic
1086882739 11:92169042-92169064 CTCTCATCTCCCAAGACGGTGGG + Intergenic
1089986152 11:122815999-122816021 CCCTCATCTCTGAAGACAGAGGG - Intergenic
1090655440 11:128840157-128840179 GGCTAGTCTCCAAAGATGGAAGG - Exonic
1094286558 12:28800854-28800876 TCCTTATCTCCAAAGAGGGAGGG - Intergenic
1096636913 12:52965823-52965845 CCCTCGTCTCCTAAGAGGGTGGG + Intergenic
1104476248 12:129072878-129072900 CCAGCCTCTTCAAAGACGGACGG + Exonic
1104871428 12:132001085-132001107 CTCTCGTCTCCACACACGGTGGG - Intronic
1110219409 13:73058252-73058274 CCCTCCTCCCCACACACGGATGG + Intronic
1132178043 15:99731509-99731531 CCCTGGCCCCCAAAGAGGGAGGG - Intronic
1134537908 16:15041399-15041421 CCCTCGTCTACCAGGAAGGAGGG - Intronic
1141910423 16:87054831-87054853 CCTTCGTCTTCAAAGACAGCAGG - Intergenic
1144991798 17:19238086-19238108 GCCTGGTCCCCAAGGACGGAAGG - Intronic
1167733934 19:51279759-51279781 CTCTGGTCTTCAAAGACTGAGGG - Intergenic
1167734146 19:51281587-51281609 CTCTGGTCTTCAAAGACTGAGGG - Intergenic
929087817 2:38185846-38185868 CCCTCCTCTCCAAAAAGGAAAGG - Intergenic
947935616 2:234001117-234001139 TCCTCATCTCCAAAGACACAGGG - Intronic
948966100 2:241381528-241381550 CCCTCTTCTCCACAGCTGGAAGG + Intronic
1172061078 20:32187968-32187990 TCTTCGTCTCCAGAGAGGGAGGG - Intergenic
1176008203 20:62877489-62877511 CCATCGTCTCCAGAGCTGGATGG + Intergenic
1181492249 22:23267920-23267942 CTCTCTTCTGCAAAGACGGCCGG + Intronic
954305249 3:49722178-49722200 CACTTGTCTCCCAAGACTGAGGG + Intronic
961404899 3:126672136-126672158 CCCTCCCCTCCAAAGGCGCAGGG - Intergenic
963028461 3:140942419-140942441 CCCGCGTCTCCTCAGACGCATGG - Intronic
967228354 3:187314399-187314421 CCTTCATCTCCGAAGAAGGAAGG + Intergenic
973159226 4:46994287-46994309 CCCTCCTCTCCAGAAAAGGATGG - Exonic
979460897 4:120982139-120982161 TCCTCGTCTCCAACGACAGAGGG - Intergenic
981531279 4:145756024-145756046 CCTTCGTCCCCACAGACTGAAGG + Intronic
989168028 5:38449466-38449488 CCTTTCTCTCCAAAGATGGAAGG + Intronic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
1003260144 6:4509636-4509658 CCATCATCTCCAAAGAAGGCAGG - Intergenic
1004128625 6:12898293-12898315 CCTTCGTCTCCAAATACCGACGG + Intronic
1012565594 6:100645898-100645920 CCATGATCTCCAAAGACTGATGG - Intronic
1017047724 6:150363292-150363314 CCCTAGTCTCCAAAAATGCAAGG + Intergenic
1019057779 6:169235570-169235592 CCCTAGTCTGCACAGACGCAGGG + Intronic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1040610262 8:48976819-48976841 CCAGGGTCTCCAAAGACAGAAGG + Intergenic
1050357091 9:4793359-4793381 GCGTCGCCTCCAAAGCCGGAGGG + Intronic
1053479509 9:38405577-38405599 CCCTCTCCTCCAGGGACGGATGG - Intergenic
1055483559 9:76734179-76734201 CCCTCCTTTCCACAGAAGGAGGG - Intronic
1188338650 X:28971794-28971816 CCCTCATCCCCAAATACAGATGG - Intronic
1190037596 X:47040211-47040233 CCCTCTTCACCAAAGAAGGTCGG - Intronic
1194583055 X:95699831-95699853 TCCTCCTCTTCAAAGATGGATGG - Intergenic
1195718595 X:107843384-107843406 CCCTCATCTCCAGGGATGGATGG + Intronic