ID: 1035140526

View in Genome Browser
Species Human (GRCh38)
Location 7:156755299-156755321
Sequence TACTTTTCCTACTGTGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035140521_1035140526 13 Left 1035140521 7:156755263-156755285 CCAAAGGATTTATAAAGATTCTA 0: 1
1: 0
2: 2
3: 28
4: 458
Right 1035140526 7:156755299-156755321 TACTTTTCCTACTGTGGAAGGGG 0: 1
1: 0
2: 2
3: 15
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035140526 Original CRISPR TACTTTTCCTACTGTGGAAG GGG Intronic
903562369 1:24237415-24237437 CACCTTTCCTACAGGGGAAGGGG - Intergenic
904558957 1:31384106-31384128 TGCTTCTCCTTCTGGGGAAGGGG - Intergenic
904862277 1:33547630-33547652 TCTGTTTCCCACTGTGGAAGAGG + Intronic
906235165 1:44202356-44202378 TGCTTTTGCTTCTGTGGCAGTGG - Intergenic
907890197 1:58629828-58629850 TAATTTTGTTACTGTGGGAGTGG + Intergenic
907986009 1:59531295-59531317 AAATTTTCCTACTATTGAAGTGG + Intronic
908024170 1:59931203-59931225 AAATTTTCCTACTGTGGTACTGG - Intergenic
908131446 1:61079788-61079810 TACTTTTGCAACTTGGGAAGAGG + Intronic
910793328 1:91073615-91073637 GACTTTACCTACAGTGGAATAGG + Intergenic
912269017 1:108190735-108190757 AAATTTTCCTACTGGGGAGGTGG + Intronic
912653737 1:111466277-111466299 TAAATTTCCTACTTTGGCAGTGG + Intergenic
913165815 1:116183445-116183467 CACTTTTCTTACTGTGGATGTGG + Intergenic
913568727 1:120099419-120099441 TTCTTTTCCCACTTTGAAAGAGG - Intergenic
914289542 1:146260440-146260462 TTCTTTTCCCACTTTGAAAGAGG - Intergenic
914550578 1:148711193-148711215 TTCTTTTCCCACTTTGAAAGAGG - Intergenic
915699787 1:157781020-157781042 TACTATTCCTACAGTGGAGGTGG + Intergenic
916388761 1:164306991-164307013 TATTTCTCCTTCTGTGGAATGGG + Intergenic
917488354 1:175475750-175475772 TCCTTTTCCTACCCTGGATGAGG + Intronic
918773318 1:188592931-188592953 TAATTTTTTTATTGTGGAAGGGG + Intergenic
921855659 1:219980767-219980789 TGCTTTTGCTACCATGGAAGAGG - Exonic
923290775 1:232543491-232543513 TACTGTTCATTCAGTGGAAGTGG - Intronic
923393132 1:233533440-233533462 TGCTTTTCCTACTGGGGAAGGGG + Intergenic
924386668 1:243505259-243505281 CAATTTTCCTACTCTGCAAGTGG - Exonic
1063048148 10:2415500-2415522 TACGTTTTCTCCTGTGGAATTGG - Intergenic
1063251494 10:4279981-4280003 TTGTTTTTCTACTGGGGAAGGGG - Intergenic
1064169422 10:13017148-13017170 CACTTTGCCTACTGTGAAAAAGG - Intronic
1066237505 10:33500778-33500800 TTTTCGTCCTACTGTGGAAGTGG + Intergenic
1068941462 10:62684961-62684983 TACTCTTATTACTGTTGAAGAGG - Intergenic
1070948790 10:80414244-80414266 TACTTCACCTTCTGTGGGAGAGG + Intronic
1071332321 10:84572188-84572210 AACTTTTCCCAGTGTGGAAAAGG - Intergenic
1071951731 10:90710970-90710992 TATTTTTCCTTCTGGGGAAAAGG - Intergenic
1072226958 10:93379370-93379392 AAATTTTCTTACTTTGGAAGAGG - Intronic
1073025496 10:100484379-100484401 TGCTTTTCCTACTCTGGGAGAGG - Intergenic
1073121731 10:101125997-101126019 AACTTTCCCTGCTGTGGGAGAGG - Intronic
1073804461 10:107082275-107082297 TACTTTTCCTACTCTTTAAGAGG + Intronic
1074480961 10:113820320-113820342 AAATTCTCTTACTGTGGAAGAGG + Intergenic
1076091340 10:127688967-127688989 TACTATTCATTCAGTGGAAGTGG + Intergenic
1076415906 10:130288346-130288368 ATCTTTTCCTACTATGGAACTGG - Intergenic
1076561006 10:131363524-131363546 GACTTTTCCTTCTGCAGAAGTGG + Intergenic
1078261138 11:9709986-9710008 TACTATTCATTCAGTGGAAGTGG + Intronic
1078874999 11:15384593-15384615 TATTTCTCCTGCTGAGGAAGTGG + Intergenic
1080038971 11:27738904-27738926 TTATTTTGCTACTGTGGAAATGG + Intergenic
1085239953 11:75044905-75044927 TACTTTTACAGCTGTGGGAGTGG - Intergenic
1086342302 11:85858541-85858563 TACTGTTCCAAGTGTGGCAGGGG + Intronic
1087126377 11:94630299-94630321 TACTGTTCATAAAGTGGAAGTGG + Intergenic
1088452938 11:110001596-110001618 TGGTTTTCCCACTCTGGAAGTGG + Intergenic
1089657095 11:119956648-119956670 TACTATTCCTTAAGTGGAAGTGG + Intergenic
1089661156 11:119986398-119986420 TACTATTCATTATGTGGAAGTGG + Intergenic
1089844757 11:121450042-121450064 TACTAGTCCTTCTGTGCAAGGGG + Intergenic
1092266657 12:6986300-6986322 TACTCTTCATTCAGTGGAAGTGG - Intronic
1093441048 12:19196635-19196657 TACTATTCATACTGTGTATGAGG - Intronic
1093798607 12:23344227-23344249 TACTTTTCCTACTGGAGACAAGG - Intergenic
1094063477 12:26339943-26339965 CACTTCTCCTTCTATGGAAGGGG - Intronic
1097779349 12:63685796-63685818 TACTATTCCTTAAGTGGAAGTGG - Intergenic
1098881156 12:75918942-75918964 AACTTTTCATTCAGTGGAAGAGG - Intergenic
1100503025 12:95192729-95192751 TACCTTTCCTACATTGGAAGGGG + Intronic
1100833147 12:98538049-98538071 TACCTTTTCTATTGTGGGAGAGG + Intronic
1101056138 12:100916165-100916187 TCCTTTTTCCACTGAGGAAGAGG + Intronic
1101070475 12:101069869-101069891 TACTTTTCCTAATGTAGATCTGG - Intronic
1101134626 12:101729606-101729628 TATTTTTCATAATGTGAAAGAGG - Intronic
1101503108 12:105322148-105322170 TACTTTGTCCACAGTGGAAGAGG - Intronic
1101687128 12:107036090-107036112 TTCTTCCCCTACTGTGGAGGAGG - Intronic
1104077854 12:125406422-125406444 TTCTTTTTCTACTGTGAAATGGG + Intronic
1106872909 13:34041128-34041150 TTATTTTTCTTCTGTGGAAGAGG + Intergenic
1107026889 13:35810764-35810786 TATTTTTCCTATTCTCGAAGCGG + Intronic
1107232002 13:38121043-38121065 TACTTTTCATTAAGTGGAAGTGG - Intergenic
1108523364 13:51264180-51264202 TATTTGTCCAACTTTGGAAGAGG + Intronic
1109400052 13:61814933-61814955 TGTTTTTCCTACTGTATAAGCGG - Intergenic
1110525001 13:76525725-76525747 TACTGTTCATCCAGTGGAAGTGG - Intergenic
1111083869 13:83347700-83347722 TCCTTTGCCTGCTGTGGAAATGG + Intergenic
1112160455 13:96861496-96861518 TACTATTCATTATGTGGAAGTGG - Intergenic
1113136230 13:107092825-107092847 AAATTTACCTTCTGTGGAAGTGG - Intergenic
1114312724 14:21482232-21482254 TACTTTTCCTACTGAAGGATGGG - Intronic
1117225648 14:53655824-53655846 TTTTCTTCCTACTGTGGATGTGG + Intergenic
1118151953 14:63199191-63199213 TCTTTTTTCTACTCTGGAAGTGG - Intergenic
1120064077 14:80019323-80019345 TACTATTCATTATGTGGAAGTGG + Intergenic
1120989418 14:90362127-90362149 TATTTTTCCTTCTGAGGCAGTGG - Intergenic
1125206820 15:37162588-37162610 TACTTTTCATTAAGTGGAAGTGG - Intergenic
1131053213 15:89361557-89361579 GACCTCCCCTACTGTGGAAGTGG + Intergenic
1137041455 16:35616507-35616529 TACTTTTACGTCTGTGGGAGTGG + Intergenic
1141640691 16:85339297-85339319 TCCTTTTCCTCCTGTGGAAGGGG + Intergenic
1146234389 17:31144859-31144881 TTCTTTTCCTAATGAGGGAGTGG + Intronic
1149028480 17:52057378-52057400 TACTGTTCATTATGTGGAAGTGG - Intronic
1150620575 17:66804726-66804748 TACTTTTCATTCTTTGTAAGAGG + Exonic
1153214336 18:2805343-2805365 TAATTTTCATACTGTGAAACTGG + Intergenic
1153969385 18:10211774-10211796 CAGTTTTCCCACTGCGGAAGAGG + Intergenic
1154473870 18:14732116-14732138 TACTATTCATAAAGTGGAAGTGG + Intronic
1154956314 18:21259312-21259334 TAATTTTTCTACTGTGCAAGAGG + Intronic
1155495840 18:26440773-26440795 TACTGTTCCAACGGCGGAAGTGG - Intergenic
1156264033 18:35469640-35469662 TATTTTTGCTGCTGTGAAAGTGG - Intronic
1156279326 18:35619483-35619505 TACTTTTCCTCCTGTATAACTGG - Intronic
1157929944 18:51810763-51810785 TACTTTTCATTAAGTGGAAGTGG + Intergenic
1159513692 18:69430519-69430541 TACTAATCCTAATGAGGAAGCGG - Intronic
1160583693 18:79901358-79901380 TACATTTCCTCCTGAGCAAGCGG + Intergenic
1161714462 19:5867477-5867499 TACTGATCCTGCTGTGGACGTGG - Exonic
1163613661 19:18313686-18313708 TTCTTTTCCTTTTGTAGAAGTGG + Intronic
1163883992 19:19950033-19950055 GACTTTTCCTCATGTGGAAATGG - Intergenic
1167587367 19:50382669-50382691 TCCTCTTCCTAGGGTGGAAGGGG + Exonic
928179574 2:29058635-29058657 TTTTTTTCCTCCTTTGGAAGGGG - Exonic
928294266 2:30069314-30069336 TACATCTACTACTGTGAAAGAGG - Intergenic
929207244 2:39310971-39310993 TTCTTTTCTTACTGTGGAAATGG - Intronic
929627888 2:43428835-43428857 CACATTTCATACTGTGGAACAGG - Intronic
931581208 2:63776994-63777016 TAGTTATCCTACTGTGCAATAGG - Intronic
932117434 2:69065978-69066000 TCATTTTCCTTCTGTGGAATTGG - Intronic
932544462 2:72693149-72693171 TTCTTTTCCTTCTTTGGATGTGG - Intronic
936006929 2:108897456-108897478 TCATTTTCCTAGTGGGGAAGGGG - Intronic
936964121 2:118110365-118110387 TACTCTTCATTCAGTGGAAGTGG + Intronic
939713572 2:145555059-145555081 TACTTTTCATTAAGTGGAAGTGG - Intergenic
939853372 2:147326703-147326725 TACTATTCATTATGTGGAAGTGG - Intergenic
942485427 2:176434577-176434599 TACTTTTATTACTGTAGATGAGG + Intergenic
943541124 2:189215869-189215891 GAGCTTTCCTACTTTGGAAGAGG - Intergenic
944707490 2:202305861-202305883 TACTGTTCATTCAGTGGAAGTGG + Intergenic
945227863 2:207551274-207551296 TACTGTTTTTACTGTGGAAAGGG + Intronic
945510518 2:210696041-210696063 TATTTTGGCTATTGTGGAAGAGG + Intergenic
946914085 2:224498217-224498239 TATTTTTCGTACTGTGGTATAGG - Intronic
948306436 2:236951257-236951279 CTCTTCTTCTACTGTGGAAGTGG - Intergenic
948498973 2:238377165-238377187 TACTATTCCTACTCTAGCAGAGG - Intronic
948970021 2:241418261-241418283 TAATTTTCCCACTGAGTAAGAGG - Intronic
1169336882 20:4763960-4763982 AACTTGTCCCACTGTGGATGAGG - Intergenic
1170181281 20:13532971-13532993 TACTCTGCCTAGTGTGCAAGGGG - Intronic
1170615064 20:17941704-17941726 TACTTTTCCTAATGTAGATCTGG + Exonic
1172356058 20:34280851-34280873 TACTGTTCCAAATGTGGCAGCGG - Exonic
1172616415 20:36288637-36288659 TACTATTCATTCAGTGGAAGTGG + Intergenic
1176420058 21:6506933-6506955 TACTTTTCCTTATGAGGAAACGG - Intergenic
1177297516 21:19195969-19195991 TACATTTCTTACACTGGAAGAGG + Intergenic
1177360763 21:20066196-20066218 TTTTTTTCCTAGTGTGGAAATGG + Intergenic
1177451252 21:21269729-21269751 TTATTTTTCTAATGTGGAAGAGG + Intronic
1178070884 21:28965515-28965537 TACTTTTTCTACTGCAGAAATGG - Intronic
1178342020 21:31793805-31793827 TACCTTTCCCACTGTGGAGTAGG + Intergenic
1178663255 21:34524084-34524106 TACATTTTTTACTGAGGAAGTGG + Intronic
1178967835 21:37140627-37140649 TGCTTGGCCTACTGTGGAATTGG + Exonic
1179518574 21:41927037-41927059 TACTATTTCTACTCTGGAACTGG + Intronic
1179695550 21:43115253-43115275 TACTTTTCCTTATGAGGAAACGG - Intergenic
1181721001 22:24774407-24774429 TATTTTTCCATCTGTGGAAGTGG - Exonic
1183341534 22:37284425-37284447 AACTTTTCCCACTGGGGCAGAGG + Intronic
1185097174 22:48816630-48816652 TACTATTCATAAAGTGGAAGTGG - Intronic
949278643 3:2319576-2319598 TACTTTTCATTAGGTGGAAGTGG - Intronic
949286707 3:2415086-2415108 TATTTTTTATACTGTGGATGAGG + Intronic
949335301 3:2968244-2968266 TACTTATCTTACTTTTGAAGAGG - Intronic
950259488 3:11534031-11534053 TACTTTTCCAACTCTGACAGTGG - Intronic
950540110 3:13607358-13607380 TACTATTCATGCAGTGGAAGTGG + Intronic
952996842 3:38891744-38891766 TAGTTTAGTTACTGTGGAAGTGG - Intronic
953866283 3:46585942-46585964 TACTATTCATACAGTGGAAGTGG + Intronic
955474268 3:59319680-59319702 TACTTTTCTTACTCTGCAAGAGG - Intergenic
955505640 3:59630497-59630519 CAGTCTTCCAACTGTGGAAGTGG - Intergenic
955522682 3:59790374-59790396 TCCTTTTCCTACTGTCCAAATGG - Intronic
955846192 3:63165245-63165267 TACTATTCATAAAGTGGAAGTGG - Intergenic
956762139 3:72453006-72453028 GATATTTCCTACTATGGAAGAGG - Intergenic
957825062 3:85430778-85430800 TACTTTTGTTACAGTAGAAGGGG + Intronic
957999969 3:87738049-87738071 TGCTGTTCCTACAGTGGAAAAGG - Intergenic
958723672 3:97877210-97877232 TACTTGTCCTCCTCTTGAAGGGG - Exonic
958903426 3:99915322-99915344 TACTCTTGGTCCTGTGGAAGGGG + Intronic
958910094 3:99984675-99984697 TACTTTGGCTACTGTGGGGGAGG + Intronic
959063850 3:101638190-101638212 TGCTTTTGCTACTGTGCATGTGG + Intergenic
959958201 3:112264838-112264860 TACTTGTACAACTGTGGGAGTGG + Intronic
961467056 3:127088506-127088528 TAGTTTTCTCACTGTGAAAGGGG + Intergenic
962462073 3:135623504-135623526 TATATTTTCTACTGTGGAATTGG - Intergenic
962501357 3:135996960-135996982 TACCTTTCCTAGTGAGGCAGGGG - Intronic
965177695 3:165356897-165356919 AGCTATTCCTACTGTGGAAATGG - Intergenic
965977662 3:174644386-174644408 TACTTTTCATTAAGTGGAAGTGG + Intronic
966094632 3:176184967-176184989 AACTTTACCTACTTTGGAAAAGG + Intergenic
967753590 3:193142786-193142808 TACTCTTCCTCCTCTGGAACGGG - Intergenic
968922923 4:3532014-3532036 TACCTTTCCTGCTGCAGAAGGGG + Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
969761566 4:9188276-9188298 TAGTTTTCCTACAGTGAAATGGG - Intergenic
970053663 4:11947014-11947036 TACTTTTCATAATGTGGTAGAGG - Intergenic
971025242 4:22582905-22582927 TACTATTCCTTAAGTGGAAGTGG - Intergenic
971398503 4:26253129-26253151 TATTTTTCCAAATGTGGAAAAGG - Intronic
971412723 4:26392199-26392221 TACTTTTCATACACTGGCAGTGG + Intronic
972985448 4:44758041-44758063 TATTTTCTCTACTGTGGAACAGG - Intergenic
972991062 4:44823011-44823033 TACTTTTACAGCTGTGGGAGTGG + Intergenic
973990388 4:56400238-56400260 TACTATTCCTTATGTGAAAGTGG - Intronic
974900203 4:67987684-67987706 TACTATTCATTATGTGGAAGTGG + Intergenic
976634381 4:87273083-87273105 TTCTTTTCCTGCTGTGGATTCGG + Intergenic
976707729 4:88036497-88036519 TACTGTTCCTACTCTCAAAGGGG + Intronic
978008264 4:103646325-103646347 AAAAATTCCTACTGTGGAAGTGG - Intronic
978804649 4:112787577-112787599 GACTTTTCCTACTGGGGCAATGG - Intergenic
981155140 4:141426148-141426170 CACTTTTTCCACTGTGGAAGAGG - Intergenic
984074795 4:175163042-175163064 TACTATTCCTTCAGTGGAACTGG + Intergenic
984534924 4:180962701-180962723 TACTTTTCGTTAAGTGGAAGTGG + Intergenic
985038935 4:185869067-185869089 AACTCTGCCTAGTGTGGAAGAGG + Intronic
985309773 4:188585041-188585063 TACATTTCTTACTGGGAAAGTGG - Intergenic
986514367 5:8545505-8545527 TATTTTTCTTACTTTTGAAGAGG + Intergenic
986843558 5:11726176-11726198 TTCTTTTCATACTGTGAAAATGG + Intronic
987097103 5:14559823-14559845 TACATTTCCTCCTGTGCAAGTGG + Intergenic
987207785 5:15645074-15645096 CACATTTCCTTATGTGGAAGTGG + Intronic
989465490 5:41750264-41750286 TTCATTTCCTATTGTGGCAGAGG + Intronic
989650063 5:43678110-43678132 TACTATTCCTTAAGTGGAAGTGG + Intronic
990255628 5:53965878-53965900 TACTATTACTATTGTGGGAGTGG + Intronic
992150608 5:73898841-73898863 TACTTTTCATCCTGTGCAGGTGG + Intronic
992772337 5:80060230-80060252 CACTTTTGCAAATGTGGAAGGGG + Intronic
993729582 5:91406647-91406669 TACTTGTCCTACTCTGGACATGG + Intergenic
995248760 5:109965277-109965299 TACTTTTGAAACTGTGAAAGAGG + Intergenic
996457967 5:123707017-123707039 TTTTCTGCCTACTGTGGAAGGGG - Intergenic
996785970 5:127237086-127237108 TATTTTTCCATTTGTGGAAGTGG + Intergenic
999044270 5:148450480-148450502 TCCTTTTCCTACTTGGGAATAGG - Intergenic
999044829 5:148455851-148455873 TACTATTTGTAATGTGGAAGTGG + Intronic
1002660142 5:180786250-180786272 AACCTGTCCTACTGTGGCAGGGG - Intergenic
1003664235 6:8094851-8094873 TACTATTCATAAAGTGGAAGTGG - Intronic
1003701534 6:8471246-8471268 AACTTATGCCACTGTGGAAGAGG - Intergenic
1004289712 6:14355272-14355294 AACTATTCCTACTGTCAAAGAGG + Intergenic
1004681567 6:17900608-17900630 TACTTTTCCTTCTGTAGCAAGGG - Intronic
1009225998 6:61020538-61020560 TATTTTTCCTAATATTGAAGAGG - Intergenic
1009510982 6:64549450-64549472 TAATCTTCCTCCTGTGGAGGTGG - Intronic
1009983878 6:70759126-70759148 TTCTTTTCCTTCTCTGGAAAAGG + Intronic
1011229440 6:85143782-85143804 TACTTTTCCTTTTATGGAATGGG - Intergenic
1011363974 6:86560161-86560183 GATTCTTCCTACTGTGGCAGTGG - Intergenic
1011893423 6:92194716-92194738 GAGTTCTCCAACTGTGGAAGTGG - Intergenic
1013643681 6:112113678-112113700 ATTTTTTCCTACTGAGGAAGGGG + Intronic
1015486747 6:133780005-133780027 TACTTTTCCTCTGGTGGCAGTGG + Intergenic
1016700158 6:147045267-147045289 AACTTTGCCTAATGTGGATGAGG + Intergenic
1016725334 6:147358769-147358791 TACTATTCCTTAAGTGGAAGTGG + Intronic
1017435427 6:154411250-154411272 TGCTTTTCCTCCAGTGGAAAAGG - Intronic
1020159611 7:5759421-5759443 TACTGTTCCTTAAGTGGAAGTGG - Intronic
1020381379 7:7551270-7551292 CACTCTTCCTATTGGGGAAGTGG + Intergenic
1021516895 7:21499135-21499157 TACTATTCATTATGTGGAAGTGG + Intronic
1022938279 7:35203483-35203505 TACTATTCCTTAAGTGGAAGTGG - Intronic
1023430342 7:40084735-40084757 TACATTGCCTACTTTGTAAGAGG + Intronic
1023604305 7:41914706-41914728 TTCTTTTTATACTGGGGAAGAGG + Intergenic
1023858747 7:44203450-44203472 TACTTTTTCAACTTTGGAATCGG - Intronic
1026683728 7:72490477-72490499 TATTATTCCTACTGTAGAGGAGG - Intergenic
1027378919 7:77584211-77584233 TACTTTTCATTGTGTGGATGTGG + Intronic
1027641843 7:80744926-80744948 TACTTTTCCGACTATTGATGAGG + Exonic
1028030473 7:85905720-85905742 TACTTTTCATTAAGTGGAAGTGG - Intergenic
1028612504 7:92727457-92727479 TACTTTTCCTACTATTAAGGGGG + Intronic
1029088580 7:98030780-98030802 TACTTTTACTTCAATGGAAGAGG - Intergenic
1031571958 7:123370116-123370138 TACTTTTCCCACTTTGGATCTGG + Intergenic
1031862969 7:127003488-127003510 TTCTTCTCCTGTTGTGGAAGAGG - Intronic
1031874114 7:127119000-127119022 TACTGTTCCTTCTGGGGAGGGGG + Intronic
1033022680 7:137742368-137742390 TTCTTTTCCTATTGCAGAAGGGG - Intronic
1035140526 7:156755299-156755321 TACTTTTCCTACTGTGGAAGGGG + Intronic
1035324742 7:158057667-158057689 TCCTTTTCCTCATGAGGAAGTGG - Intronic
1036716511 8:11129490-11129512 TAATGGTCCTCCTGTGGAAGTGG - Intronic
1038115931 8:24555139-24555161 CACTTTTCCTACCTTGGAATAGG - Intergenic
1039918129 8:41874838-41874860 TATTTTTCCAACTTTGGAATGGG - Intronic
1040709009 8:50165016-50165038 TATTTTTCCTGCTGGGGAGGGGG - Intronic
1042082332 8:65069088-65069110 TAGTTTTCCTACTGAAGATGAGG + Intergenic
1043030230 8:75124997-75125019 TAGTTTTCCTTCAGTGGAGGTGG - Intergenic
1044091570 8:88008759-88008781 TACTATTCATTCAGTGGAAGTGG + Intergenic
1044216096 8:89612557-89612579 TCCTTTTCTTACTTTGGAAATGG - Intergenic
1047567533 8:126062207-126062229 CACTTTTCCTGCTGAGCAAGAGG + Intergenic
1048892940 8:138964124-138964146 TACTGTTCCCACTCTGGAAATGG + Intergenic
1049098801 8:140564564-140564586 TACTTTTCATTAAGTGGAAGTGG - Intronic
1051183632 9:14437497-14437519 TACTTTTAAAACTCTGGAAGGGG - Intergenic
1051812930 9:21070687-21070709 TTCTTTACCTACTGTGGATTTGG + Intergenic
1056134519 9:83618910-83618932 TACTTTTCCTACTCTGTTAAAGG + Intergenic
1056136455 9:83633806-83633828 TACTTCTCCTACTGTGTTAAAGG + Intronic
1056271297 9:84950378-84950400 TGCTTTGGCTTCTGTGGAAGTGG + Intronic
1056972816 9:91222018-91222040 TGCTTTTCCTGCTCTGCAAGGGG - Intronic
1058526014 9:105858412-105858434 TGCCTTTCCTTCTGAGGAAGTGG + Intergenic
1058849477 9:108997078-108997100 TATTTTTCCTACTTTAGAAAAGG - Intronic
1059014747 9:110503842-110503864 TATTTTTGCTGCTGTGGTAGAGG + Intronic
1062160733 9:135078229-135078251 CAATTTACCTACAGTGGAAGCGG - Intronic
1186304406 X:8240032-8240054 TACTATTCATTCAGTGGAAGTGG + Intergenic
1186944890 X:14554801-14554823 TCCTTCCCCCACTGTGGAAGAGG - Intronic
1187242414 X:17525653-17525675 TTTTTTTACTACAGTGGAAGGGG + Intronic
1187625534 X:21108695-21108717 TATTTATCCTACTGTAGTAGAGG - Intergenic
1188049719 X:25470012-25470034 TACTTTTCCCACTGAGAAATGGG + Intergenic
1188625734 X:32282938-32282960 GACTCTTCCTACAGTGGAAGGGG - Intronic
1189833915 X:45001816-45001838 TGCTGTTCCTACAGCGGAAGGGG - Intronic
1191067539 X:56366700-56366722 TCCTTTTCTTTCTGTGGATGTGG + Intergenic
1192896570 X:75448616-75448638 TACCTATTCTTCTGTGGAAGGGG + Intronic
1192924822 X:75745167-75745189 TGCTTGGCCTACTGTGGAATTGG - Intergenic
1194284826 X:91996696-91996718 TACTATTCCTTAAGTGGAAGTGG - Intronic
1195405431 X:104507956-104507978 ACCCTTACCTACTGTGGAAGGGG + Intergenic
1195455461 X:105064285-105064307 GACTTTTCTGCCTGTGGAAGGGG - Intronic
1195747162 X:108130295-108130317 TTCTTTTCCCAGTGTGGAAGTGG - Intronic
1197298503 X:124750166-124750188 TACTGTTCCAACAGAGGAAGGGG - Intronic
1198774862 X:140168947-140168969 GACTTTTCATACTGTGGATCTGG + Intergenic
1200602393 Y:5221266-5221288 TACTATTCCTTAAGTGGAAGTGG - Intronic
1200763315 Y:7059457-7059479 TCCTGTTCATACAGTGGAAGGGG - Intronic
1200769194 Y:7107969-7107991 TCCTGTTCATACAGTGGAAGGGG + Intergenic
1201766983 Y:17581083-17581105 TACTTTTTCTACTGTTGCAATGG - Intergenic
1201834570 Y:18324902-18324924 TACTTTTTCTACTGTTGCAATGG + Intergenic
1202091117 Y:21191606-21191628 TACTTTTCTTATTGTGGGTGTGG - Intergenic