ID: 1035133259

View in Genome Browser
Species Human (GRCh38)
Location 7:156675327-156675349
Sequence TCACAGGACCCTCCTGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 1, 2: 8, 3: 44, 4: 221}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133259_1035133264 -7 Left 1035133259 7:156675327-156675349 CCTCTCACAGGAGGGTCCTGTGA 0: 1
1: 1
2: 8
3: 44
4: 221
Right 1035133264 7:156675343-156675365 CCTGTGACCCACTTTAGGGGTGG No data
1035133259_1035133265 -6 Left 1035133259 7:156675327-156675349 CCTCTCACAGGAGGGTCCTGTGA 0: 1
1: 1
2: 8
3: 44
4: 221
Right 1035133265 7:156675344-156675366 CTGTGACCCACTTTAGGGGTGGG No data
1035133259_1035133270 8 Left 1035133259 7:156675327-156675349 CCTCTCACAGGAGGGTCCTGTGA 0: 1
1: 1
2: 8
3: 44
4: 221
Right 1035133270 7:156675358-156675380 AGGGGTGGGGAGAGGTCAGACGG 0: 1
1: 2
2: 26
3: 602
4: 2314
1035133259_1035133266 -5 Left 1035133259 7:156675327-156675349 CCTCTCACAGGAGGGTCCTGTGA 0: 1
1: 1
2: 8
3: 44
4: 221
Right 1035133266 7:156675345-156675367 TGTGACCCACTTTAGGGGTGGGG No data
1035133259_1035133268 0 Left 1035133259 7:156675327-156675349 CCTCTCACAGGAGGGTCCTGTGA 0: 1
1: 1
2: 8
3: 44
4: 221
Right 1035133268 7:156675350-156675372 CCCACTTTAGGGGTGGGGAGAGG No data
1035133259_1035133262 -10 Left 1035133259 7:156675327-156675349 CCTCTCACAGGAGGGTCCTGTGA 0: 1
1: 1
2: 8
3: 44
4: 221
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133259 Original CRISPR TCACAGGACCCTCCTGTGAG AGG (reversed) Intronic
900749102 1:4382883-4382905 TCACAAGTCCCTTCTGGGAGAGG + Intergenic
901779441 1:11583761-11583783 TCACTGGAACCCCCTGTAAGTGG - Intergenic
902538763 1:17137558-17137580 TCACAAGACCTTCAGGTGAGAGG + Intergenic
902719833 1:18296567-18296589 TCACAAGACCTTCACGTGAGAGG - Intronic
903576280 1:24341600-24341622 TAGCAGGACCCTCTAGTGAGAGG - Intronic
904818034 1:33220177-33220199 TCACAGGACTCTGCAGTGGGGGG + Intergenic
904929141 1:34072715-34072737 CCACAGGGTCCTACTGTGAGTGG + Intronic
905432176 1:37932149-37932171 GCACAGAACCCTTCTGTGCGCGG - Intronic
905844210 1:41213523-41213545 TCATAAGACCCTCATGTGACAGG + Intronic
906350824 1:45057465-45057487 TCACAGCACAATCCTGTGACTGG + Intronic
907803690 1:57797000-57797022 CCACAGGAACCTGCAGTGAGTGG - Intronic
907987276 1:59544435-59544457 TCATAAGACCCTCATGTGAGAGG - Intronic
908197779 1:61762040-61762062 TCATAGGATCCTCATGTGAGAGG - Intronic
909287174 1:73834587-73834609 TCATCAGACCCTCATGTGAGAGG + Intergenic
910415509 1:86993022-86993044 TCATAAGACTCTTCTGTGAGAGG - Exonic
910508309 1:87975796-87975818 TCAGAAGACCTTCATGTGAGAGG - Intergenic
912821875 1:112874376-112874398 TCACAGGGCCCTGGGGTGAGGGG + Intergenic
914377163 1:147081444-147081466 TCATAAGACTCTCATGTGAGAGG + Intergenic
916672434 1:167034900-167034922 TCATAAGACCCTCATGTGAGAGG - Intergenic
918121031 1:181540599-181540621 TCATAGAACGCTCATGTGAGAGG + Intronic
918219965 1:182427826-182427848 ACTAAGGACCCTCCTGTGGGAGG + Intergenic
920173795 1:204087787-204087809 TCACAGAAGCATCCTGTGCGGGG - Intronic
920193017 1:204206932-204206954 TTCCAGGACTCTCCTGTGATGGG + Intronic
920455958 1:206101323-206101345 TCACAGCATCCTCAGGTGAGGGG + Intronic
924667216 1:246085482-246085504 TCAAAGGACCCTAATGTGTGAGG + Intronic
1063065077 10:2599944-2599966 TCACTGTACCCTGCTGTGATCGG - Intergenic
1063757609 10:9032592-9032614 TCATAAGACCCTCGTGTGAAAGG + Intergenic
1064243243 10:13649404-13649426 TCACAGAACCCACATATGAGAGG + Intronic
1064312554 10:14224386-14224408 TCACAGGGCCCTCCTTTGATGGG - Intronic
1064722842 10:18247201-18247223 GCACAGAATCCTGCTGTGAGGGG + Intronic
1065258854 10:23903648-23903670 TCATAAGATCCTCCTGTGACAGG - Intronic
1065287567 10:24200813-24200835 TCACAGGCCCCTTCTGAGAAAGG - Intronic
1067047484 10:42992699-42992721 GCCCAGGACCCTCCTGGGGGTGG - Intergenic
1068692882 10:59935641-59935663 TCATAAGACCCTCATGTAAGTGG - Intergenic
1069610305 10:69768342-69768364 TCACAGGACCATGTTGAGAGGGG - Intergenic
1070221704 10:74454896-74454918 TCACAAGACCCTTATGTGAATGG - Intronic
1071375443 10:84997616-84997638 TCAGAAAACCCTTCTGTGAGGGG - Intergenic
1071509424 10:86251869-86251891 TCACAGGATATTCCTGTGGGAGG - Intronic
1072827681 10:98624808-98624830 TCTCAGGATCTTCCTGTGATTGG - Intronic
1075918283 10:126188615-126188637 TCACAGGCATCTTCTGTGAGTGG + Intronic
1076200136 10:128551402-128551424 ACACAAGGGCCTCCTGTGAGGGG - Intergenic
1076543141 10:131227076-131227098 TCACAGGACCCTGGAGAGAGCGG + Intronic
1076661474 10:132058477-132058499 ACACAGGACCCTCCAGAGAAAGG - Intergenic
1076769543 10:132655576-132655598 TCACAGAACCCTCTTGGAAGCGG - Intronic
1080692953 11:34574337-34574359 TCACAGAAGCCTCCTGAGAAGGG + Intergenic
1081773434 11:45663390-45663412 TCACAGGCCCCTGCTGGGAGAGG - Intronic
1084273873 11:68042246-68042268 CCACAGGCTCCTCCTGAGAGGGG - Intronic
1084709477 11:70835168-70835190 GCACAGGACACTACTGTGTGCGG + Intronic
1085474499 11:76781442-76781464 TCACAGGAAGCTCCTTTGTGTGG - Intergenic
1086133718 11:83425772-83425794 TCATAAGACTCTCATGTGAGAGG + Intergenic
1086597029 11:88585028-88585050 TCATAAGACCCTCATGTGAGAGG + Intronic
1087309419 11:96522381-96522403 TCACAGTTCCTTCCAGTGAGTGG - Intergenic
1087926280 11:103922494-103922516 TCATAAGACCCTCATGCGAGAGG + Intronic
1091469785 12:716843-716865 TCACACGACCCACCTGGGAGGGG + Intergenic
1091891659 12:4060029-4060051 TTACAGGATCCTACTCTGAGTGG + Intergenic
1092179553 12:6436086-6436108 GCCCAGGAGCCTACTGTGAGAGG + Intergenic
1094376040 12:29788259-29788281 TCATAAGACCTTCATGTGAGAGG - Intergenic
1096287168 12:50310190-50310212 TCACAAAACCCTCATGTGAGAGG - Intergenic
1096396236 12:51269108-51269130 TCCCAGGCCCTTCCTGTGTGAGG + Intronic
1100049433 12:90428640-90428662 TCATATGATCCTCATGTGAGAGG - Intergenic
1101910191 12:108855859-108855881 TCACAGCCCCCTCCTTGGAGAGG - Intronic
1103963704 12:124624916-124624938 TCACAGAACCCACCTGTGGTAGG + Intergenic
1107045832 13:35991125-35991147 TCATAAGACCCTCATGGGAGAGG + Intronic
1107359902 13:39606996-39607018 TCTTAGGACCCTCCCCTGAGAGG + Intergenic
1109124679 13:58504350-58504372 GCACAGGAGCCCACTGTGAGGGG + Intergenic
1112443220 13:99440264-99440286 TCAGGAGACCCTCATGTGAGAGG + Intergenic
1113534366 13:111052615-111052637 TCACGAGACCCTCATGTGAGAGG + Intergenic
1118486747 14:66221635-66221657 TCATAATACCCTCATGTGAGAGG - Intergenic
1121112996 14:91325075-91325097 ACACAGGGCCCTGCTATGAGAGG + Intronic
1122261541 14:100526115-100526137 TCCCAGGTCCCTTCTGTGGGAGG + Intronic
1122386896 14:101354972-101354994 ACCCATGACCGTCCTGTGAGTGG + Intergenic
1122686073 14:103507308-103507330 GCACAGGAACCTGCTGTGATGGG - Intergenic
1126669631 15:51104400-51104422 ATTCAGGACTCTCCTGTGAGTGG - Intronic
1126697282 15:51337174-51337196 GCACAAGTCCCTGCTGTGAGAGG + Intronic
1127559602 15:60122814-60122836 TCACAGGATCCTCATGTGACAGG + Intergenic
1127787833 15:62371748-62371770 TCCTAAGACCCTCCCGTGAGAGG - Intergenic
1128775086 15:70314070-70314092 TTACAGGGCCCTCCTATGAGAGG + Intergenic
1129703978 15:77784111-77784133 TGTCAGGACCCTCCTTTGGGTGG + Intronic
1130312144 15:82765131-82765153 TCACAGAACGCCCTTGTGAGCGG + Intronic
1130695538 15:86127782-86127804 ACATAAAACCCTCCTGTGAGAGG + Intergenic
1131092546 15:89633358-89633380 TCGCAGGGCCCTCTTGGGAGTGG - Intronic
1134339556 16:13332745-13332767 TCTCAGGAGCCTCACGTGAGAGG + Intergenic
1140616795 16:76674937-76674959 ACACAGGACACTTCTGTGACTGG + Intergenic
1140783904 16:78321762-78321784 TCACAGGCCCTCCCTGTCAGTGG + Intronic
1141268061 16:82514780-82514802 TCTCAGGGCCTTCCTGTGAGTGG - Intergenic
1141278747 16:82611286-82611308 TCACAGGACCCTTCTGAAATAGG - Intergenic
1141602620 16:85135666-85135688 TCACAGAGCCCAGCTGTGAGTGG - Intergenic
1141777909 16:86136535-86136557 TCACACAACCCTCCTGTGGCTGG - Intergenic
1141938317 16:87256590-87256612 GCACAGGACCTTCCTCAGAGGGG + Intronic
1143595756 17:7912571-7912593 TCCCCGGCCCCTCCTGGGAGGGG - Exonic
1143859322 17:9876571-9876593 TCACAAGACCCTCATGTGAGAGG - Intronic
1144076239 17:11722066-11722088 TCACAGGACCCGGCTGGGAGAGG + Intronic
1144293843 17:13854595-13854617 TCACAAAACCCTCATGTGAGAGG - Intergenic
1144429508 17:15178293-15178315 TCACAAGACCCTCATGTGAGAGG + Intergenic
1145773683 17:27511529-27511551 CCACAGGCCCCTCCTGAGTGGGG - Intronic
1148278792 17:46330928-46330950 TCTCAGGCCCCTGCTGTGTGTGG - Exonic
1148301004 17:46548790-46548812 TCTCAGGCCCCTGCTGTGTGTGG - Exonic
1149431589 17:56598430-56598452 CCAGAGGACCCTCCATTGAGAGG - Intergenic
1149468208 17:56895825-56895847 TCACAGAACCCTGATGAGAGAGG + Intronic
1150006266 17:61470798-61470820 GCACAGGACCCTGCTGGGCGTGG - Intronic
1151330085 17:73401504-73401526 TGCCAAGAGCCTCCTGTGAGTGG + Intronic
1151387013 17:73761157-73761179 TCAAACTACCCTCCTGTGACTGG - Intergenic
1151441449 17:74131980-74132002 TCATAGGACCCTAATGTGAGAGG - Intergenic
1152275348 17:79353353-79353375 TCCGTGGACTCTCCTGTGAGTGG + Intronic
1152809338 17:82374187-82374209 TCACAGTGGCCTCCTGGGAGCGG + Intergenic
1152846325 17:82601877-82601899 TCACAGGACCCACCAGGCAGCGG + Exonic
1153288912 18:3481348-3481370 TCATAAGATCCTCATGTGAGAGG + Intergenic
1153374429 18:4359319-4359341 TCATAAGACCCTCATGTGAGAGG + Intronic
1156738030 18:40286896-40286918 TCATAAGACCCTCATGCGAGAGG + Intergenic
1157598168 18:48876321-48876343 TCACTGGCCCCTCCTGTGGCGGG + Intergenic
1158350628 18:56561854-56561876 CCACAGGGTTCTCCTGTGAGAGG + Intergenic
1159886353 18:73911456-73911478 TCATAAGACCCTCTTGTGACAGG - Intergenic
1159960980 18:74555551-74555573 CCACAGGACCTTCCTGTCAGGGG + Intronic
1160609571 18:80074909-80074931 TGACAGGACCCCCTTGTGAGAGG + Intronic
1163325360 19:16600034-16600056 TCCAAGCACCCACCTGTGAGAGG + Intronic
1164738219 19:30558214-30558236 TCACAGGGCCCACCTAAGAGTGG - Intronic
1165262846 19:34635787-34635809 TCACAGTACCCACATGTGAAGGG + Intronic
1165465121 19:35969796-35969818 TCACAGGAACCTGCTGAGGGAGG - Intergenic
1165826580 19:38709192-38709214 TCACGAGGCACTCCTGTGAGTGG + Intronic
1165974362 19:39661696-39661718 TCACAGGACCTACCTTTGAATGG + Intergenic
1167572563 19:50298226-50298248 TCACAGGACCCTCATTTCAGAGG - Intronic
925196084 2:1927071-1927093 GAGCAGGAGCCTCCTGTGAGCGG + Intronic
927415699 2:22878316-22878338 TCTCAGGAGACTCCTGTGAAAGG + Intergenic
928214735 2:29351892-29351914 TCCCAGGACTCTCCTGTTTGGGG + Intronic
929863771 2:45700636-45700658 TCATAGCACCCACCTGTGAGAGG - Intronic
930101232 2:47605097-47605119 TCAGAAGACCCTCGTGTGAGAGG - Intergenic
932579900 2:72986331-72986353 TCAAAGCACCCTCCTCTCAGTGG + Intronic
932819055 2:74884300-74884322 TGGCAAGACCCTCCTGTGATGGG + Intronic
933850211 2:86360713-86360735 TCACAGAACCCTCTTCTGCGTGG - Intergenic
936929420 2:117772083-117772105 TCCCAGGTGCCTCCTGTGTGTGG - Intergenic
938295087 2:130172886-130172908 TCACAGGACCCTGCAGAGAGAGG + Exonic
938461539 2:131500949-131500971 TCACAGGACCCTGCAGAGAGAGG - Intergenic
939361986 2:141184406-141184428 TCATAAGAACCTCATGTGAGAGG + Intronic
941237607 2:162994771-162994793 TCACAGGACCCTAATCTGATAGG + Intergenic
942934717 2:181541245-181541267 TCACAGCACCCACAAGTGAGTGG - Intronic
944694748 2:202190770-202190792 TCACAGCACCCATCTCTGAGAGG + Intronic
944713094 2:202353427-202353449 ACACTGGAGCCTCCTGAGAGGGG - Intergenic
946015364 2:216599850-216599872 TCATAAGACCCTCATGTGATAGG + Intergenic
947879250 2:233490957-233490979 TCACTGGTCCCTCCTCTGACAGG - Intronic
947935625 2:234001170-234001192 TCATAGGACCCTCATGTGAGAGG - Intronic
947976443 2:234370533-234370555 CCACAAGACCCTCATGTGAGAGG - Intergenic
948765780 2:240217948-240217970 TCTCAGATCCCACCTGTGAGGGG + Intergenic
1169742326 20:8908385-8908407 TCATAAGACCCTCATGTGAGAGG - Intronic
1170341015 20:15327294-15327316 TCACGTGACCATCATGTGAGAGG - Intronic
1170605516 20:17872729-17872751 TCACAGCAGCCTCCTGGGAACGG - Intergenic
1171250184 20:23640553-23640575 CCAGAGGACTCTCCTGGGAGTGG + Intergenic
1171279137 20:23881710-23881732 CCAGAGGACTCTCCTGGGAGTGG + Intergenic
1171284230 20:23924279-23924301 CCAGAGGACTCTCCTGGGAGTGG + Intergenic
1172227879 20:33317257-33317279 TCACAGCTCCCTCCTGTGCTAGG + Intergenic
1172940086 20:38648304-38648326 GGACAGGAGCCTGCTGTGAGGGG - Intronic
1172940179 20:38648764-38648786 TCACTGGGCCCTTCTGTGGGAGG + Intronic
1174114230 20:48215814-48215836 TCAGAGGAGACTCCTGGGAGAGG - Intergenic
1175127820 20:56765423-56765445 GCACAGCCCCCTCCTGTAAGAGG - Intergenic
1175475925 20:59274276-59274298 TCACTGGTCCTTCCTGTGAGGGG + Intergenic
1175555179 20:59847482-59847504 TCACATGTCCCTCATGTCAGAGG - Exonic
1175658680 20:60793607-60793629 TCACAGGACCCTCAGCTGGGAGG + Intergenic
1175794282 20:61761849-61761871 GCACTGGAGCTTCCTGTGAGAGG - Intronic
1176305745 21:5122248-5122270 TCTCAGGACCCTCTCCTGAGAGG + Intronic
1176669843 21:9722866-9722888 TCATAAGATCCTCATGTGAGAGG + Intergenic
1179410998 21:41163192-41163214 TCATAGGACTCTCATGTGATGGG - Intergenic
1179851313 21:44139783-44139805 TCTCAGGACCCTCTCCTGAGAGG - Intronic
1181143168 22:20822579-20822601 TAGCAGGACCCTCCTGTCATTGG - Intronic
1181320149 22:21998196-21998218 GTATAAGACCCTCCTGTGAGAGG + Intergenic
1181494418 22:23279964-23279986 TCACATGGCCTTCCTGGGAGTGG + Intronic
1183459132 22:37939251-37939273 TCCCAGCACACACCTGTGAGGGG - Intronic
1184105148 22:42363091-42363113 TCACAGCAGCCTCATGTGTGAGG + Intergenic
949152077 3:781392-781414 TCACAAGACCCTCATTAGAGAGG + Intergenic
951671410 3:25187123-25187145 TCATAAGACCCTCATTTGAGAGG - Intronic
951690262 3:25387637-25387659 TCACAGGGGCCTGCTGAGAGTGG - Intronic
952177267 3:30878607-30878629 TCACAGGACACTCCACTCAGAGG + Intronic
954414086 3:50384519-50384541 TCACAGGCCCCTTGGGTGAGGGG - Intronic
954633275 3:52058122-52058144 TCACAGGACACACCTGCAAGTGG - Intergenic
955219977 3:57015379-57015401 TCACAGGACCCTCCTTAGAAAGG + Intronic
956719598 3:72106169-72106191 TCATAAGCCCCTCATGTGAGAGG - Intergenic
957815916 3:85297017-85297039 TCACTGCAGCATCCTGTGAGGGG - Intronic
958160363 3:89811326-89811348 TCACAGCCCCATCCAGTGAGGGG - Intergenic
960995126 3:123335653-123335675 GTACAGGACCCCCCTGAGAGGGG + Intronic
961522316 3:127473813-127473835 GCTCAGGTCCCTCCTGTGTGGGG - Intergenic
961795481 3:129405836-129405858 ACACAGGAGCATCCTGTGGGTGG - Intronic
962754400 3:138457055-138457077 TCACACGACCCTCCTGGGCTTGG + Intronic
964361398 3:155900970-155900992 TAACTGGACTCTCCTGTCAGAGG + Intronic
964779399 3:160318888-160318910 TCATAAGACTCTCATGTGAGAGG + Intronic
966754489 3:183355791-183355813 TAACAGGACCCTCAGGTGACTGG - Intronic
970525109 4:16924209-16924231 TCATAGGACCCTCATCTCAGAGG + Intergenic
970531535 4:16990274-16990296 TCACAAGACCCTCATGTGAGAGG + Intergenic
971034959 4:22683036-22683058 TCATAAGGCCCTCATGTGAGGGG + Intergenic
972429434 4:38966299-38966321 TCATAGGACCCTCATGTGAGAGG - Intergenic
975571845 4:75825894-75825916 TTACAAGACCCTCATGTGAGAGG - Intergenic
976825767 4:89258674-89258696 TCATACGACCCTCATGTGAGGGG - Intronic
978317073 4:107450189-107450211 TCATAGGACCCACACGTGAGAGG + Intergenic
978847782 4:113294256-113294278 TTAAAGGAGCCTCCTGAGAGGGG + Intronic
979460908 4:120982192-120982214 TCATAAGACCCTCATGTGAGAGG - Intergenic
979618805 4:122775256-122775278 TCATAAGACCTTCCTGTGAAAGG - Intergenic
980523021 4:133956572-133956594 TCATAAAACCCTCATGTGAGGGG + Intergenic
983641528 4:169947914-169947936 TCACAGGTCCTACCTGTGAGGGG + Intergenic
984871468 4:184329251-184329273 TCGTAAGACCCTCCTGTGAGCGG + Intergenic
984999450 4:185469993-185470015 TCAGAGGAGCCTGCTGTGAGGGG - Intronic
984999453 4:185469997-185470019 TCACAGCAGGCTCCTCTGAGAGG + Intronic
985404936 4:189628664-189628686 TCACAAGATCCTCATGTGAGAGG - Intergenic
985852422 5:2398339-2398361 CCTCAGGAGCCTCCTGTGAGGGG + Intergenic
986642917 5:9889685-9889707 CCAAAGGCCCCTCATGTGAGAGG + Intergenic
987134855 5:14890960-14890982 TCAGAGGACCACACTGTGAGTGG + Intergenic
991658406 5:68926348-68926370 TCATAAGACCCTCATGTGAGAGG - Intergenic
996575638 5:124974177-124974199 TCACAGAACCCTCCTGTGAGAGG - Intergenic
996576908 5:124985706-124985728 TCCCAAGACCCTCATGTAAGAGG + Intergenic
998904661 5:146891922-146891944 GCACAGGACCCTTCTAAGAGTGG + Intronic
1000582914 5:163055903-163055925 TCATAAGACCTTCCTGTGAGAGG + Intergenic
1002270310 5:178067426-178067448 ACAGAGGACCCTCCTGGGATGGG + Intergenic
1003105408 6:3211379-3211401 TAACAGGATCCTCCTCTGCGTGG + Intergenic
1004075122 6:12338109-12338131 TCACAGGACTCTCGTGTATGCGG + Intergenic
1004274151 6:14221064-14221086 TCATAAGAACCTCATGTGAGAGG - Intergenic
1005365297 6:25070299-25070321 CCAAAGCACCCTCCTGTGAAGGG + Intergenic
1005704266 6:28435920-28435942 AGACAGCACCGTCCTGTGAGTGG - Exonic
1007252595 6:40506016-40506038 TCTGAGGGCCCTCCAGTGAGGGG + Intronic
1007590219 6:43016521-43016543 TGACAGGAGCTCCCTGTGAGGGG + Intronic
1007960691 6:45956375-45956397 ACACAGGCCCTTCCTGTCAGTGG - Intronic
1007983137 6:46179682-46179704 TCACAGGACTGTCTTGGGAGGGG + Intergenic
1009858233 6:69291901-69291923 TCATAAGACCCTCATGTGAGAGG + Intronic
1015085028 6:129280126-129280148 ACACAGGACCACGCTGTGAGAGG + Exonic
1017831220 6:158131628-158131650 GCACAGCACCCTGCTGCGAGTGG + Intronic
1018849982 6:167579930-167579952 ACACAGGCCCCTTCTGTGAATGG - Intergenic
1019151432 6:170008587-170008609 TCCCAGGACTCTCCTGCGTGGGG + Intergenic
1019156985 6:170045818-170045840 TCACATGACCCTCATGTGGATGG - Intergenic
1019659617 7:2216846-2216868 CCTCAGGACTCTCCTGTGGGAGG + Intronic
1020259440 7:6522434-6522456 TGACAGGACCTTTCTGTGTGGGG - Intronic
1021486057 7:21169726-21169748 TCAAAGGCCCTTCCTGGGAGGGG + Intergenic
1021913014 7:25405262-25405284 TCACAGAACCTTCTTGTGTGTGG + Intergenic
1022446487 7:30474934-30474956 ACACAGGCCCCTTCAGTGAGTGG - Intronic
1023392263 7:39721551-39721573 TCTTATGACCCTCCTCTGAGAGG - Intergenic
1024931824 7:54672326-54672348 GCACAGGACACTTCTGAGAGTGG + Intergenic
1027790044 7:82628114-82628136 TCAAAAGACCCTCATATGAGAGG - Intergenic
1027980397 7:85212244-85212266 TCATAAGACCCTCGTTTGAGAGG - Intergenic
1028873261 7:95792405-95792427 TCAAAGGACCCTCATGTGAGAGG + Intronic
1029940843 7:104479140-104479162 TCATAAGACCCTTCTCTGAGAGG + Intronic
1030601215 7:111595292-111595314 TCATAGCACCCTCATGTGAGAGG + Intergenic
1032541831 7:132709445-132709467 TGACAGGACCATCCTGTGTAAGG + Intronic
1033066868 7:138164401-138164423 TCTTATGACCCTCATGTGAGAGG + Intergenic
1033288453 7:140062001-140062023 ACCCAGGACCCTTCTGTGACTGG - Intronic
1034788636 7:153947818-153947840 TCCTAGGACCCACCTGTGAGCGG - Intronic
1034992892 7:155559317-155559339 GCACAGGGCCCTTCTGAGAGTGG - Intergenic
1035133259 7:156675327-156675349 TCACAGGACCCTCCTGTGAGAGG - Intronic
1036216386 8:6883241-6883263 ACCCTGGACCCTCCAGTGAGGGG - Intergenic
1036913089 8:12775303-12775325 TCACATGACCTCCCTGAGAGGGG - Intergenic
1037858760 8:22389923-22389945 TCACAGTGCCCTCCTCTGGGTGG + Intronic
1038432972 8:27514715-27514737 TCACAGGAACCTCCTGTGCGTGG - Intronic
1039728770 8:40252247-40252269 TCATAAGACCCTCCTGGGTGAGG + Intergenic
1041869848 8:62620271-62620293 TCATAAGACCCTCATTTGAGAGG - Intronic
1042207961 8:66347895-66347917 TCATAAGACTCTCATGTGAGAGG + Intergenic
1042208781 8:66356318-66356340 TCATAAGACCCTCATGTGAGAGG + Intergenic
1042947880 8:74173255-74173277 TCATAAGACCCTCAGGTGAGAGG + Intergenic
1045881857 8:107050376-107050398 TCATAAGACCCTCATGTAAGTGG + Intergenic
1049047981 8:140167868-140167890 GAGCAGAACCCTCCTGTGAGAGG - Intronic
1049988397 9:972076-972098 TCCCAGGAGCCTCCTGGGCGGGG - Intergenic
1051065055 9:13093042-13093064 ATACAGGACCCTCATGTGAAAGG - Intergenic
1055122007 9:72671310-72671332 TCATAAGTCCCTCATGTGAGAGG - Intronic
1055290542 9:74778275-74778297 CCACAGGATCCCCCTGTGGGAGG + Intronic
1057520974 9:95760124-95760146 TCATAAGACCCTCATTTGAGAGG - Intergenic
1059735419 9:117095118-117095140 TCACAGGACCTTCTTTTCAGTGG + Intronic
1060901716 9:127263472-127263494 TCACTGGCCGCTCCAGTGAGAGG - Intronic
1061766315 9:132883790-132883812 TCACAAGGCGCTCCAGTGAGAGG + Intronic
1062282919 9:135759959-135759981 TCACTGTCCCCTCCTGGGAGTGG - Intronic
1185801319 X:3013853-3013875 TCCCAGCAGCGTCCTGTGAGTGG + Intronic
1186080827 X:5930032-5930054 TCATAAGACCCTCCTATGAGAGG - Intronic
1187614266 X:20976030-20976052 TCATAAGACCCTCAGGTGAGAGG + Intergenic
1189276335 X:39788838-39788860 TCATAAGACCCTCATGTGAGAGG - Intergenic
1189353432 X:40294236-40294258 TCACAGGGCCCTCCTGCCTGTGG + Intergenic
1189651629 X:43196201-43196223 TCACAAAACCCTCCTGTGAGAGG + Intergenic
1189765708 X:44369983-44370005 TCTGAAGACCCTCATGTGAGAGG + Intergenic
1193416879 X:81236369-81236391 ACAAAGGACATTCCTGTGAGAGG + Intronic
1196300796 X:114047951-114047973 TCAGAGGACCTTACAGTGAGGGG + Intergenic
1197251537 X:124220941-124220963 TCATAGGACCTTCATGTGAGAGG + Intronic
1198564538 X:137890657-137890679 TCAAAAGACCCTTATGTGAGAGG - Intergenic
1199479979 X:148287779-148287801 TCACAGTACCTACTTGTGAGAGG + Intergenic
1200054852 X:153454896-153454918 TCACAGGACCAGCCAGTCAGAGG + Exonic
1200218696 X:154380076-154380098 TCTCAGGTCCTCCCTGTGAGCGG - Intronic