ID: 1035133254

View in Genome Browser
Species Human (GRCh38)
Location 7:156675303-156675325
Sequence ACCCTCGTCTCCAAAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133254_1035133260 12 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133260 7:156675338-156675360 AGGGTCCTGTGACCCACTTTAGG No data
1035133254_1035133258 -7 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133258 7:156675319-156675341 CGAGGGTGCCTCTCACAGGAGGG No data
1035133254_1035133262 14 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133254_1035133268 24 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133268 7:156675350-156675372 CCCACTTTAGGGGTGGGGAGAGG No data
1035133254_1035133257 -8 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data
1035133254_1035133264 17 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133264 7:156675343-156675365 CCTGTGACCCACTTTAGGGGTGG No data
1035133254_1035133261 13 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133254_1035133265 18 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133265 7:156675344-156675366 CTGTGACCCACTTTAGGGGTGGG No data
1035133254_1035133266 19 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133266 7:156675345-156675367 TGTGACCCACTTTAGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133254 Original CRISPR ACCCTCGTCTCCAAAGACGG AGG (reversed) Intronic
900559631 1:3297531-3297553 ACCTCAGTCTCCAAAAACGGTGG + Intronic
903883973 1:26530555-26530577 ACTCTCGTCTCCACAGCCTGGGG - Intronic
904290541 1:29483030-29483052 ACCCTCATCTCCAGACACGCTGG + Intergenic
906594482 1:47062757-47062779 ACCCTGGTAGCCAAAGACGAAGG + Intergenic
910312154 1:85836003-85836025 ATCCTCATCTCCAAAAACGAAGG + Intronic
910993445 1:93079368-93079390 ACCCTTGTCTCCAAGGACCTCGG + Exonic
915563299 1:156700121-156700143 ACCCTCCTCTCCAAAGCCACAGG - Intronic
918782614 1:188721346-188721368 TCTCTCGTCTCCAAAAACTGAGG + Intergenic
1063931243 10:11030447-11030469 TTCCTCGTCTCCAAAGCCCGAGG + Intronic
1075646920 10:124102745-124102767 ACCCCAGTCTCCAAGGACAGGGG + Intergenic
1076145101 10:128112569-128112591 ACCATAGTCTTCAAAGACAGTGG - Intronic
1079187945 11:18254071-18254093 ACCCTCTGCCCCAAAGACTGTGG - Intergenic
1079971100 11:27036508-27036530 TCCCTCTTCTCCAAAGCTGGAGG + Intergenic
1080226935 11:29972492-29972514 ACCCTCATCTCCATAGTCAGAGG + Intergenic
1082071645 11:47944160-47944182 ACCCTCGTCCTCAAAGACAATGG - Intergenic
1083400498 11:62419859-62419881 ACCCAGTTCCCCAAAGACGGGGG - Intronic
1086882738 11:92169041-92169063 TCTCTCATCTCCCAAGACGGTGG + Intergenic
1087278396 11:96183402-96183424 ACCCTTGTCTCAAAAGAAAGGGG - Intronic
1089986154 11:122816000-122816022 ACCCTCATCTCTGAAGACAGAGG - Intergenic
1096636911 12:52965822-52965844 TCCCTCGTCTCCTAAGAGGGTGG + Intergenic
1104871429 12:132001086-132001108 TCTCTCGTCTCCACACACGGTGG - Intronic
1109201306 13:59434806-59434828 ACCCTGGTAACCAAAGACAGAGG - Intergenic
1110275023 13:73633289-73633311 ACCCCAGTCTCCACAAACGGTGG + Intergenic
1112590061 13:100754791-100754813 ACCCCCGTCTCTAAAAACAGTGG + Intergenic
1113740598 13:112710177-112710199 ACACACGTCTGCAAAGAGGGAGG - Intronic
1125772938 15:42183800-42183822 ACCCTTGTCTCCAGAGACAGGGG + Intronic
1130461243 15:84159483-84159505 ACCCTCGGTTCCCATGACGGGGG + Intergenic
1132178045 15:99731510-99731532 ACCCTGGCCCCCAAAGAGGGAGG - Intronic
1133289826 16:4712576-4712598 ACCATCGTCTCCAAAGATATGGG + Intronic
1136912345 16:34154455-34154477 ACCCCCATCTTCAAAAACGGTGG - Intergenic
1138546027 16:57720385-57720407 ATCCTCATCTCCAGAGACTGGGG + Intronic
1151309389 17:73284215-73284237 ACCCTGGCCTCAAAAGTCGGTGG + Exonic
1151378841 17:73710770-73710792 GCCCACCTCTCCAAAGGCGGTGG - Intergenic
1151972071 17:77463080-77463102 AGCCTCATCTCCAGAGACAGAGG - Intronic
1152911800 17:83009530-83009552 GCCCTTGGCTCTAAAGACGGTGG + Intronic
1160983481 19:1827211-1827233 ACTCTCGTCCCCAAAGAGGTCGG + Exonic
1163358277 19:16829337-16829359 AACCCCGCCTCCAAAGGCGGAGG + Intergenic
1167733935 19:51279760-51279782 ACTCTGGTCTTCAAAGACTGAGG - Intergenic
1167734147 19:51281588-51281610 ACTCTGGTCTTCAAAGACTGAGG - Intergenic
1168394795 19:56038688-56038710 TCCCTCGTCTCCATAGAAGGAGG - Intronic
926033186 2:9611201-9611223 ACCATCGTCTCCACAGTAGGGGG - Intronic
928279851 2:29936023-29936045 ACCCTTGACTCCAACCACGGGGG - Intergenic
939503513 2:143015006-143015028 ACCCTAGTCTCCCAAGTAGGTGG + Intronic
943949717 2:194117175-194117197 ACCCCCCTCTCTAAAGACGTGGG + Intergenic
945540832 2:211084541-211084563 ACCATTGTCTCCAAAGACAAAGG + Intergenic
946179844 2:217942705-217942727 GCCCTTGTCTCCAAAGACCCTGG + Intronic
1169039899 20:2484405-2484427 ACCCTGGTCTGCAAGGACAGAGG - Exonic
1171768915 20:29306786-29306808 ACCCTCATCTTCAAAAACGGTGG + Intergenic
1171867639 20:30500142-30500164 ACCCCCATCTTCAAAAACGGTGG + Intergenic
1180314292 22:11264816-11264838 ACCCCCATCTTCAAAAACGGTGG + Intergenic
1180341066 22:11618735-11618757 ACCCCCATCTTCAAAAACGGTGG - Intergenic
1183912311 22:41089190-41089212 ACCCTCGTCTCCTGAAACGTTGG + Intergenic
1184334264 22:43844252-43844274 AACCTCCTCTCCTAAGACTGTGG + Intronic
950466403 3:13157759-13157781 AGCCGCGTCTCCACAGACTGTGG + Intergenic
956840652 3:73136850-73136872 ATCCTCCTCTCTAAAGACAGGGG - Intergenic
967936460 3:194731856-194731878 ACCCTCATCTCCAGAGCCTGGGG + Intergenic
969173030 4:5379197-5379219 ACCCAGGTCTCCAAAGCCCGTGG + Intronic
978198301 4:105995638-105995660 ACCCATGTCTCCAAGGACTGAGG - Intronic
979460898 4:120982140-120982162 ATCCTCGTCTCCAACGACAGAGG - Intergenic
983518620 4:168683037-168683059 ATCATCATCTCCAAAGACAGGGG + Exonic
984942405 4:184944337-184944359 TCCCTCTTCACCAAAGATGGGGG + Intergenic
986405875 5:7424466-7424488 ACCCTAGTCACCAATGACAGTGG - Intronic
1001756409 5:174173773-174173795 ACCCTCTTTTCCAAAGATGCCGG + Intronic
1007308077 6:40922807-40922829 CCCCTCATCTCCAAAGCCAGTGG + Intergenic
1012439883 6:99253145-99253167 ACCCTCCACCCCAAAGAAGGAGG + Intergenic
1012780703 6:103553430-103553452 ACCCTCAAGTCCAAAGATGGAGG + Intergenic
1016624823 6:146154461-146154483 ATCCTCAGCTCCAAAGACTGTGG - Intronic
1019057777 6:169235569-169235591 ACCCTAGTCTGCACAGACGCAGG + Intronic
1035133254 7:156675303-156675325 ACCCTCGTCTCCAAAGACGGAGG - Intronic
1037528315 8:19749553-19749575 ACCCTGGTCACCAAACAAGGCGG + Intronic
1043145733 8:76651443-76651465 ACCCTTGTTTCCAAAGACTTAGG - Intergenic
1051360521 9:16277862-16277884 ACCCTCACCTCCAAAGTTGGGGG - Intergenic
1057214170 9:93218967-93218989 ACCCTCCTCTCCAAGGCCAGAGG - Intronic
1057221175 9:93258832-93258854 CCCCTCGTCCCCAATGACTGTGG + Intronic
1188615270 X:32150499-32150521 ACCCTCACCTCCACAGACGGTGG - Intronic
1189012454 X:37060050-37060072 ACCCTAGTCTCCAAATGTGGGGG + Intergenic
1192141127 X:68647808-68647830 AGCCTCGTCCCCAGAGAGGGAGG + Exonic
1196698529 X:118640663-118640685 AACCTTGTCTCCAAAGAGGTGGG + Intronic