ID: 1035133255

View in Genome Browser
Species Human (GRCh38)
Location 7:156675306-156675328
Sequence GGCACCCTCGTCTCCAAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 126}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133255_1035133261 10 Left 1035133255 7:156675306-156675328 CCGTCTTTGGAGACGAGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 126
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133255_1035133264 14 Left 1035133255 7:156675306-156675328 CCGTCTTTGGAGACGAGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 126
Right 1035133264 7:156675343-156675365 CCTGTGACCCACTTTAGGGGTGG No data
1035133255_1035133260 9 Left 1035133255 7:156675306-156675328 CCGTCTTTGGAGACGAGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 126
Right 1035133260 7:156675338-156675360 AGGGTCCTGTGACCCACTTTAGG No data
1035133255_1035133265 15 Left 1035133255 7:156675306-156675328 CCGTCTTTGGAGACGAGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 126
Right 1035133265 7:156675344-156675366 CTGTGACCCACTTTAGGGGTGGG No data
1035133255_1035133266 16 Left 1035133255 7:156675306-156675328 CCGTCTTTGGAGACGAGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 126
Right 1035133266 7:156675345-156675367 TGTGACCCACTTTAGGGGTGGGG No data
1035133255_1035133268 21 Left 1035133255 7:156675306-156675328 CCGTCTTTGGAGACGAGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 126
Right 1035133268 7:156675350-156675372 CCCACTTTAGGGGTGGGGAGAGG No data
1035133255_1035133270 29 Left 1035133255 7:156675306-156675328 CCGTCTTTGGAGACGAGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 126
Right 1035133270 7:156675358-156675380 AGGGGTGGGGAGAGGTCAGACGG 0: 1
1: 2
2: 26
3: 602
4: 2314
1035133255_1035133262 11 Left 1035133255 7:156675306-156675328 CCGTCTTTGGAGACGAGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 126
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133255_1035133258 -10 Left 1035133255 7:156675306-156675328 CCGTCTTTGGAGACGAGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 126
Right 1035133258 7:156675319-156675341 CGAGGGTGCCTCTCACAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133255 Original CRISPR GGCACCCTCGTCTCCAAAGA CGG (reversed) Intronic
903158613 1:21468328-21468350 GGCACCCTCGTCTCACCTGAGGG - Intronic
906515685 1:46437566-46437588 GCCACCTTTGTCTCCAAGGATGG - Intergenic
907837151 1:58120840-58120862 GGCTCCTGCTTCTCCAAAGAAGG - Intronic
912269948 1:108199227-108199249 GGCATTCTCTTATCCAAAGAGGG - Intronic
913121847 1:115749653-115749675 GGCACCCTTGGCTCCCATGAAGG - Intronic
924464151 1:244285007-244285029 GGCCTCCTCGTCTTCCAAGAAGG + Intergenic
1063159085 10:3406836-3406858 GGCACCAGCGGTTCCAAAGATGG + Intergenic
1066836362 10:39833423-39833445 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066923617 10:41546965-41546987 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066923694 10:41548324-41548346 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066923764 10:41549682-41549704 GGAAATCTCGTTTCCAAAGACGG - Intergenic
1066923862 10:41551379-41551401 GGAAATCTCGTTTCCAAAGACGG - Intergenic
1066923934 10:41552737-41552759 GGAAATCTCGTTTCCAAAGACGG - Intergenic
1066924006 10:41554095-41554117 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066924083 10:41555453-41555475 GGAAATCTCGTTTCCAAAGACGG - Intergenic
1066924153 10:41556811-41556833 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066924230 10:41558169-41558191 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066924302 10:41559528-41559550 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066924375 10:41560886-41560908 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066924467 10:41562582-41562604 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066924560 10:41564281-41564303 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066924648 10:41565979-41566001 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066924720 10:41567337-41567359 GGAAATCTCGTTTCCAAAGACGG - Intergenic
1066924792 10:41568695-41568717 GGAAATCTCGTTTCCAAAGACGG - Intergenic
1066924936 10:41571411-41571433 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066925031 10:41573110-41573132 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066925162 10:41575486-41575508 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066925326 10:41578542-41578564 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066925412 10:41580239-41580261 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066925490 10:41581597-41581619 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066925565 10:41582956-41582978 GGAAATCTCGTTTCCAAAGACGG - Intergenic
1066925713 10:41585672-41585694 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066925785 10:41587030-41587052 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066925928 10:41589746-41589768 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1066926006 10:41591104-41591126 GGAAATCTCGTTTCCAAAGACGG - Intergenic
1066926080 10:41592462-41592484 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1083699496 11:64466309-64466331 GGCAACCTCATATTCAAAGATGG - Intergenic
1091854910 12:3731678-3731700 AGCAACCCCGTTTCCAAAGAAGG - Intronic
1096636909 12:52965819-52965841 ACCTCCCTCGTCTCCTAAGAGGG + Intergenic
1097263652 12:57733875-57733897 GGGAGCCTGGTCTCCAAATAAGG - Intronic
1098022550 12:66170774-66170796 GGGACCAACGTCTGCAAAGAGGG + Intergenic
1102306528 12:111808935-111808957 GGCACCCAGGTTTCCAAGGAGGG + Intronic
1103548050 12:121715623-121715645 GGCTCCCTCTTCCCCAAAGTAGG - Intronic
1104592734 12:130097721-130097743 GGCCCTCTCGTCTCCAGACAGGG + Intergenic
1104843812 12:131836929-131836951 GGCACCCAGGTCCCCACAGATGG + Intronic
1123105884 14:105840865-105840887 GGCACCCTCGTCTCCCCACCTGG + Intergenic
1125193731 15:37022716-37022738 TGCAACCTCGTCTCCCAGGAGGG + Intronic
1128213816 15:65920432-65920454 GGCACCCTACTCCCCACAGAGGG - Intronic
1132593005 16:734566-734588 GGCAGCCTCTTCTCCAGAAAAGG + Intronic
1134884508 16:17777635-17777657 TGCAGCCTCTTCTCCAAACAGGG + Intergenic
1135528112 16:23229459-23229481 GGCACCCCCTTCTCCAACGTTGG - Intergenic
1138292087 16:55856442-55856464 GGCACGCTTCTCTCCACAGAAGG - Exonic
1140950312 16:79810530-79810552 GGCATCCACTTCCCCAAAGAAGG - Intergenic
1203142116 16_KI270728v1_random:1773558-1773580 GGCACCATCATCTCCCAAGCTGG - Intergenic
1151458645 17:74241758-74241780 GGCTTCCCCGTCCCCAAAGAGGG - Intronic
1153276475 18:3372697-3372719 GGCAACCTTGTCTCCAAACCTGG - Intergenic
1157364391 18:47050203-47050225 GGAAAACTCGTCTCTAAAGATGG - Intronic
1158391194 18:57046592-57046614 GGCACCATGGTCTGCACAGATGG + Intergenic
1160591764 18:79948956-79948978 GCCAGCCACGTCTCCAAAGCAGG + Intronic
1160722276 19:602977-602999 GGCACCCTCGTCCCCCAGGGAGG + Intronic
1161948511 19:7454005-7454027 GGCACCCACAACTCCCAAGATGG - Intronic
1163766131 19:19164500-19164522 GGCACCCTCACCTGCCAAGAAGG + Intronic
1168394796 19:56038691-56038713 GGCTCCCTCGTCTCCATAGAAGG - Intronic
925382007 2:3434968-3434990 GGCATCCTCGTTGCCACAGAGGG - Intronic
927420528 2:22926069-22926091 GGCCCTCCCTTCTCCAAAGAAGG + Intergenic
927637014 2:24824044-24824066 GGTACCCTCGTCTTCACAGCTGG - Intronic
928374861 2:30765969-30765991 GGCACGCTCACCACCAAAGAAGG - Intronic
929544990 2:42849854-42849876 TGCACCCTGCACTCCAAAGAAGG + Intergenic
933977783 2:87525728-87525750 AGGACACTCATCTCCAAAGAAGG - Intergenic
934857899 2:97740106-97740128 GGCACACTCATCTCCACACAGGG - Intergenic
935097257 2:99957577-99957599 GGCAGCACAGTCTCCAAAGATGG + Intronic
936316047 2:111425079-111425101 AGGACACTCATCTCCAAAGAAGG + Intergenic
936852787 2:116921178-116921200 GGCATCCCAGTCTCCAAAGTGGG + Intergenic
938448177 2:131393627-131393649 AGCCCTCCCGTCTCCAAAGAGGG - Intergenic
942869209 2:180714555-180714577 GGCACGCTGGTGCCCAAAGAGGG - Intergenic
943436697 2:187872855-187872877 GGCCACCTCTTCTCCAAATATGG - Intergenic
943976854 2:194491596-194491618 GGCTCCTTCTTCTCAAAAGATGG + Intergenic
948264975 2:236629397-236629419 AGCCCCCTGGTCTCCAGAGAGGG - Intergenic
948298878 2:236886986-236887008 GGCACCTTCTTCTACTAAGAAGG + Intergenic
1169113356 20:3046856-3046878 GGCACTCTCCTCTCCAAATCCGG - Intronic
1170070078 20:12357343-12357365 GGCATCCTCGTCTCCAACCTGGG - Intergenic
1171768913 20:29306783-29306805 GCCACCCTCATCTTCAAAAACGG + Intergenic
1175390654 20:58625311-58625333 TGCTCTCTCGTCTCCAAAGGAGG - Intergenic
1175460343 20:59147646-59147668 GCCCCCCTCATCTCCAAACAAGG + Intergenic
1180798508 22:18619800-18619822 GGCACTCTCCTCTCCAGAGAAGG + Intergenic
1181223209 22:21375465-21375487 GGCACTCTCCTCTCCAGAGAAGG - Intergenic
1181255529 22:21560161-21560183 GGCACTCTCCTCTCCAGAGAAGG + Intronic
1183115083 22:35685665-35685687 GGCACCCACCTCTGCAAAGGAGG + Intergenic
950177057 3:10882203-10882225 GGCTCCCAAGGCTCCAAAGAAGG - Intronic
954607919 3:51928481-51928503 GTCACCCTCGGCTCCAAATGTGG - Intergenic
954685333 3:52367067-52367089 GGTTCCCTCGTCTGCAAAGCGGG + Intronic
955947859 3:64212544-64212566 GCCAACCTCGTCCACAAAGAAGG - Intronic
958441698 3:94163514-94163536 CTCACCCTGGTGTCCAAAGATGG - Intergenic
959231375 3:103656549-103656571 GCCACCCTTATCTCCAACGAAGG - Intergenic
959931595 3:111989255-111989277 GGCCCTCTAGTGTCCAAAGAAGG - Intronic
969462578 4:7336545-7336567 AGGACTCTTGTCTCCAAAGATGG + Intronic
971039461 4:22735494-22735516 GGCTCCCTCCCCTCCAGAGATGG + Intergenic
974429059 4:61772680-61772702 GGCATCTTTATCTCCAAAGATGG - Intronic
975571838 4:75825845-75825867 AGCATCCTTATCTCCAAAGACGG - Intergenic
981144887 4:141312639-141312661 GAAACCCTCTTCCCCAAAGATGG - Intergenic
992561778 5:77959212-77959234 GTCACCCTCGAAACCAAAGAGGG - Intergenic
998063631 5:139138857-139138879 GGGAAGCTAGTCTCCAAAGAGGG - Intronic
1000228546 5:159293418-159293440 GGATCCCTCTTCTCCAAAGCGGG - Intergenic
1001077493 5:168641422-168641444 TTCACCCTGGGCTCCAAAGATGG - Intergenic
1001783326 5:174389743-174389765 TTCTCCCTCTTCTCCAAAGATGG - Intergenic
1004529203 6:16437873-16437895 GGCACCCTCTTCCCCAGACAAGG - Intronic
1015914584 6:138203115-138203137 GGCACCCTCCTCTAGGAAGAGGG + Intronic
1018361626 6:163076523-163076545 GGCAGACTCCTCTCCAAAGTCGG + Intronic
1019925161 7:4186833-4186855 GGCGCCTTCCTCCCCAAAGAAGG - Intronic
1020210290 7:6153898-6153920 GGCACCCCCGCTACCAAAGAAGG + Exonic
1022180107 7:27910796-27910818 GGCTCCCTGGTCACCAAAAATGG - Intronic
1035133255 7:156675306-156675328 GGCACCCTCGTCTCCAAAGACGG - Intronic
1037619633 8:20552021-20552043 GGCACCCTTCTCCCCACAGAGGG - Intergenic
1038990772 8:32865225-32865247 GGCAGACACGTCTCAAAAGAAGG + Intergenic
1039135499 8:34318897-34318919 AGCTCACTCGTCTGCAAAGAAGG - Intergenic
1049575451 8:143387744-143387766 GGCACCCACTTCTCCAGGGAAGG + Intergenic
1051360524 9:16277865-16277887 AGCACCCTCACCTCCAAAGTTGG - Intergenic
1053048743 9:34941001-34941023 GGTGTCCTGGTCTCCAAAGAAGG - Intergenic
1062587717 9:137256921-137256943 GGAAACCTCGTCCCCGAAGAGGG - Exonic
1203341050 Un_KI270414v1:79-101 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1203341121 Un_KI270414v1:1436-1458 GGAAATCTCGTTTCCAAAGAAGG - Intergenic
1185550310 X:978850-978872 GGCACCATCTTCTCCCAAGCTGG + Intergenic
1186791695 X:13005740-13005762 GGCACGCACATCTCCAAATAGGG + Intergenic
1188615271 X:32150502-32150524 AGCACCCTCACCTCCACAGACGG - Intronic
1189765717 X:44370032-44370054 GGCATCCTTATCTCCGAAGATGG + Intergenic
1194916607 X:99716755-99716777 GACACCCTCCTCTTGAAAGAAGG + Intergenic
1198603827 X:138314519-138314541 GCCACCAGCGTCCCCAAAGAAGG - Intergenic
1200232136 X:154449410-154449432 GGCACTCTCCTCCCAAAAGAGGG + Intronic
1201159223 Y:11155627-11155649 GGCACCCTGAACCCCAAAGATGG - Intergenic
1201694101 Y:16805814-16805836 TGCAGCCTCTTCCCCAAAGAAGG + Intergenic
1201866621 Y:18662397-18662419 GGCAACCTCGTCTTTTAAGAGGG + Intergenic