ID: 1035133262

View in Genome Browser
Species Human (GRCh38)
Location 7:156675340-156675362
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133252_1035133262 15 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133259_1035133262 -10 Left 1035133259 7:156675327-156675349 CCTCTCACAGGAGGGTCCTGTGA 0: 1
1: 1
2: 8
3: 44
4: 221
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133249_1035133262 22 Left 1035133249 7:156675295-156675317 CCCGGCTCCCTCCGTCTTTGGAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133250_1035133262 21 Left 1035133250 7:156675296-156675318 CCGGCTCCCTCCGTCTTTGGAGA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133247_1035133262 25 Left 1035133247 7:156675292-156675314 CCTCCCGGCTCCCTCCGTCTTTG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133255_1035133262 11 Left 1035133255 7:156675306-156675328 CCGTCTTTGGAGACGAGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 126
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data
1035133254_1035133262 14 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133262 7:156675340-156675362 GGTCCTGTGACCCACTTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr