ID: 1035135387

View in Genome Browser
Species Human (GRCh38)
Location 7:156698261-156698283
Sequence CAGGCTGGTATTGGTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035135385_1035135387 -10 Left 1035135385 7:156698248-156698270 CCAGCTGCTTTCACAGGCTGGTA 0: 9
1: 148
2: 307
3: 443
4: 602
Right 1035135387 7:156698261-156698283 CAGGCTGGTATTGGTTTTCCAGG No data
1035135375_1035135387 25 Left 1035135375 7:156698213-156698235 CCACCCCTGTGGCTTTGCAGGGT 0: 501
1: 832
2: 858
3: 624
4: 629
Right 1035135387 7:156698261-156698283 CAGGCTGGTATTGGTTTTCCAGG No data
1035135376_1035135387 22 Left 1035135376 7:156698216-156698238 CCCCTGTGGCTTTGCAGGGTACA 0: 907
1: 1362
2: 1353
3: 919
4: 764
Right 1035135387 7:156698261-156698283 CAGGCTGGTATTGGTTTTCCAGG No data
1035135384_1035135387 -9 Left 1035135384 7:156698247-156698269 CCCAGCTGCTTTCACAGGCTGGT 0: 49
1: 298
2: 627
3: 991
4: 1205
Right 1035135387 7:156698261-156698283 CAGGCTGGTATTGGTTTTCCAGG No data
1035135381_1035135387 -5 Left 1035135381 7:156698243-156698265 CCCTCCCAGCTGCTTTCACAGGC 0: 109
1: 238
2: 613
3: 796
4: 1353
Right 1035135387 7:156698261-156698283 CAGGCTGGTATTGGTTTTCCAGG No data
1035135382_1035135387 -6 Left 1035135382 7:156698244-156698266 CCTCCCAGCTGCTTTCACAGGCT 0: 109
1: 265
2: 633
3: 852
4: 1400
Right 1035135387 7:156698261-156698283 CAGGCTGGTATTGGTTTTCCAGG No data
1035135379_1035135387 -2 Left 1035135379 7:156698240-156698262 CCTCCCTCCCAGCTGCTTTCACA 0: 97
1: 212
2: 531
3: 799
4: 1343
Right 1035135387 7:156698261-156698283 CAGGCTGGTATTGGTTTTCCAGG No data
1035135377_1035135387 21 Left 1035135377 7:156698217-156698239 CCCTGTGGCTTTGCAGGGTACAG 0: 877
1: 1466
2: 1338
3: 996
4: 796
Right 1035135387 7:156698261-156698283 CAGGCTGGTATTGGTTTTCCAGG No data
1035135378_1035135387 20 Left 1035135378 7:156698218-156698240 CCTGTGGCTTTGCAGGGTACAGC 0: 835
1: 1480
2: 1472
3: 1176
4: 922
Right 1035135387 7:156698261-156698283 CAGGCTGGTATTGGTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035135387 Original CRISPR CAGGCTGGTATTGGTTTTCC AGG Intronic
No off target data available for this crispr