ID: 1035133257

View in Genome Browser
Species Human (GRCh38)
Location 7:156675318-156675340
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133244_1035133257 28 Left 1035133244 7:156675267-156675289 CCACGGCAAGGCCTGTGTGCTGT 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data
1035133254_1035133257 -8 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data
1035133247_1035133257 3 Left 1035133247 7:156675292-156675314 CCTCCCGGCTCCCTCCGTCTTTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data
1035133246_1035133257 17 Left 1035133246 7:156675278-156675300 CCTGTGTGCTGTCTCCTCCCGGC 0: 1
1: 0
2: 0
3: 12
4: 224
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data
1035133250_1035133257 -1 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data
1035133249_1035133257 0 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data
1035133252_1035133257 -7 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr