ID: 1035134534

View in Genome Browser
Species Human (GRCh38)
Location 7:156688409-156688431
Sequence CTAGCAAGTGATGAGTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035134532_1035134534 3 Left 1035134532 7:156688383-156688405 CCTACTTCACATACACGCCACAG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1035134534 7:156688409-156688431 CTAGCAAGTGATGAGTAATGAGG 0: 1
1: 0
2: 0
3: 9
4: 167
1035134529_1035134534 20 Left 1035134529 7:156688366-156688388 CCTCAAGCCAGACCTAACCTACT 0: 1
1: 0
2: 3
3: 21
4: 148
Right 1035134534 7:156688409-156688431 CTAGCAAGTGATGAGTAATGAGG 0: 1
1: 0
2: 0
3: 9
4: 167
1035134531_1035134534 8 Left 1035134531 7:156688378-156688400 CCTAACCTACTTCACATACACGC 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1035134534 7:156688409-156688431 CTAGCAAGTGATGAGTAATGAGG 0: 1
1: 0
2: 0
3: 9
4: 167
1035134530_1035134534 13 Left 1035134530 7:156688373-156688395 CCAGACCTAACCTACTTCACATA 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1035134534 7:156688409-156688431 CTAGCAAGTGATGAGTAATGAGG 0: 1
1: 0
2: 0
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035134534 Original CRISPR CTAGCAAGTGATGAGTAATG AGG Intronic
904269111 1:29337639-29337661 CTTCCAGGTGATGAGTGATGTGG - Intergenic
907022427 1:51081190-51081212 TTAGGAAGTGATGAGTATTCTGG + Intergenic
907323478 1:53620230-53620252 CTAACCAGTGAGGACTAATGAGG - Intronic
907966136 1:59331595-59331617 CTAGCAAGTGATTACTCAGGGGG - Intronic
908898904 1:68932753-68932775 TAAGCAAGGGATGAGAAATGAGG + Intergenic
909871999 1:80752713-80752735 CAACCAAGTGTTGATTAATGAGG + Intergenic
911323741 1:96444960-96444982 CTAGCAAGAGATGTGGAAGGAGG + Intergenic
912764709 1:112397678-112397700 CTAGCAATAGATGATTACTGGGG - Intronic
915995142 1:160554306-160554328 TTAGAAAGTGATGAGTTTTGAGG - Intronic
916089422 1:161295796-161295818 CTTCCAGGTGATGAGAAATGTGG - Intergenic
917985751 1:180316866-180316888 CTAGGAAGTGATGAGTACGCTGG + Intronic
1063889366 10:10613999-10614021 CTAGCAAGTGTAGAATAAAGAGG + Intergenic
1065192024 10:23221294-23221316 CTAGCATGAGAAGAGTAAGGGGG + Intronic
1065865128 10:29908349-29908371 ATATAAAGTGATGAGCAATGAGG + Intergenic
1065882617 10:30049438-30049460 CTAGCAGGTGATGAAGAGTGAGG - Intronic
1067453858 10:46399296-46399318 CAAGCAAGGGATGAGAAATTTGG + Intergenic
1067583338 10:47459978-47460000 CAAGCAAGGGATGAGAAATTTGG - Intergenic
1067633343 10:47985334-47985356 CAAGCAAGGGATGAGAAATTTGG - Intergenic
1069268861 10:66498534-66498556 CTAACAAGTGATACGAAATGTGG - Intronic
1070580837 10:77718132-77718154 CTAGAAAGTGTTGATGAATGGGG - Intergenic
1071813788 10:89210403-89210425 CTATCAAGTGCTGACTAAGGTGG + Intergenic
1073773576 10:106761987-106762009 CTAGCATGTGCTGAGCATTGTGG + Intronic
1074113962 10:110441997-110442019 CTAGAGAGTGATGTGTAAAGGGG - Intergenic
1075955306 10:126518277-126518299 CTAGCAAATGAGGAGTTTTGAGG + Intronic
1078459115 11:11499829-11499851 CTCACAGGTGATGGGTAATGTGG + Intronic
1078597800 11:12703415-12703437 ATAGCAAGTGCTCAGAAATGGGG + Intronic
1080248602 11:30207935-30207957 GTAGCAAGAGATGAGTAAAGTGG + Intergenic
1080394842 11:31880642-31880664 CTACCAGGTGCTGAGTACTGTGG + Intronic
1082133849 11:48524689-48524711 GTAGCATGTGGTGAATAATGGGG - Intergenic
1082140961 11:48608666-48608688 GTAGCATGTGGTGAATAATGTGG - Intergenic
1082568123 11:54705488-54705510 GTAGCATGTGGTGAATAATGTGG - Intergenic
1082569724 11:54723523-54723545 ATAGCATGTGGTGAATAATGTGG - Intergenic
1082612403 11:55317142-55317164 GTAGCATGTGGTGAATAATGTGG - Intergenic
1082618110 11:55387111-55387133 GTAGCATGTGGTGAATAATGTGG - Intergenic
1082622682 11:55443053-55443075 ATAGCATGTGGTGAATAATGTGG - Intergenic
1082625082 11:55474633-55474655 GTAGCATGTGGTGAATAATGTGG - Intergenic
1082997554 11:59265729-59265751 CTAGAAAGTGGGGAGGAATGTGG - Intergenic
1085625801 11:78071886-78071908 CAGGCAAATGATGAGTGATGAGG + Intronic
1087237516 11:95736549-95736571 CTAGAAAGTGATAAGTATTATGG + Intergenic
1089158848 11:116422753-116422775 CCAGCCAGGGATGAGGAATGGGG + Intergenic
1091038837 11:132257607-132257629 CCAGCAAGTGGTGTGTAGTGAGG - Intronic
1091661884 12:2390333-2390355 CCTGCCTGTGATGAGTAATGGGG + Intronic
1093910375 12:24740620-24740642 CCAGGAAGTGATGAGTCATCAGG + Intergenic
1099175415 12:79415851-79415873 AAAGAAAGTGCTGAGTAATGCGG + Intronic
1099837269 12:87922711-87922733 CTAGCAAGTGAAGAGTAAGATGG + Intergenic
1100009953 12:89941031-89941053 ATAGGAAGTGATGAGCAATAAGG + Intergenic
1101440172 12:104697999-104698021 CAGGCAAGAGATGAGTAATGAGG - Intronic
1103268129 12:119648161-119648183 ATAGCAAGTGATGAGGGGTGGGG - Intergenic
1104738516 12:131154912-131154934 CTTGCAGCTGAAGAGTAATGGGG - Intergenic
1105315959 13:19263635-19263657 ATGGCAAGTGATGAGAGATGAGG + Intergenic
1107038211 13:35922330-35922352 CAAGGAATTCATGAGTAATGGGG - Intronic
1107447874 13:40484440-40484462 CAGTAAAGTGATGAGTAATGGGG + Intergenic
1108310154 13:49181251-49181273 TTATCCAGTGATGAGTAAAGAGG - Intronic
1108467391 13:50730388-50730410 ATTGCAAGTGATAAGCAATGAGG - Intronic
1110363148 13:74650810-74650832 CTGGCAGGTGATGAGGAAAGTGG + Intergenic
1110789195 13:79568694-79568716 CTAGCAATTGAATAGTGATGAGG + Intergenic
1115843124 14:37495008-37495030 CTAGAAAGTGAGGAGTGATTAGG + Intronic
1115967825 14:38912006-38912028 CCACCCAGTGATGAGGAATGGGG - Intergenic
1116027957 14:39537284-39537306 CTGCCAAGTGAAGAGGAATGGGG - Intergenic
1119101450 14:71883736-71883758 TTAGCATGTGATGAGCAGTGAGG - Intergenic
1119255836 14:73195467-73195489 CTAGTAAGTGATGAGTAGGCTGG - Intronic
1124546892 15:30637180-30637202 CTAGCAAGCCATTAGTAAAGTGG - Intronic
1124780494 15:32627176-32627198 CTAGCAAGCCATTAGTAAAGTGG - Intronic
1126265955 15:46754291-46754313 ATAGCAAGAGATGATCAATGTGG + Intergenic
1127549321 15:60021735-60021757 CTAGCATGTAATGAGCAGTGAGG + Intronic
1134053905 16:11157238-11157260 CTAGTCAGTGATCAGTGATGTGG + Intronic
1136224478 16:28849473-28849495 CTAGCAAGTTATGAGTTTTTGGG + Intronic
1137795406 16:51213309-51213331 CTAGAAAGTGAGGAGTTAAGAGG - Intergenic
1139204797 16:65017022-65017044 TTAGCAAATAATGAGCAATGAGG + Intronic
1143075036 17:4334448-4334470 CTAAGAAGTGATGAGTAAAATGG - Intronic
1144808864 17:17985737-17985759 CTAGCAAGTGTTTACCAATGGGG - Intronic
1145877685 17:28332003-28332025 CTGGGAAGTGATGAGGAATTGGG - Intronic
1146576319 17:33995029-33995051 CAAGCTAGTTATGAGAAATGTGG - Intronic
1147476076 17:40712648-40712670 GGACCAAGTGATAAGTAATGTGG - Intergenic
1150220836 17:63495135-63495157 CTAGAGAGTGATGAATAGTGGGG - Intronic
1150655398 17:67035923-67035945 CGAGCAAGAGATGAGTCATGAGG - Intergenic
1153222232 18:2871743-2871765 CAATCAGGTGATGAATAATGAGG - Intronic
1155042158 18:22073852-22073874 CTTGCAGGTGATAAGTGATGAGG + Intergenic
1157253555 18:46117526-46117548 TTAGGAAGTGATGACTAAGGGGG + Intronic
1158118016 18:54018320-54018342 CAAGCAAATGAAGAGTGATGGGG - Intergenic
1158924833 18:62245249-62245271 ATAGCAGGTGATAAGTAATCAGG - Intronic
1161296146 19:3521213-3521235 CTAGGAAGTGCTGGGTCATGTGG + Intronic
1161746542 19:6063641-6063663 CAGGCAAGTGATGAGCAGTGGGG + Intronic
1164659081 19:29947546-29947568 CAATCTAGTGATGAGTAATGAGG + Intronic
1168360395 19:55734964-55734986 CTAATGAGTGATGAGAAATGGGG + Intronic
927624442 2:24699725-24699747 CTAGCCAGATATGAGAAATGTGG + Intronic
928401545 2:30982220-30982242 ATAGCAAGTGATTGATAATGAGG + Intronic
928416009 2:31092370-31092392 CTGGTAGGTGATGAGTCATGAGG - Intronic
929705062 2:44201934-44201956 CTGGGATGTTATGAGTAATGAGG + Exonic
930580118 2:53201093-53201115 CTAGCCAGTGAAGAGTGAGGAGG - Intergenic
930685588 2:54304295-54304317 CTACCACGTGCTGAGTAATGAGG + Intronic
931166554 2:59755177-59755199 CTGGCAAGGGATGGGTCATGTGG - Intergenic
932777282 2:74535856-74535878 CTAGCAAGTGATGGGTCAGGTGG + Intronic
935834599 2:107036979-107037001 CTACCCAGTGAGGAGGAATGGGG - Intergenic
942146970 2:173036237-173036259 CAAGCAGGTGATGAGTATTTGGG + Intronic
943769161 2:191696096-191696118 CTAGCTAGTGATCATTTATGTGG - Intronic
945042490 2:205753931-205753953 CTAGCAAGTGTTGAGTTTTGAGG + Intronic
1169522788 20:6391100-6391122 CTGTGAATTGATGAGTAATGTGG - Intergenic
1169876578 20:10304108-10304130 ATAGTAAGTGATGAATAGTGTGG + Intronic
1170283060 20:14673306-14673328 CCAGAAAGTGATGAGCAATTGGG - Intronic
1172831223 20:37836699-37836721 CTAGCAAGTGCTGAGTGTTCAGG - Intronic
1176819350 21:13642329-13642351 CCAGCCAGTGATTAGAAATGTGG - Intergenic
1177677689 21:24323213-24323235 ATAGCAAGTCATGTTTAATGAGG - Intergenic
1179113423 21:38467448-38467470 CTAGCAAGTTATGTGTGGTGGGG + Intronic
949742017 3:7246491-7246513 CTACCAAGTGATGACAACTGAGG - Intronic
950175924 3:10874370-10874392 CTAGCCTGTGATGAGGTATGAGG + Intronic
950294581 3:11817894-11817916 ATTGCAAGTGATGAGAAATGAGG + Intronic
952531170 3:34263537-34263559 CTAGAAGGTGATGAGAGATGAGG - Intergenic
954744917 3:52782313-52782335 CTGGCATGTGGTGAGTGATGGGG - Intronic
957122826 3:76118199-76118221 GTAGAAAGTGAAGAATAATGTGG - Intronic
957780923 3:84816692-84816714 GTAGCAATTGATGAGTACAGTGG + Intergenic
959292980 3:104498372-104498394 GTAGGAAAGGATGAGTAATGTGG + Intergenic
960545231 3:118906502-118906524 CCAGCCAGTGATGAGGAATTAGG - Intronic
962645891 3:137439568-137439590 TTAGATAGTGATGAGTAGTGTGG - Intergenic
962855133 3:139338377-139338399 CTAGCAGGTGGTGAGTAAAATGG + Intronic
964474477 3:157086150-157086172 CCAGGAAGTGATGATTACTGGGG + Intergenic
964874247 3:161347895-161347917 TAATTAAGTGATGAGTAATGTGG + Intronic
966457873 3:180138240-180138262 ATATCACTTGATGAGTAATGAGG - Intergenic
967982195 3:195072341-195072363 CTAGCAAGTGGGGAGCAAAGAGG + Intronic
969099229 4:4756457-4756479 CCAGCAAGGGATGAATAAGGGGG + Intergenic
970984008 4:22134407-22134429 CTAGCAAGTGAACAGCAAGGGGG - Intergenic
971048063 4:22828538-22828560 CTATCAAGTGATGATTTAAGAGG + Intergenic
971427556 4:26531038-26531060 CTAGCAACTGATGAGCATGGTGG - Intergenic
973330738 4:48908019-48908041 TTAGCATTTAATGAGTAATGAGG + Intergenic
975569633 4:75801582-75801604 CTAGAAAGTGCTGAAAAATGAGG + Intronic
976691569 4:87873020-87873042 CTAGCAATTGTTAAGTCATGAGG - Intergenic
978558607 4:110007699-110007721 CTACCAAGTTCTGAGTAATTTGG - Intronic
981036694 4:140176865-140176887 CTAGCAGGAGATGAGTCATAAGG - Intergenic
983061940 4:163170409-163170431 CTAGGAAGTGATTGGTATTGAGG - Intergenic
983967769 4:173834005-173834027 CCAGCAAGTGAGTAGCAATGTGG + Intergenic
986359614 5:6963985-6964007 CTAGCAAATGATTAGCAAAGAGG - Intergenic
986673073 5:10160260-10160282 CTAGCATGTAATGAGCAGTGAGG - Intergenic
989167786 5:38447792-38447814 CTGGAAAGTGATCAGAAATGCGG + Intronic
992964414 5:81985323-81985345 CTAGCAAGAGAAGACTAATATGG - Intronic
996060887 5:119032118-119032140 CTAGCAGGTGACGAGGAAAGAGG - Intergenic
999959093 5:156735240-156735262 CCACCCAGTGATGAGGAATGGGG + Intronic
1000725091 5:164760007-164760029 CTAGCAAGATATGAGTGAGGTGG + Intergenic
1003786758 6:9495079-9495101 CTTACAAGAAATGAGTAATGTGG - Intergenic
1005074746 6:21896132-21896154 TTAACAAGTGAGGAGTTATGGGG + Intergenic
1008127391 6:47684328-47684350 TTAGGAAGTGATGAGTTCTGAGG - Intronic
1008531387 6:52463778-52463800 CCAGGAAGTGATGGGCAATGAGG - Intronic
1009835500 6:68996070-68996092 CTAGCAACTCAGGATTAATGTGG + Intronic
1012080705 6:94755340-94755362 TTAGAAAGTGACTAGTAATGTGG + Intergenic
1012853952 6:104478990-104479012 TTAGCAAGTGAGGAGTAGAGAGG + Intergenic
1013248683 6:108313074-108313096 CTGGCCAGTGATGCCTAATGGGG - Intronic
1014120085 6:117714689-117714711 TTAGAAAGTGATAAGTAATATGG - Intergenic
1016270005 6:142277756-142277778 CTAGAAAGAGATGAATGATGTGG - Intergenic
1016358823 6:143246821-143246843 CTAGCAATTGGTGTGAAATGAGG - Intronic
1027511373 7:79085941-79085963 GTAGCAAGAGATGAGAAATTAGG + Intronic
1029190172 7:98766282-98766304 TTAGAAAGTGATGAGTATTATGG - Intergenic
1030807859 7:113938203-113938225 TTAGCAAGTGGTCAGGAATGCGG + Intronic
1031001665 7:116422561-116422583 CTACCAAATGATGGGGAATGGGG + Intronic
1035134534 7:156688409-156688431 CTAGCAAGTGATGAGTAATGAGG + Intronic
1038974396 8:32676852-32676874 ACAGTAAGTGATGAGAAATGGGG + Intronic
1040701677 8:50074246-50074268 CTAGCAGGTGCTGATTCATGAGG - Intronic
1041147119 8:54888834-54888856 CAAGCAATTGGTGAGTAATATGG + Intergenic
1044095081 8:88053379-88053401 ATAGCGAATGATGAGTACTGCGG - Intronic
1044341727 8:91053873-91053895 CTAGTTAGTGTTGACTAATGTGG - Intergenic
1044357664 8:91243236-91243258 CTAGCCAGTTTTGAGTAATTGGG + Intronic
1048744023 8:137593243-137593265 ATATCAAGTGGTGAGGAATGGGG - Intergenic
1051223476 9:14875284-14875306 CCTGAAAGTGATGAGTGATGGGG - Intronic
1055406597 9:75980662-75980684 CTAGCAACTTATCATTAATGAGG - Intronic
1056114637 9:83430038-83430060 TTAGTAAGTGATTAGTGATGGGG - Intronic
1057352443 9:94310604-94310626 CTAGAAAGTAATGAGCACTGAGG - Intergenic
1057655196 9:96945469-96945491 CTAGAAAGTAATGAGCACTGAGG + Intronic
1058441730 9:105014838-105014860 CTAGCAGATGAAGATTAATGAGG - Intergenic
1203528008 Un_GL000213v1:107241-107263 CCAGCCAGTGATTAGAAATGTGG + Intergenic
1187338813 X:18403403-18403425 CTGGGAAGTGCTGAGAAATGAGG + Intergenic
1187607029 X:20896206-20896228 CTGGCAAGTGATGAGTGAGCTGG + Intergenic
1188252575 X:27915825-27915847 CCAGGAAGTGATGACTAATATGG - Intergenic
1188452067 X:30317790-30317812 CTGGGAGGTGATGAATAATGTGG + Intergenic
1190844563 X:54180371-54180393 ATTGCAAGTGATGAAAAATGTGG - Intronic
1191155271 X:57266659-57266681 CTGTCTAGTGATGAGCAATGTGG - Intergenic
1196245278 X:113392168-113392190 CTGCCCAGTGATGAGTAGTGGGG + Intergenic
1196438524 X:115695983-115696005 ATAGCCAGTGATGAGAGATGAGG - Intergenic
1196669206 X:118347280-118347302 CAAACAAGTGCTGAGTAATCTGG + Intronic
1200303012 X:154997464-154997486 CTAGAAAGTGATGAGGCAGGAGG + Intronic