ID: 1035133261

View in Genome Browser
Species Human (GRCh38)
Location 7:156675339-156675361
Sequence GGGTCCTGTGACCCACTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133247_1035133261 24 Left 1035133247 7:156675292-156675314 CCTCCCGGCTCCCTCCGTCTTTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133254_1035133261 13 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133252_1035133261 14 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133249_1035133261 21 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133250_1035133261 20 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154
1035133255_1035133261 10 Left 1035133255 7:156675306-156675328 CCGTCTTTGGAGACGAGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 126
Right 1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133261 Original CRISPR GGGTCCTGTGACCCACTTTA GGG Intronic
900362323 1:2294999-2295021 GGGGCCTGACATCCACTTTAGGG - Intronic
901179490 1:7331353-7331375 GGGTCCTGAGACCCGCATGAGGG - Intronic
901265852 1:7910195-7910217 GGTTTCTGTGACCCACCTTGGGG - Intergenic
903387391 1:22936464-22936486 GGGGCCTGAGACCCACTCTCTGG - Intergenic
907112262 1:51936722-51936744 GGGCTCTCTGACCCAGTTTAGGG - Intronic
907566947 1:55444330-55444352 GGGTCTTGTGACCTACGTTTAGG + Intergenic
907923174 1:58931766-58931788 GGGTCCTGTGTGCCAGGTTAAGG - Intergenic
909076186 1:71053327-71053349 GGTTTCTGTGACTCACTTTGTGG + Intergenic
911732708 1:101307160-101307182 GGGTCTTATGACCTATTTTAAGG - Intergenic
911856509 1:102884226-102884248 GGTTTCTATGACCCACTTTGGGG - Intronic
915736020 1:158085770-158085792 GGTTCCTGTGACCATATTTAGGG + Intronic
916214698 1:162384957-162384979 GGTTCCTGCAACCCACTTTTAGG + Intronic
918316128 1:183324018-183324040 GGGTCCCCTTGCCCACTTTATGG - Intronic
919523162 1:198614421-198614443 GGGTCTTATGACCTACTTTCAGG - Intergenic
920061107 1:203227585-203227607 GGGTCCTGTGACACACATTGTGG - Intronic
921556098 1:216600840-216600862 GTGTCCTGTGACCCGCTGTGAGG - Intronic
922146157 1:222946915-222946937 GGGTATTGTGAACCACATTAAGG + Intronic
922804960 1:228380835-228380857 GGATCCTATGACCCGCTTTTGGG + Intergenic
924758962 1:246966821-246966843 AGGTCCTGTGAGCCACTGCAAGG + Intronic
1064098321 10:12440962-12440984 GGGTCTTATGACCGACTTTCAGG - Intronic
1065192944 10:23231452-23231474 GGAACCTGTGTACCACTTTATGG + Intronic
1067762050 10:49055785-49055807 GGCTCATGTCACCCACTTAATGG - Intronic
1069609553 10:69763679-69763701 GGTTCCTGTGACCCACTCCTTGG + Intergenic
1069787523 10:70998221-70998243 GAGTGCTGAGACCCACCTTATGG + Intergenic
1070221706 10:74454908-74454930 GGGTCTTGTGACCTACTTAAGGG + Intronic
1070916065 10:80155684-80155706 AGGTCCTGTGGCACACTATACGG + Exonic
1071872786 10:89813805-89813827 GGTTTCTATGACCCACCTTAAGG - Intergenic
1074429106 10:113378111-113378133 GGGTCCTGGAACCCATGTTAGGG + Intergenic
1074884035 10:117680852-117680874 GGGTCTTGGGAACCACTTCAGGG + Intergenic
1076510729 10:131012134-131012156 GGGTTCTCTGTGCCACTTTATGG - Intergenic
1077437207 11:2548661-2548683 GGATACAGTGACCCACTTCAAGG + Intronic
1078757030 11:14220960-14220982 GGGTCCTCTGTCCCATTTCAAGG - Intronic
1079904183 11:26224267-26224289 GGGTGCTGTGACCTATTGTACGG - Intergenic
1083859443 11:65412034-65412056 GGGTCCTGTGCCCCTCGTTCTGG + Exonic
1084077507 11:66792146-66792168 GGGTCCTCTAACCCCTTTTAAGG + Intronic
1086000244 11:81974819-81974841 GGGTCTTATGATCTACTTTAAGG - Intergenic
1086173918 11:83867276-83867298 GGTACCTTTAACCCACTTTATGG - Intronic
1087902994 11:103663720-103663742 GGTTTCTATGACTCACTTTAGGG - Intergenic
1090688932 11:129156744-129156766 GGGTTCAGGGACCCACTTGAGGG - Intronic
1091938671 12:4454624-4454646 GGTTCCTATGACTCACTTTGTGG - Intergenic
1096042673 12:48531719-48531741 GGGTCTTATGACCTACTTTCAGG - Intergenic
1097689938 12:62725359-62725381 GGATCCTGTGACCTGCTTCAGGG - Intronic
1098296841 12:69012524-69012546 AGGTCTTATGACCCACTTTCAGG - Intergenic
1103467081 12:121150380-121150402 GGGTCATGTGACCCACCATTTGG - Intronic
1108300469 13:49069343-49069365 GGGTCTAGTGAGCCATTTTAAGG - Intronic
1112346270 13:98592657-98592679 GGGACCTGTGATCCACCCTAAGG + Intergenic
1115667294 14:35565266-35565288 GGGTCATGGGACCCAGTTTTTGG + Intronic
1117445146 14:55797114-55797136 GGGTCTTATGACCTACTTTCAGG + Intergenic
1118107122 14:62672310-62672332 GGTTCCTGTTTCTCACTTTATGG - Intergenic
1118490239 14:66251815-66251837 GGGCCCTGTAAGCCACATTAAGG - Intergenic
1119130530 14:72168393-72168415 GGGTCCTGTGACCCAGAGCATGG + Intronic
1119622673 14:76144315-76144337 GGGTCCTATGACCTATTTTCAGG - Intergenic
1120813625 14:88830336-88830358 ATGTCCTGTTACCCACTTTGAGG + Intronic
1120819983 14:88903125-88903147 GGGTCTTGTAAGCCACTGTAAGG + Intergenic
1121547558 14:94772961-94772983 GGTTCCTGTGACCCCCTTCCCGG - Intergenic
1125718251 15:41831982-41832004 GGGTTCTGACACCCTCTTTAGGG + Intronic
1127378003 15:58402647-58402669 CGCTCCTGTGACCCAATGTAAGG + Intronic
1129726216 15:77903105-77903127 GGGTCCTGCCCCCCACATTATGG + Intergenic
1130893166 15:88150449-88150471 GGGTCCTGGGACCCCTGTTAAGG + Intronic
1131486607 15:92826022-92826044 GGCTTCTGTGACCCACCTTGGGG + Intergenic
1132302607 15:100785412-100785434 GTTTCCTGTGGCCCACTTGATGG - Intergenic
1134025453 16:10949628-10949650 GGGCCCTGTAAATCACTTTAAGG + Intronic
1137802122 16:51271054-51271076 GGGGCCTGGGACCCCCTTTTGGG - Intergenic
1139845303 16:69916814-69916836 GGGTCCTAGGAACCACTTGAGGG + Intronic
1140530541 16:75662094-75662116 GGCTCCTGTGACCTCCTTTTTGG + Intronic
1143738619 17:8934885-8934907 GGGTCCAGTGAGCCATGTTATGG - Intronic
1146521292 17:33527536-33527558 GTGTTGTGTGTCCCACTTTATGG + Intronic
1147915238 17:43881808-43881830 GGGTCCTGTGCCCTACTTGGTGG - Intronic
1150666861 17:67148065-67148087 GGGTCCTGCGACCCTCTTTTTGG - Intronic
1150849460 17:68690699-68690721 GGGTCCTGTGGTCCACTTCCAGG - Intergenic
1151607078 17:75144614-75144636 GGTTCCTGTGACCCCTTCTATGG - Intronic
1151916672 17:77123389-77123411 TGGGCCTGGGACCCACTTCAGGG - Intronic
1153167943 18:2283323-2283345 GGGACGTGTGAGCCACATTAAGG - Intergenic
1155209490 18:23588038-23588060 GGTTCCTGTGACTTACTTCAGGG + Intergenic
1157680578 18:49602332-49602354 GGTTTCTATGACCCACCTTAGGG - Intergenic
1159741604 18:72178283-72178305 TGCTCCTGTGACCCACTTTTAGG - Intergenic
1160331744 18:77999522-77999544 GGGTGCTGTGAACCTTTTTATGG - Intergenic
1160563699 18:79774077-79774099 GGCTGCTGGGCCCCACTTTATGG + Intergenic
1163765286 19:19160406-19160428 GGATCCTGTGACCCATTTTATGG - Intronic
1165659747 19:37566873-37566895 GGGTCTTGTGAGCCATATTAAGG - Intronic
1167572564 19:50298238-50298260 GGGTCCTGTGATCCACAGTCAGG + Intronic
925190819 2:1882055-1882077 GGGTGCTTAGACCCATTTTACGG - Intronic
931436085 2:62248228-62248250 GGTTTCCATGACCCACTTTAGGG - Intergenic
931960544 2:67477719-67477741 GGGTCCTGTTTCCCTTTTTAGGG + Intergenic
933769629 2:85734817-85734839 GGGCACTGTACCCCACTTTATGG + Intergenic
937538252 2:122917600-122917622 GGGTCTTATGACCTACTTTCAGG - Intergenic
940097402 2:149993240-149993262 GGGTCTTATGACCTGCTTTAGGG + Intergenic
942420186 2:175798952-175798974 GGGTCCTCTGAGCCACTTTGGGG + Intergenic
943082025 2:183267162-183267184 GGTTTCTGTGACTCACTTTCGGG + Intergenic
944663613 2:201940970-201940992 GTGTCTTTTGACCCACTTCAGGG - Intergenic
945305052 2:208252131-208252153 GGTTCCTGTGACCCATATTCAGG + Intronic
945419505 2:209617134-209617156 GGTTTCTATGACCCACCTTAAGG + Intronic
945614738 2:212053636-212053658 CTGCCCTGTGAACCACTTTAAGG - Intronic
945865182 2:215166519-215166541 GTGTCCTGTCCCCAACTTTATGG - Intergenic
946015363 2:216599838-216599860 GGGTCTTATGACCTACTTTCAGG - Intergenic
947935627 2:234001182-234001204 GGGTCCTATGACCTGCTGTAGGG + Intronic
1168895671 20:1321690-1321712 AGGCCCTGTGAGCCTCTTTAAGG - Intronic
1169684897 20:8260457-8260479 GGGTCCTGTGGAGGACTTTAGGG + Intronic
1169774740 20:9240241-9240263 GGGTCTTATGACCTACTTTCAGG + Intronic
1171461054 20:25298126-25298148 GGGACCTGTGGCCCACTTGCAGG - Intronic
1171904328 20:30888324-30888346 GGGGTCTGGGACCCACTTGAGGG + Intergenic
1172479311 20:35261572-35261594 GGATCCTGTGTCCCACTTCCAGG + Intronic
1175373554 20:58509248-58509270 GGGTGCTGTGAGCCACGTCAGGG + Intronic
1175637625 20:60598847-60598869 GGGTTCTGCTCCCCACTTTAGGG + Intergenic
1179720855 21:43315427-43315449 GGGTCCTGCGACCCACCCAAGGG + Intergenic
1184496211 22:44843142-44843164 GGCTACTGTTACCCACTTCATGG - Intronic
1185051792 22:48557859-48557881 GGGTCCTGGGACCCATTTTCAGG - Intronic
949152075 3:781380-781402 GGGTCTTGTGACCTACTTCAGGG - Intergenic
949689041 3:6613598-6613620 GGTTTCTGTGACCCACCTTGGGG - Intergenic
951329409 3:21347942-21347964 GGGTCTTATGACCTACTTTCAGG - Intergenic
951740196 3:25912984-25913006 GGGTCATGTGAGCCACTCTGGGG + Intergenic
952162765 3:30710869-30710891 GGGTCTTACGACCCACTTCAGGG + Intergenic
956064590 3:65383822-65383844 GGGTCCTGTGAAGAACTTTAGGG - Intronic
956772509 3:72538429-72538451 TGGTCCCATGACCCAATTTATGG - Intergenic
960036570 3:113108359-113108381 GGGTCTTATGACCTACTTTCAGG + Intergenic
960507923 3:118515541-118515563 GGGTCTTATGACCCACTTTCAGG - Intergenic
961537910 3:127581025-127581047 GGGTCCTGGGAACCACTCTGGGG + Intronic
962917370 3:139916928-139916950 TGTTGCTGTGACCCAGTTTACGG - Intergenic
963648166 3:147943771-147943793 GGTTTCTGTGACTCACTTCAGGG + Intergenic
965080694 3:164026847-164026869 GGGTCTTATGACCTACTTTCAGG + Intergenic
968704314 4:2070948-2070970 GGGCCCTGTGCCCCACTTCAAGG + Intergenic
969963997 4:10975512-10975534 TGGTCCTGTTACCCAATTTCTGG + Intergenic
970958463 4:21843509-21843531 GGGTCTTATGACCCACTTCAAGG - Intronic
972667998 4:41185415-41185437 GGGTCCTGAAACCCTCTTTATGG - Intronic
973822074 4:54670645-54670667 GGTTTCTGTGACTCACTTTGCGG - Intronic
976924112 4:90475730-90475752 GAGTCCTTTGCCCCTCTTTATGG - Intronic
979998644 4:127463624-127463646 GGGGTCAGTGACCCACTTGAGGG + Intergenic
980185684 4:129458338-129458360 AGGTCTTATGACCCACTTTCAGG + Intergenic
982624100 4:157743568-157743590 GGGTCCTATGACCCACTTAAGGG + Intergenic
985516434 5:347745-347767 GGGTCCTGGGAACCCCTCTAGGG + Intronic
991915519 5:71600997-71601019 GGTCCCTGTGCCCCCCTTTAAGG + Intronic
992093121 5:73337113-73337135 CTGTCCTATGACCAACTTTAGGG + Intergenic
992211748 5:74486798-74486820 GGGTCTTATGATCTACTTTAGGG - Intergenic
994915825 5:105977733-105977755 GGGTCTTATGACCTGCTTTAGGG - Intergenic
995897937 5:117036636-117036658 GGGTCTTTTGACCTACTTTCAGG - Intergenic
996996851 5:129707129-129707151 TGGTTGTGAGACCCACTTTAAGG + Intronic
997797801 5:136828454-136828476 GGGGTCTGGGACCCACTTCAGGG + Intergenic
999417727 5:151414439-151414461 GGGTCTTGTGAGCCAGATTAAGG + Intergenic
1001040874 5:168334262-168334284 GTGTCCTGTGAGCCACGTTAGGG - Intronic
1011421318 6:87176456-87176478 GGGTCTTATGACTTACTTTAGGG + Intronic
1011837357 6:91450030-91450052 GGTTTCTGTGACTCACTTTTGGG - Intergenic
1013958640 6:115870553-115870575 TTCACCTGTGACCCACTTTATGG - Intergenic
1015836509 6:137426065-137426087 GGGTCTTATGACCTACTTTCAGG + Intergenic
1015846490 6:137525541-137525563 GGTTTCTATGACTCACTTTATGG + Intergenic
1015884086 6:137898496-137898518 GGGCCTTGTGAGCCACATTAAGG - Intergenic
1017444088 6:154491800-154491822 GTGTCCTGTTACCCAGTTCAGGG + Intronic
1020013060 7:4816809-4816831 GGGTGCGGTGAGCCACTTTCTGG - Intronic
1021642208 7:22749185-22749207 GGTTTCTAGGACCCACTTTAGGG - Intergenic
1022303813 7:29127700-29127722 GGGTCTTATGACCTACTTTCAGG - Intronic
1023066011 7:36378548-36378570 GGGTTCAGGGACCCACTTGAGGG + Intronic
1024025345 7:45405417-45405439 GGGTCCTTTTACCAGCTTTATGG + Intergenic
1024361173 7:48470049-48470071 GTGTCCTGTAGGCCACTTTAGGG + Intronic
1024386153 7:48754199-48754221 TGGTCCCATGACCCACTTTAGGG + Intergenic
1027469406 7:78554629-78554651 GGGTCCTATGACCTGCTTCAGGG - Intronic
1027797834 7:82716042-82716064 GGGTCTTATGACCCACTTCAGGG - Intergenic
1029542918 7:101195115-101195137 GGGTCCTGATACCCAATCTAAGG + Exonic
1033364209 7:140659118-140659140 GGTTACTGTGGCCCAGTTTACGG - Intronic
1034005374 7:147466447-147466469 GGTTTCTATGACCCACTTTGGGG + Intronic
1035133261 7:156675339-156675361 GGGTCCTGTGACCCACTTTAGGG + Intronic
1036460538 8:8948618-8948640 GGGTCTTATGACCTGCTTTAGGG - Intergenic
1041901236 8:62985353-62985375 GGTACCTGAGACCTACTTTAAGG - Intronic
1047797154 8:128269220-128269242 AGATTCTGTGACCCTCTTTAAGG - Intergenic
1050096964 9:2077004-2077026 TGGTTGTGTGCCCCACTTTAGGG + Intronic
1050255014 9:3785295-3785317 GGGTCATCTGACACATTTTATGG - Intergenic
1051817061 9:21120860-21120882 GGGTCTTGCGACCTACTTTCAGG + Intergenic
1056230230 9:84535884-84535906 GGGGTCTGGGACCCACTTGAGGG + Intergenic
1187143373 X:16615541-16615563 GGGTCTTATGACCTACTTTCAGG - Intronic
1189960747 X:46322873-46322895 GGGTCATATAACCTACTTTAGGG + Intergenic
1190579376 X:51876037-51876059 TGGTCATGTGACCCACACTATGG - Intronic
1191846250 X:65550195-65550217 GGGTCCTGTGCCCCTCGTTCTGG - Intergenic
1192772980 X:74213007-74213029 GGGGTCTGTGACCCTCTTAAAGG - Intergenic
1196135952 X:112209719-112209741 TGGACCCGTGACCCACTTTATGG + Intergenic
1201605852 Y:15783834-15783856 GGGTCCTTTGATCCTCTTTCTGG - Intergenic