ID: 1035138798

View in Genome Browser
Species Human (GRCh38)
Location 7:156736474-156736496
Sequence CAAAGTGTCAAACACATACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035138798 Original CRISPR CAAAGTGTCAAACACATACG TGG Intronic
904953529 1:34263607-34263629 CACAATGTCAAACACATTGGTGG - Intergenic
908713200 1:67041118-67041140 CAAAGTGACTAACACATAATAGG + Intronic
908971050 1:69832197-69832219 AACAGTGTAAAACACATACCAGG + Intronic
910694965 1:90002277-90002299 CACAGTGCCTAACACATACATGG + Intronic
914716516 1:150258858-150258880 CACAGTGTCCAGCACATACTAGG + Intronic
914914116 1:151807737-151807759 CAAAGTGCCAAGTACATAAGGGG - Intronic
916199507 1:162256944-162256966 CAAAGTGCCAACCACTTACAGGG + Intronic
916423432 1:164658550-164658572 TATAGTGTCAAACACACTCGGGG - Intronic
917245245 1:172993894-172993916 CAATGAGTCAAAAACATACTTGG + Intergenic
917636183 1:176939153-176939175 CATAGTATCATACACATACATGG + Intronic
918519648 1:185401484-185401506 AAAAATGTAAAACACATACATGG - Intergenic
918860763 1:189824030-189824052 CAAAGTGTCATACACCTGAGAGG + Intergenic
921372932 1:214444045-214444067 CAAAGTGTCTAACACAGAATAGG + Intronic
1063371023 10:5523325-5523347 CAAAGTGTCACCCACACACGTGG + Intergenic
1063907185 10:10793038-10793060 GAAAATGTCAGACACATACGTGG + Intergenic
1064879139 10:20030801-20030823 TAAGGGGTCAAACACATACTCGG - Intronic
1068432248 10:56948752-56948774 CACAGTCTCAAAGACATAGGAGG + Intergenic
1079610706 11:22429509-22429531 CACAGTGTCTGACACATAGGAGG - Intergenic
1085969297 11:81567669-81567691 TAAAGTGCCAAACACATACCAGG + Intergenic
1088916413 11:114231247-114231269 CACAGTGTCCAACACATAGTAGG - Intronic
1090252132 11:125258995-125259017 CATAGTGTCGGACACATACTAGG + Intronic
1092120299 12:6038935-6038957 CAAAGTGGCAAAGACATTCAGGG + Intronic
1093550729 12:20407277-20407299 CAAAGTGCCAAACATATAGCAGG + Intronic
1095338704 12:41063044-41063066 CAAAGTGGCAAACTCACACCAGG + Intronic
1095353408 12:41242127-41242149 CACAGAGTTAAACACATACCTGG - Intronic
1100223535 12:92532966-92532988 TAAAGGGTAAAACACATATGAGG + Intergenic
1101309113 12:103560202-103560224 CAAAGTGACAAACAAATTAGTGG + Intergenic
1105818245 13:24056602-24056624 CACAGTGTCTAGCACATAGGAGG + Intronic
1110681996 13:78324983-78325005 CTAAGTGTGAAACACATAACTGG - Intergenic
1110829056 13:80009451-80009473 CAAATTTAAAAACACATACGTGG - Intergenic
1111711385 13:91818943-91818965 CACAGTGTAAAACATATATGTGG + Intronic
1112469926 13:99678912-99678934 CTAAGTGTCCAGCACATACTAGG - Intronic
1115649248 14:35391149-35391171 CAAAGTGCCAGACACATAGTAGG - Intergenic
1119135261 14:72212645-72212667 AATAGTGACAAACACATACTGGG - Intronic
1119647083 14:76355757-76355779 CACAGGGTCCAACACATAGGAGG + Intronic
1119746313 14:77046726-77046748 CACAATGTCCAACACATAAGAGG - Intergenic
1120791551 14:88588392-88588414 CAAAGTATCAAACAAGTACAAGG - Intronic
1124804647 15:32869335-32869357 AAAAGTGTCACAGACATAAGGGG + Intronic
1125369067 15:38950996-38951018 CAAACTGCCATACACATACAAGG + Intergenic
1127693131 15:61417150-61417172 ATCAGTGTAAAACACATACGTGG - Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1129644137 15:77414735-77414757 TAAAGTGTCTAGCACATAGGAGG + Intronic
1130545014 15:84850323-84850345 CACAGTACCAAACACATAAGGGG - Intronic
1131617066 15:94027496-94027518 CAAATTGTAAATTACATACGTGG - Intergenic
1131652866 15:94421390-94421412 CAAATTATCAAAGACATAAGTGG + Intronic
1134813759 16:17189003-17189025 CACAGTGTCCAACACATAGTAGG + Intronic
1134857129 16:17529473-17529495 CAGAGTGTCAAACTCATAATGGG - Intergenic
1135197480 16:20406294-20406316 AAAAGAGTCAAACACATCCCAGG - Intergenic
1138641116 16:58388120-58388142 CAAAGTGCCTAATACATACTAGG + Intronic
1148177589 17:45581152-45581174 CAAAATGTCACTCACATCCGGGG + Intergenic
1148526573 17:48343624-48343646 CAAAGTGCAAAACTCATAAGAGG - Intronic
1149185846 17:53996788-53996810 CAAAGTGTCCAGCACATAACAGG + Intergenic
1151361893 17:73593898-73593920 CAAATTGTCCAACACAGACTCGG - Intronic
1152940254 17:83167229-83167251 CAGAGTGCCAAATATATACGAGG - Intergenic
1156195385 18:34768750-34768772 CACAATGTCAAACACATAGCAGG - Intronic
1158523347 18:58190146-58190168 CAAAGTATCAAATACATAGAAGG + Intronic
1166306047 19:41937600-41937622 CAAACTCTGACACACATACGTGG + Intergenic
925168213 2:1732405-1732427 CACAGGGTCACACACACACGGGG + Intronic
927134836 2:20089329-20089351 GAAAGTGTCACACACAGACTGGG + Intergenic
927304694 2:21557113-21557135 CAAAGTGTAACACACTTACAGGG + Intergenic
928395293 2:30939186-30939208 GAAAGAGACAAACACATACAAGG + Intronic
929570028 2:43016929-43016951 CAAAGGGACAAACACAGACAGGG + Intergenic
931191871 2:60009349-60009371 CAAAGTGGCAAAGACATTCCTGG + Intergenic
931503870 2:62902363-62902385 CAAAATGTCAGAAACATAGGAGG + Intronic
934930917 2:98422035-98422057 CAAAGTGTGACACACACATGGGG + Intergenic
935622610 2:105143042-105143064 CAAAGTGCTAAACACAGACCTGG + Intergenic
936701235 2:115013547-115013569 CTAAGAGTCAAACACATCGGTGG + Intronic
941016583 2:160364330-160364352 TAAATTGTGAAACACGTACGAGG - Intronic
941413207 2:165186389-165186411 CAAAGAGGCAAATACATACAGGG - Intronic
941641224 2:167990954-167990976 CAAAGTGGCAAAGACACACTAGG + Intronic
942600056 2:177631843-177631865 CAATGTGTTTAACACATAGGAGG - Intronic
944267429 2:197744139-197744161 CTAAGTGTAAAATACATACTGGG - Intronic
1169079954 20:2791842-2791864 GGAAGTGTCAAACACATTCAGGG + Intergenic
1171488191 20:25498610-25498632 CAAAGTGTCAGACACAGGCAGGG + Intronic
1173940035 20:46903020-46903042 CAATGTGTCAAGCACATTGGAGG - Intronic
1177778426 21:25595616-25595638 TTAAGTGTAAAACACATACCAGG + Intronic
1178280760 21:31280797-31280819 CAAAGTGTCAAAGACACTTGGGG + Intronic
1178613469 21:34108706-34108728 CAAAGTTGCAAACAAATACGAGG - Intronic
1182865835 22:33603636-33603658 CAAAGACTCAAACACAGAAGAGG + Intronic
1183719809 22:39556258-39556280 CACAGTGTCTAACACATAATAGG - Intergenic
1184826067 22:46952136-46952158 CAAAGTGTCAACCACCCACAGGG - Intronic
952639052 3:35569324-35569346 CATGGTGTTAAACACATACCTGG - Intergenic
955369138 3:58335944-58335966 CAAAGCGTTAAACACATTAGAGG + Intronic
957519285 3:81297789-81297811 CAAAGATTCACACACATAAGAGG - Intergenic
962942195 3:140135328-140135350 CAAAGTGTCAACCACAACAGAGG - Intronic
965975789 3:174620175-174620197 CAAAGTGTCAGGCACATAGTAGG - Intronic
966233664 3:177676372-177676394 CAAAGTGTTAAATACACAGGGGG + Intergenic
969786210 4:9459259-9459281 CAAGGTGTCAAAGACACACAGGG + Intergenic
970878745 4:20903180-20903202 CAAACTATCAAAGGCATACGAGG + Intronic
971079822 4:23196568-23196590 CAAAGTGTAGAAGACATATGTGG - Intergenic
975363211 4:73496323-73496345 CAAAATGTCAAACACACAGTAGG - Intronic
980105042 4:128579618-128579640 CAAAGCTTCAAAGACATAGGAGG + Intergenic
981950773 4:150404068-150404090 TAAAGTGTCAAATACTTACAAGG + Intronic
982406537 4:155026691-155026713 CAAATTGTCAAACATTTATGGGG + Intergenic
983748484 4:171232284-171232306 CAATGTGTAAAATACAAACGAGG + Intergenic
987505962 5:18772595-18772617 CAAAGTGAAAAATACATACCTGG + Intergenic
987793507 5:22598692-22598714 CAAAGTGTAAAACAAACAAGAGG - Intronic
989422774 5:41259299-41259321 CAAAGTGTGAACTAAATACGTGG + Intronic
989771892 5:45155178-45155200 CAAAGTGTCATACCCATGCTAGG - Intergenic
992284640 5:75221565-75221587 CAAAGGGTGAAAAACATAAGAGG + Intronic
996036158 5:118761695-118761717 CAAAGTGACAAAAACATTTGCGG + Intergenic
999021875 5:148174728-148174750 CAGAGTTTCAAACACATAAGGGG - Intronic
1000723650 5:164740273-164740295 CAAAGCTTCAAACACACACGTGG + Intergenic
1001642400 5:173253656-173253678 CAAAGTTTCAGACACAAAGGAGG + Intergenic
1003832305 6:10025409-10025431 CTAAGTGTAAAATACATACCTGG - Intronic
1005112259 6:22295165-22295187 CGAAGTGTCAAACACATGCATGG - Intronic
1006587284 6:35124122-35124144 CAAAGTAGCAAACACAAATGTGG - Intronic
1006700504 6:35969115-35969137 CAAAGTGCTAAACACATACTAGG + Intronic
1007653521 6:43438071-43438093 AAAGGTGTCCAACACATAAGAGG - Intronic
1011781848 6:90798151-90798173 CTCAGTGTCTAACACATAAGAGG + Intergenic
1012773739 6:103477992-103478014 CAAAGTTTAAAGCACATACTGGG + Intergenic
1015025360 6:128525776-128525798 TAATTTGTCAAACACATACTGGG - Intergenic
1017642768 6:156510284-156510306 CAAAATGTCAAGCACATAGTAGG - Intergenic
1019576904 7:1741981-1742003 CAACCTGGCACACACATACGAGG + Intronic
1021146986 7:17101245-17101267 GAAAGTGACAATCACATACAAGG + Intergenic
1021463290 7:20913005-20913027 CAAAGTGTCTTACACATAATAGG + Intergenic
1028956076 7:96692363-96692385 CAAAATGTCAAAAACATATCAGG + Intronic
1034201654 7:149286393-149286415 CAAAGCGTCCCACACATACCAGG - Intronic
1035138798 7:156736474-156736496 CAAAGTGTCAAACACATACGTGG + Intronic
1037209144 8:16363841-16363863 CACAGTGTGAAAGACATAGGAGG + Intronic
1037693348 8:21202558-21202580 CAGAGTGTCTGACACATACTAGG + Intergenic
1038993765 8:32898838-32898860 CAAAGTGTCAAGCACATAGTAGG + Intergenic
1039241155 8:35558225-35558247 CAGAGTGACAGACACATACAGGG + Intronic
1040564825 8:48556071-48556093 CAAAGTGTAAAACATTTACAAGG + Intergenic
1041434518 8:57823236-57823258 CAAAGTCTCATACACATAACCGG + Intergenic
1042182876 8:66109487-66109509 CAAAGTAGCAATCACATATGAGG - Intergenic
1044920885 8:97168208-97168230 CACAGTGTCAAGCACATAGTAGG - Intergenic
1045345647 8:101291217-101291239 TAAAGTGTCTAACACATACAAGG - Intergenic
1045628067 8:104080224-104080246 TAAAGTGTTAAACAAATATGTGG + Intronic
1050627562 9:7521426-7521448 CAAAGTGTCAAATACATGTATGG + Intergenic
1055756976 9:79568573-79568595 CAAAATGTGAAACACATCCAAGG + Intergenic
1055769017 9:79696282-79696304 AAAAGTGTAAAATACATAGGTGG + Intronic
1060041780 9:120306628-120306650 CAATGTGTCACCCACATAAGGGG + Intergenic
1062584458 9:137242737-137242759 CAAAGTGTCAGACACAGTGGTGG + Exonic
1186765716 X:12768861-12768883 CCAAGTGGCAAATACATACTTGG - Intergenic
1187331591 X:18345280-18345302 CACAGTGTCTATCACATACTAGG + Intronic
1188186449 X:27121627-27121649 AAAAGTGTCAACCACATAAATGG + Intergenic
1189499926 X:41546831-41546853 AAAACTTTCAAACACATACAAGG + Intronic
1190583903 X:51918077-51918099 CAAACTGACAAACACATCCCAGG + Intergenic
1196371000 X:114979793-114979815 CACAGTTTCAAGCACATACTAGG - Intergenic
1199426933 X:147713009-147713031 CAAAGTTTCAAAAACACAAGGGG - Intergenic