ID: 1035138353

View in Genome Browser
Species Human (GRCh38)
Location 7:156730502-156730524
Sequence ACGTATCAGTCTAATCCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 48}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035138353 Original CRISPR ACGTATCAGTCTAATCCATT AGG (reversed) Intronic
908603153 1:65763271-65763293 CCATTTCTGTCTAATCCATTTGG + Intergenic
912523013 1:110259332-110259354 AAGGATCAGTCTATTCCATATGG + Intronic
919964009 1:202502942-202502964 ACTTATCAGTCGATGCCATTTGG - Intronic
1066737622 10:38493479-38493501 ACATTTCATTCTATTCCATTCGG - Intergenic
1072720794 10:97779890-97779912 ACGTATCACTCCACTCCACTCGG - Intergenic
1075164954 10:120059492-120059514 AAGTATCTGTCTCATCCTTTAGG + Intergenic
1078282491 11:9916984-9917006 ATGTCTAAGTATAATCCATTTGG - Intronic
1079708457 11:23651541-23651563 ACCTATCAGTCTTATCACTTAGG + Intergenic
1080931527 11:36816639-36816661 ATGTATCAGCCTCCTCCATTAGG + Intergenic
1087276780 11:96168868-96168890 ACGTTTCTGTGTAATCCACTTGG + Intronic
1089530100 11:119122039-119122061 ACGTATCAGTCTTATCTTTTTGG + Intronic
1095615832 12:44187206-44187228 CCATATCAGTCTAATCCAGATGG + Intronic
1098373683 12:69788698-69788720 ACGTATCTGTTAGATCCATTTGG - Intronic
1098413920 12:70211912-70211934 ACGTATCTGTTAGATCCATTTGG + Intergenic
1104252782 12:127111381-127111403 CCATTTCAGTCTAATCCATTTGG - Intergenic
1109266840 13:60210924-60210946 ACGTATCACCCATATCCATTAGG - Intergenic
1127573235 15:60264608-60264630 ACATTTCAGTATAAGCCATTCGG + Intergenic
1131426485 15:92349307-92349329 ATGTATATGTCTAATCCAGTAGG - Intergenic
1133431267 16:5739108-5739130 AAGTATGTGTCTTATCCATTGGG + Intergenic
1144243874 17:13343298-13343320 AAATGTCTGTCTAATCCATTAGG + Intergenic
1145257266 17:21333028-21333050 ACGTGTCAGTCTATTCTTTTCGG + Intergenic
1151926407 17:77200816-77200838 ACGTATCAGTCTGTTCAACTTGG - Intronic
939177836 2:138770139-138770161 GGGAATCATTCTAATCCATTTGG - Intronic
940575201 2:155494856-155494878 ACTTATCCGCCTAAGCCATTTGG + Intergenic
944330422 2:198458998-198459020 AGATATCATTCTAATCCTTTTGG - Intronic
948538942 2:238671816-238671838 ATGTATCAGTCTTTTCCTTTAGG + Intergenic
1176747181 21:10662193-10662215 ACATTACATTCTAATCCATTCGG + Intergenic
1177638217 21:23813275-23813297 ACATATAATTCCAATCCATTAGG + Intergenic
1177739277 21:25134575-25134597 ACCTATAATTCCAATCCATTAGG + Intergenic
949300068 3:2573459-2573481 AAGTGTCAGTCGAATCCCTTAGG - Intronic
976415625 4:84770973-84770995 GAGTATCAGTCTAATCAACTTGG + Intronic
977382205 4:96289890-96289912 TTGTATTAGTCTAAACCATTTGG - Intergenic
979988362 4:127343517-127343539 ACGTATCATTCTTATACCTTTGG - Intergenic
984152381 4:176150256-176150278 ATGTACCATTCTAATTCATTGGG + Intronic
984755709 4:183324081-183324103 ACGGAGCAGCCTATTCCATTAGG - Intergenic
985482210 5:120636-120658 GCTTATCAGTGTAATGCATTTGG - Intergenic
992893809 5:81229868-81229890 AGTTTACAGTCTAATCCATTTGG - Exonic
994893306 5:105667728-105667750 ACATATCAATTAAATCCATTAGG + Intergenic
1001263805 5:170257139-170257161 ACCCATCAGTCTAAACCTTTGGG + Intronic
1004840075 6:19573859-19573881 ACCTATGAGTTTAGTCCATTTGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1022345750 7:29512722-29512744 ACGTTTTATTCTAATCCATCAGG + Exonic
1023671317 7:42579899-42579921 AAGTATCAGTTAAATCCATTTGG + Intergenic
1035138353 7:156730502-156730524 ACGTATCAGTCTAATCCATTAGG - Intronic
1037056969 8:14454879-14454901 ATGTATATGCCTAATCCATTTGG - Intronic
1046188622 8:110758931-110758953 AACTATCAATCAAATCCATTGGG + Intergenic
1046313425 8:112468782-112468804 ACATATAAGACTAATACATTTGG - Intronic
1058218530 9:102265591-102265613 ACACAACAGTCTAATCCATTTGG - Intergenic
1059638738 9:116195573-116195595 AAGTAACAGTCTAGTGCATTGGG + Intronic
1194469821 X:94279640-94279662 ATGTATCATTCTTATGCATTTGG + Intergenic
1199031197 X:143002603-143002625 ACGTATCAGTCTCTTCAACTAGG - Intergenic
1201351240 Y:13043763-13043785 AAATGTCTGTCTAATCCATTTGG - Intergenic
1201383431 Y:13412346-13412368 ACTTATCAGACTAACCTATTAGG - Intronic
1202299655 Y:23398787-23398809 ACTTATCAGTCTATGCCATTTGG - Intergenic
1202571154 Y:26271811-26271833 ACTTATCAGTCTATGCCATTTGG + Intergenic