ID: 1035133268

View in Genome Browser
Species Human (GRCh38)
Location 7:156675350-156675372
Sequence CCCACTTTAGGGGTGGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133255_1035133268 21 Left 1035133255 7:156675306-156675328 CCGTCTTTGGAGACGAGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 126
Right 1035133268 7:156675350-156675372 CCCACTTTAGGGGTGGGGAGAGG No data
1035133254_1035133268 24 Left 1035133254 7:156675303-156675325 CCTCCGTCTTTGGAGACGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1035133268 7:156675350-156675372 CCCACTTTAGGGGTGGGGAGAGG No data
1035133252_1035133268 25 Left 1035133252 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1035133268 7:156675350-156675372 CCCACTTTAGGGGTGGGGAGAGG No data
1035133259_1035133268 0 Left 1035133259 7:156675327-156675349 CCTCTCACAGGAGGGTCCTGTGA 0: 1
1: 1
2: 8
3: 44
4: 221
Right 1035133268 7:156675350-156675372 CCCACTTTAGGGGTGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133268 Original CRISPR CCCACTTTAGGGGTGGGGAG AGG Intronic
No off target data available for this crispr