ID: 1035140695

View in Genome Browser
Species Human (GRCh38)
Location 7:156757628-156757650
Sequence GTGTGAGTAGTTTGGATGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 401}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035140695_1035140698 11 Left 1035140695 7:156757628-156757650 CCTCACATCCAAACTACTCACAC 0: 1
1: 0
2: 1
3: 41
4: 401
Right 1035140698 7:156757662-156757684 AATAAATTGTGAGGAGCTAATGG 0: 1
1: 0
2: 1
3: 23
4: 351
1035140695_1035140697 2 Left 1035140695 7:156757628-156757650 CCTCACATCCAAACTACTCACAC 0: 1
1: 0
2: 1
3: 41
4: 401
Right 1035140697 7:156757653-156757675 AGCAAAAAAAATAAATTGTGAGG 0: 1
1: 0
2: 7
3: 152
4: 2069

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035140695 Original CRISPR GTGTGAGTAGTTTGGATGTG AGG (reversed) Intronic
901162931 1:7193734-7193756 ATGTGAGCACTTTGGATGTCTGG + Intronic
902206131 1:14869439-14869461 TTGTGAGTCATTAGGATGTGTGG + Intronic
903771507 1:25767240-25767262 GTGAGGGGAGTGTGGATGTGAGG - Intronic
904281608 1:29424408-29424430 GTGTGAGGTGTATGGAGGTGGGG - Intergenic
906125240 1:43423395-43423417 GTGTGAGTAGTATAGAGGTGTGG + Intronic
906125290 1:43423633-43423655 GTGTGAGTAGTATAGAGGTGTGG + Intronic
908251089 1:62266490-62266512 GTGTGAGTGGTGTGTGTGTGAGG - Intronic
908261318 1:62341381-62341403 GTGTGAGGAGTATGGAAGTGGGG - Intergenic
908461165 1:64349541-64349563 GTGTGTGTAGTGTGTGTGTGTGG + Intergenic
909587031 1:77301555-77301577 GAGTGAGTACATTGTATGTGTGG - Intronic
911244743 1:95504372-95504394 GTGTGGGAAGTTGGGATGGGTGG + Intergenic
912645900 1:111391536-111391558 GTGTGAGTATTTGGGGGGTGGGG - Intergenic
913445253 1:118944135-118944157 GTCTGGGAAGTTGGGATGTGAGG - Intronic
914840778 1:151246964-151246986 ATGTGAGTATCTGGGATGTGTGG + Exonic
915683179 1:157602692-157602714 GTGTCAGAAGCTTGGATGTGCGG + Intergenic
915960800 1:160264945-160264967 GTGTTAATAGATTGAATGTGGGG + Intergenic
918741314 1:188134131-188134153 GTGTGAGTAGTGTGTGTGTTGGG - Intergenic
920047702 1:203144272-203144294 GTGTGAGCAATTTGAAAGTGGGG + Intronic
922087954 1:222369092-222369114 GTGTGCATAGTTGGGATCTGGGG + Intergenic
923676606 1:236085911-236085933 GTGTGAGGTGTCTGGGTGTGTGG + Intergenic
923687192 1:236161449-236161471 GTGTGAGGAGATGTGATGTGTGG - Intronic
924075538 1:240330748-240330770 GTGTAAGTATTTTGCATGAGTGG + Exonic
924833046 1:247617720-247617742 GTGTGTGTAGTCTCGATGTATGG + Intergenic
1063355996 10:5398791-5398813 GTGTGAGTATATTTTATGTGTGG + Intronic
1064710728 10:18121750-18121772 GTGTGTGTTGTTTGTGTGTGAGG + Intergenic
1065918246 10:30369632-30369654 GAGTGAGAAGTTTCGATCTGGGG + Intronic
1067439157 10:46298792-46298814 GTGTGTGTACTTCGGGTGTGTGG + Intronic
1067464809 10:46489998-46490020 GTGTGTGTAGTGTGTGTGTGTGG + Intergenic
1067622382 10:47894603-47894625 GTGTGTGTAGTGTGTGTGTGTGG - Intergenic
1068917372 10:62446834-62446856 GAGTTACTAGTTTTGATGTGTGG + Intronic
1070548491 10:77472357-77472379 GTGTGTGTAGTATGTGTGTGTGG - Intronic
1071038509 10:81277578-81277600 GAGAGAGTGGTCTGGATGTGTGG + Intergenic
1071819119 10:89262671-89262693 GATTTAGTAGTTTGGAGGTGAGG - Intronic
1074498909 10:114004662-114004684 CTCTGAGAAGTTTGGATGAGAGG - Intergenic
1074890117 10:117728850-117728872 GTGTGAGTGGGTTGGGAGTGGGG + Intergenic
1075953440 10:126502037-126502059 GTGTGTGTGGTGTGGGTGTGTGG - Intronic
1076053737 10:127354726-127354748 TGGTGAGTAGCCTGGATGTGGGG + Exonic
1076405201 10:130207394-130207416 GTGTGAGAAGTGTGGGTGTGTGG - Intergenic
1076481974 10:130790780-130790802 GTGTGTGGAGTGTGTATGTGTGG - Intergenic
1077372140 11:2187745-2187767 GTGTGTGTGGTGTGTATGTGTGG - Intergenic
1079016117 11:16870299-16870321 GTGTGTGTAGTGTGTGTGTGGGG - Intronic
1079050975 11:17159090-17159112 TTGTGTGGAGTTTGGAAGTGGGG - Intronic
1079786977 11:24685414-24685436 GTGTGAGGAGGGTGTATGTGGGG - Intronic
1081284794 11:41254666-41254688 GTGTAAGGAATTTGGATGTGAGG + Intronic
1081393174 11:42553838-42553860 GTGTGTATAGTTTTGATGAGAGG + Intergenic
1081865143 11:46355646-46355668 GTGTGAGTAGTGTGGAAGCCTGG + Intronic
1083200221 11:61116666-61116688 GTGTGTGTAGTGTGTGTGTGTGG - Intronic
1083673516 11:64313196-64313218 GTGTCGGTGGCTTGGATGTGGGG + Intronic
1084611826 11:70208056-70208078 GTGTGAGCAGCTTGGCTTTGGGG + Intergenic
1085826324 11:79851540-79851562 GTGTGTTTAGTTTGGGGGTGGGG + Intergenic
1087322055 11:96675079-96675101 GTGGGAGAAGTTTGGATGGGTGG - Intergenic
1088682426 11:112255089-112255111 GTGTGTGTGGTATGTATGTGTGG + Intronic
1088949440 11:114552012-114552034 GTGTGAGTGGTTTCGTTTTGTGG + Intronic
1091028494 11:132162471-132162493 GTGTGGGAAGTGTGGATGGGGGG + Intronic
1091040004 11:132268577-132268599 CTGTGTGTGGTGTGGATGTGTGG + Intronic
1091150948 11:133327247-133327269 GTGTGAGTTGTTAGCAGGTGAGG + Intronic
1091332360 11:134739966-134739988 ATGTGTGTGGTGTGGATGTGTGG + Intergenic
1096666451 12:53169698-53169720 CTGTGAGTAGTGGGGATGAGGGG - Intronic
1096966518 12:55632278-55632300 GTGTGAGTAGGTATGCTGTGGGG + Intergenic
1097079501 12:56419591-56419613 GTGTGAGTGGTGTGGCTGTGAGG + Intronic
1097123182 12:56752140-56752162 GTGTGAGGAGGTTGGAGGCGGGG - Intronic
1097841236 12:64323623-64323645 GTGTGAGTAGCTTGGACTAGAGG + Intronic
1098233652 12:68397741-68397763 GTGTGAATAGTTTGGGGGAGTGG - Intergenic
1100813249 12:98361214-98361236 GTGTGCATGGTTTGTATGTGTGG + Intergenic
1100981771 12:100167652-100167674 GAGTGAGAAGTTTAGATTTGGGG + Intergenic
1103606830 12:122092987-122093009 GTGTGTGTTGTGTGTATGTGTGG + Intronic
1105437940 13:20392479-20392501 GTGTGTGTGGTGTGTATGTGAGG - Intergenic
1105438028 13:20393526-20393548 GTGTGTGTAGTGTGCGTGTGAGG - Intergenic
1105450772 13:20497306-20497328 GTGTGTGTAGTGTGTATATGCGG - Intronic
1105450777 13:20497377-20497399 GTGTGTGTAGTGTGTATATGCGG - Intronic
1105450782 13:20497451-20497473 GTGTGTGTAGTGTGTATATGTGG - Intronic
1105450805 13:20497801-20497823 GTGTGTGTAGTATGTATATGTGG - Intronic
1105450835 13:20498262-20498284 GTGTGTGTAGTGTGTATATGGGG - Intronic
1105853522 13:24357328-24357350 GTGTGATGAGTTTGTGTGTGTGG - Intergenic
1106439964 13:29757527-29757549 GTTTGATTAGTTTTTATGTGGGG + Intergenic
1106924150 13:34595507-34595529 GTGTGTATAGTTTGGCTCTGTGG - Intergenic
1107397708 13:40034615-40034637 ATGTGATTAGTTTGGAAATGCGG + Intergenic
1107601503 13:42018209-42018231 GTGTGTGTAGTGGGGATGAGGGG - Intergenic
1107612590 13:42131082-42131104 ATGTGAGTAGTTTCAGTGTGGGG + Intronic
1109858525 13:68166443-68166465 GATTCAGTAGTTTGGAGGTGGGG + Intergenic
1110598100 13:77341045-77341067 GTGTGTGTAGGTTGGTGGTGGGG + Intergenic
1112849835 13:103691767-103691789 GTGAGGGTACTTTGGATGAGTGG + Intergenic
1113056307 13:106271858-106271880 GGGTGAGAAGTGTTGATGTGAGG - Intergenic
1113406267 13:110043242-110043264 GTGTGTGTAGTGTGAGTGTGTGG - Intergenic
1113506040 13:110816595-110816617 GTGTGAGTTGGGTGGAGGTGGGG + Intergenic
1113592553 13:111511508-111511530 GTGTGTGTGGTATGAATGTGTGG + Intergenic
1114528336 14:23379876-23379898 GTCTGAGCAGTGAGGATGTGGGG + Intergenic
1117354965 14:54914940-54914962 GTCTGAGAAGCTTGGATGAGAGG - Intergenic
1118506892 14:66423373-66423395 TTATGACTAATTTGGATGTGGGG - Intergenic
1120325238 14:83015545-83015567 CTCTGAGGAGTTTGGAGGTGAGG - Intergenic
1120369378 14:83613506-83613528 GTGTGTACAGTTTGTATGTGTGG + Intergenic
1123054660 14:105563549-105563571 GTGTGAGGGTTGTGGATGTGGGG + Intergenic
1123054682 14:105563674-105563696 GTGTGGGGTGTGTGGATGTGTGG + Intergenic
1123054816 14:105564335-105564357 GTGTGGGGTGTGTGGATGTGTGG + Intergenic
1123875967 15:24624152-24624174 CTGTGAGTAATATGTATGTGTGG + Intergenic
1124866359 15:33495983-33496005 GTGTGTGTAGTTTGTATTTCAGG - Intronic
1124959530 15:34384060-34384082 GAGTGAGAAGTTTCGATCTGGGG + Intronic
1124976156 15:34530281-34530303 GAGTGAGAAGTTTCGATCTGGGG + Intronic
1125460915 15:39905913-39905935 GTGTGTGTAGTTTGTGTGTAAGG - Intronic
1126140068 15:45430321-45430343 TTGTGAGGAGTTTGGAGGTTTGG - Intergenic
1126956282 15:53936462-53936484 GTCTGGGTAGTTTGGATGAGGGG + Intergenic
1128784494 15:70385023-70385045 TTCTGAGCAGTTTGGATTTGGGG - Intergenic
1128875723 15:71199565-71199587 GTGTGTGTAGTGTGTGTGTGTGG + Intronic
1129037749 15:72661229-72661251 GAGTGAGAAGTTTTGATCTGGGG - Intronic
1129212139 15:74075998-74076020 GAGTGAGAAGTTTTGATCTGGGG + Intronic
1129398262 15:75265087-75265109 GAGTGAGAAGTTTTGATCTGGGG - Intronic
1129401872 15:75289362-75289384 GAGTGAGAAGTTTTGATCTGGGG - Intronic
1129475458 15:75782051-75782073 GAGTGAGAAGTTTTGATCTGGGG - Intergenic
1129674291 15:77624111-77624133 GTGCGAGTAGTCTGTGTGTGTGG + Intronic
1129729266 15:77920319-77920341 GAGTGAGAAGTTTTGATCTGGGG + Intergenic
1129839242 15:78733630-78733652 GAGTGAGAAGTTTCGATCTGGGG - Intergenic
1129878657 15:78993364-78993386 GTGTGTGTAGTGTGTGTGTGTGG + Intronic
1129894310 15:79092156-79092178 GTGTGTGGTGTTTGGGTGTGTGG - Intergenic
1130217793 15:81988594-81988616 GTGTTAGTAGATTGGATATGGGG + Intergenic
1132682244 16:1147473-1147495 GTTTGTTTGGTTTGGATGTGTGG - Intergenic
1133908187 16:10040495-10040517 GTGTTTGTGGTGTGGATGTGTGG - Intronic
1134386934 16:13782077-13782099 CTGTCAGCAGATTGGATGTGGGG - Intergenic
1135772813 16:25230100-25230122 CTGAGAATGGTTTGGATGTGTGG - Intergenic
1136115117 16:28089525-28089547 GTGTGTGTGGTGTGTATGTGTGG - Intergenic
1136115124 16:28089606-28089628 GTGTGTGTAGTGTGTATATGTGG - Intergenic
1136135954 16:28257081-28257103 GGCTGAGGAGTTTGGAGGTGGGG - Intergenic
1136405686 16:30045359-30045381 GTGTGTGTGGTTTGTGTGTGTGG + Intronic
1137222602 16:46470838-46470860 GAGTGAGTAGTTTGAATAGGAGG + Intergenic
1141059975 16:80857935-80857957 GGGGGAGAAGTTTGGAGGTGAGG - Intergenic
1143357636 17:6342400-6342422 TTGTGTGTAGTGTGGACGTGAGG - Intergenic
1144416292 17:15050529-15050551 GTGAGTGTAGTTGGGATGTAGGG + Intergenic
1147678234 17:42221928-42221950 GTGTGTGTGGTGTGTATGTGTGG + Intronic
1149442650 17:56687974-56687996 GTGAGTGTATTTTGCATGTGGGG + Intergenic
1149848404 17:60020953-60020975 GTGGGAGGAGATTGGATTTGGGG - Intergenic
1149861765 17:60125571-60125593 GTGGGAGGAGATTGGATTTGGGG + Intergenic
1152367155 17:79862955-79862977 GTGCGAGGAGTTTGGATGCGGGG + Intergenic
1152474874 17:80511623-80511645 GTGTGCGTGGTATGTATGTGTGG - Intergenic
1156395404 18:36695003-36695025 GTGTGTGTAGTATGCATTTGGGG + Intronic
1157804537 18:50648395-50648417 GTGTGAGAAGCTTGTGTGTGAGG + Intronic
1159383829 18:67696514-67696536 CTTTAAGTAGTTTGCATGTGTGG + Intergenic
1160357165 18:78238405-78238427 GTGTGTGTATGTTTGATGTGTGG + Intergenic
1160922796 19:1528671-1528693 GTGTGAGCAGGTGGGAGGTGTGG - Intronic
1161471011 19:4456871-4456893 GTGTGAGGAGAGTGGAGGTGAGG - Intronic
1161770798 19:6229757-6229779 GTGTGTGTCGTGTGTATGTGTGG - Intronic
1165070103 19:33250703-33250725 GTGTGTGTTGTGTGTATGTGTGG - Intergenic
1165354970 19:35299030-35299052 GTGTGTGTGGTGTGGGTGTGTGG - Intronic
1166164459 19:40977560-40977582 GAGTCAGTAGCTTGGATGGGTGG + Intergenic
1166186321 19:41141488-41141510 GAGTCAGTAGCTTGGATGGGTGG - Intergenic
1168305806 19:55434590-55434612 GTGTGTGTGGTGTGGGTGTGTGG + Intronic
1168305818 19:55434697-55434719 GTGTGTGTGGTGTGGGTGTGTGG + Intronic
925518353 2:4710354-4710376 GTGTGCGTGGCTTGGGTGTGTGG - Intergenic
925911473 2:8576215-8576237 GTGTGTGTAGTGTGAATGTGTGG - Intergenic
927145802 2:20165047-20165069 GTGTGTGTGGTGTGTATGTGTGG - Intergenic
927674287 2:25093129-25093151 GGGTAAGTAGTTTGGAAGAGAGG + Exonic
927919336 2:26960157-26960179 GATTCAGTAGTTTTGATGTGGGG + Intergenic
928195976 2:29216776-29216798 GTGTGTGTGGTGTGTATGTGTGG + Intronic
928196718 2:29221646-29221668 GTGTGAGTGATATGGCTGTGAGG - Intronic
929297693 2:40267001-40267023 CTGTTTGTAGTTTGTATGTGGGG + Intronic
929625559 2:43403251-43403273 GTGTGATTAGGTTGAATGTTTGG - Intronic
930003462 2:46877699-46877721 GTGTGTGTGGTGTGGGTGTGTGG - Intergenic
931978820 2:67672221-67672243 GTGTATGTGGTGTGGATGTGTGG - Intergenic
932688588 2:73893741-73893763 GTGTGAGTCTTTTGGATGAGTGG - Intronic
934245136 2:90299094-90299116 GTGTGTGTAGTGTGTGTGTGTGG - Intergenic
934263609 2:91497939-91497961 GTGTGTGTAGTGTGTGTGTGTGG + Intergenic
935548918 2:104430876-104430898 GGGTGGGAAGTTTGGACGTGAGG + Intergenic
939702825 2:145415277-145415299 TTGTGAATATTTTGGTTGTGTGG + Intergenic
941798161 2:169624565-169624587 GTGTAAGTAGTTAGGAAGTAGGG + Intronic
942415681 2:175756801-175756823 GAGTGAGTATTCTGGGTGTGGGG + Intergenic
943623351 2:190174022-190174044 GGGTGAGTAGTTTTGGTGGGAGG - Intronic
944393697 2:199246192-199246214 GGGTGAGGAGTTTGGGTGTGGGG - Intergenic
944942288 2:204642081-204642103 GGAGGAGTAGTTTGTATGTGTGG + Intronic
945054110 2:205853001-205853023 ATGTAACTGGTTTGGATGTGAGG - Intergenic
945230120 2:207579430-207579452 GTCTATGTAGTTTGGCTGTGTGG + Intronic
946540550 2:220679795-220679817 GAGTGAGTAGTGTGGGTTTGTGG + Intergenic
947757716 2:232580071-232580093 GTGTGTGTGGTATGTATGTGGGG - Intronic
948348998 2:237322922-237322944 GTGTGAGTAGTTTATTTGGGAGG - Intergenic
948682173 2:239642500-239642522 GTGTGTGTGGTGTGTATGTGTGG + Intergenic
948682217 2:239643066-239643088 GTGTGTGTGGTGTGTATGTGTGG + Intergenic
949044395 2:241865268-241865290 GTGTGTGGTGTTTGGTTGTGTGG + Intergenic
949044410 2:241865534-241865556 GTGTGTGTAGTGTGTGTGTGTGG + Intergenic
1170974522 20:21149906-21149928 GTGTAAGTAGTTTATATGGGAGG + Intronic
1171049308 20:21840470-21840492 GGGTGAGGAGTTTGTATGGGAGG - Intergenic
1175400089 20:58695140-58695162 GTGTGTGTGGTGTGCATGTGTGG + Intronic
1175451724 20:59075000-59075022 GTGTGAGAAATGTGGATGTCTGG + Intergenic
1176296263 21:5075110-5075132 GTGTCTGTGGTTGGGATGTGTGG + Intergenic
1176887360 21:14272664-14272686 GAGTGAGTAGTTTGAAAGTGCGG + Intergenic
1176950652 21:15042524-15042546 GTGAGGGTAATTTGGAGGTGGGG + Intronic
1179304049 21:40138902-40138924 GTGTGTGTGGTGTGTATGTGTGG + Intronic
1179467342 21:41585217-41585239 ATGTGTGTGGTTTGTATGTGTGG - Intergenic
1179556821 21:42184249-42184271 GTGTGTGTGGTTTGTGTGTGTGG + Intergenic
1179860786 21:44187011-44187033 GTGTCTGTGGTTGGGATGTGTGG - Intergenic
1180986816 22:19909666-19909688 GTGTGAGTAGTGTGTGTGAGTGG - Intronic
1180986844 22:19909943-19909965 GTGTGAGTGGTGTGTGTGTGTGG - Intronic
1183524505 22:38315537-38315559 GTGTGTGTACGTGGGATGTGTGG - Intronic
1185013893 22:48332526-48332548 GTGTGTGTGGTGTGCATGTGTGG - Intergenic
1185351011 22:50338503-50338525 GTGTGTGTAGTGTGTGTGTGCGG + Intergenic
949353105 3:3146146-3146168 GAGTCAGTAATTTGGAAGTGAGG + Intronic
950553809 3:13683236-13683258 GTGTGAGTTGTGTGGGTGTGAGG - Intergenic
950553816 3:13683306-13683328 GTGAGAGTTGTGTGGGTGTGAGG - Intergenic
951154903 3:19339795-19339817 GTGTGGGAATTTTGGAGGTGGGG + Intronic
951703530 3:25521360-25521382 GTGTGATGAGTTTGGATGGGAGG - Intronic
952127198 3:30314931-30314953 GAGTGAGTAGTTTGTAGGAGGGG + Intergenic
954597207 3:51836483-51836505 GTGTGAGTAGTTTGGTTGAGAGG + Intergenic
954645163 3:52126886-52126908 GTGTGGGTTGTTGGGAGGTGGGG - Intronic
954978248 3:54717529-54717551 GTGTGTGTGGTGTGCATGTGTGG + Intronic
955091683 3:55758330-55758352 GTGTGCATAGTTTGGAGTTGGGG - Intronic
955603291 3:60671336-60671358 ATGTGTGTATTTTGGAAGTGGGG - Intronic
958408659 3:93784339-93784361 TTCTGAGTAGTTTTTATGTGTGG + Intergenic
958580202 3:96008182-96008204 GTTTGGGTTGTTTGGATGTCTGG - Intergenic
961390014 3:126546849-126546871 GTGTGAGTAGTTTTTGTGAGAGG - Intronic
962956354 3:140270541-140270563 GTGTGAGTCATCTGGATGGGAGG - Intronic
963253678 3:143122794-143122816 TTAAGAGTAATTTGGATGTGGGG + Exonic
964989126 3:162785002-162785024 GAGTCAGTAGTTTGAATGTGAGG - Intergenic
965253685 3:166376549-166376571 GTGTGAGAGGTTTGTATATGAGG + Intergenic
966096451 3:176210033-176210055 GTGGGAGTTGTTTGGATGATAGG + Intergenic
966211426 3:177457440-177457462 GGGTGAGTAGTTTTGGTGGGAGG - Intergenic
966757071 3:183381257-183381279 GTGTGATTAATGAGGATGTGTGG + Intronic
967150227 3:186641452-186641474 GTGTGAATATTCTGGACGTGGGG + Intronic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
968929181 4:3567828-3567850 GTGTGTGTAGTTTGTGTGTGTGG - Intergenic
968929183 4:3567888-3567910 GTGTGTGTAGTTTGTGTGTGTGG - Intergenic
968929186 4:3568081-3568103 GTGTGTGTACTTTGTGTGTGTGG - Intergenic
968929196 4:3568578-3568600 GTGTGTGTACTTTGTGTGTGTGG - Intergenic
968929203 4:3568872-3568894 GTGTGTGTACTTTGTGTGTGGGG - Intergenic
968929206 4:3568928-3568950 GTATGTGTAGTTTGTGTGTGTGG - Intergenic
968929207 4:3568988-3569010 GTGTGTGTAGTTTGTGTGTGTGG - Intergenic
968929208 4:3569074-3569096 GTGTGTGTAGGTTGTGTGTGTGG - Intergenic
968929210 4:3569160-3569182 GTGTGTGTAGTTTGTGTGTGTGG - Intergenic
969119934 4:4900693-4900715 GTGTGGGTAGTTTGTTTGGGAGG - Intergenic
969687957 4:8687162-8687184 GTGTGTGTAGTGTGTGTGTGTGG + Intergenic
970125791 4:12808888-12808910 GTTGGGGTAGTTTGGATGAGGGG + Intergenic
970273846 4:14375899-14375921 GTGTGCGGAGTTGGGAGGTGGGG + Intergenic
970428140 4:15964188-15964210 GGGGGACTAGTTTGAATGTGAGG + Intronic
973527768 4:51795704-51795726 TTGTGTCTAGTTTGTATGTGCGG + Intergenic
973527904 4:51797914-51797936 TTGTGTCTAGTTTGTATGTGCGG + Intergenic
973528043 4:51800125-51800147 TTGTGTCTAGTTTGTATGTGCGG + Intergenic
973528309 4:51804545-51804567 TTGTGTCTAGTTTGTATGTGCGG + Intergenic
973528444 4:51806754-51806776 TTGTGTCTAGTTTGTATGTGCGG + Intergenic
973528575 4:51808964-51808986 TTGTGTCTAGTTTGTATGTGCGG + Intergenic
973528801 4:51812707-51812729 TTGTGTCTAGTTTGTATGTGCGG + Intergenic
973528856 4:51813552-51813574 TTGTGTCTAGTTTGTATGTGCGG + Intergenic
977151205 4:93514408-93514430 GTGTGTGTACTGTGGAGGTGGGG - Intronic
978448285 4:108801956-108801978 GAGAGAGTAGTTTCGCTGTGTGG + Intergenic
981115861 4:140990490-140990512 CTGTCAGTAGGTGGGATGTGAGG - Intronic
981805853 4:148714160-148714182 GTGTAAGTAGTTTGATTGTAAGG + Intergenic
983732473 4:171012469-171012491 GTGTGAGGAGTTTGGATTGTTGG - Intergenic
985982623 5:3484115-3484137 GTGTGTATAGTGTGCATGTGTGG - Intergenic
988421986 5:31016912-31016934 TTCTGAGAATTTTGGATGTGAGG + Intergenic
988890261 5:35609064-35609086 GTGTATGTGGTTTGCATGTGGGG - Intergenic
989861593 5:46384797-46384819 TTGTGTGTAGTTTTTATGTGAGG - Intergenic
989898248 5:47125205-47125227 GTCTGTCTAGTTTGTATGTGAGG - Intergenic
994750488 5:103731599-103731621 GAGGGAGTAGTTTGGTTGTCTGG + Intergenic
995187644 5:109289204-109289226 ATGTGAGTAGCTCTGATGTGTGG - Intergenic
995274627 5:110264042-110264064 GTGTAAGTAGTTAGGAAGAGAGG - Intergenic
995304168 5:110624085-110624107 ATGTGAATAGTCTGGTTGTGAGG - Intronic
996364093 5:122681466-122681488 GTGTGAATAAATTGAATGTGGGG - Intergenic
997075518 5:130670753-130670775 GTGTGAATAGTCTTGATTTGTGG + Intergenic
997197793 5:131991209-131991231 GTGTGTGGAGTTTGTATGTGGGG - Intronic
997262136 5:132473601-132473623 TTATGAGTATTGTGGATGTGTGG + Intronic
997785303 5:136705714-136705736 GTGTTAGTTCTTTGGATGTTTGG - Intergenic
998134956 5:139669732-139669754 GTGTGTGTAGCTTGGCTGTGGGG - Intronic
999081387 5:148847659-148847681 GTATGTGTGGTTTGGATGGGGGG + Intergenic
1000985157 5:167858437-167858459 GAGTGAGGAGTTTGCATGTGAGG - Intronic
1002077571 5:176718010-176718032 TTGTGAGAAGTTTGCAGGTGGGG - Intergenic
1003948422 6:11095855-11095877 TTGTGATATGTTTGGATGTGGGG + Intronic
1004647575 6:17577453-17577475 GGGTGAGTAGTTTCGGTGGGAGG + Intergenic
1004704814 6:18114665-18114687 GGGGGACTAGTTGGGATGTGGGG + Intergenic
1005164702 6:22906471-22906493 GTGTGTGTGGTTTGTGTGTGTGG - Intergenic
1007915118 6:45554133-45554155 GTGTGTGTGGTGTGTATGTGTGG + Intronic
1008708860 6:54198920-54198942 GTGTGAAGAGAGTGGATGTGTGG + Intronic
1011750793 6:90452833-90452855 TTGTCAATGGTTTGGATGTGAGG + Intergenic
1014160261 6:118159444-118159466 GTATGAGTTGTTTGGATTTCAGG - Intronic
1015187217 6:130431527-130431549 ATTTGAGGAGTTGGGATGTGGGG + Intronic
1015842831 6:137492101-137492123 GGGTGAGGAATTTGGATGGGTGG - Intergenic
1015884817 6:137905790-137905812 ATGTGAGGAGTATGTATGTGAGG - Intergenic
1015914181 6:138198702-138198724 GTGTAGGCAGTTTGGATATGTGG - Intronic
1016466697 6:144332539-144332561 GTGGGAGTATTTTGGATCTTTGG + Intronic
1018935305 6:168270164-168270186 GTGTGAGTATATGGTATGTGGGG - Intergenic
1019074022 6:169372462-169372484 GTGTGTGTGGTGTGTATGTGTGG - Intergenic
1019487267 7:1295105-1295127 GTGTGTGTGGTGTGGGTGTGTGG + Intergenic
1019487278 7:1295169-1295191 GTGTGTGTGGTGTGGGTGTGTGG + Intergenic
1019487344 7:1295479-1295501 GTGTGTGTGGTGTGGGTGTGTGG + Intergenic
1020215584 7:6187552-6187574 GTGAGAGTGGTTGGGATGTGGGG - Intronic
1020744658 7:12066842-12066864 GGGTGAGTAGTTTTGGTGGGAGG - Intergenic
1020971440 7:14946567-14946589 ATGTGTGTAGTTTGTAAGTGGGG - Intronic
1023896003 7:44433435-44433457 GTGTGTGCAGTTTGTGTGTGTGG + Intronic
1024154197 7:46603518-46603540 CTGTGAGTACTTGAGATGTGAGG - Intergenic
1024390248 7:48802225-48802247 GTATGAGTTCTTTGCATGTGAGG - Intergenic
1024992748 7:55249103-55249125 GTGTGGCTAGTTTGGTTGGGAGG - Intronic
1027266816 7:76499083-76499105 GTGTGAGGTGTGTGGAGGTGTGG + Intronic
1027308881 7:76933009-76933031 GGGTGAGAAGTTTGTGTGTGTGG - Intergenic
1027318203 7:76997223-76997245 GTGTGAGGTGTGTGGAGGTGTGG + Intergenic
1027613003 7:80386066-80386088 GTGTGAGGAGTAAGGATGAGAGG + Intronic
1029842495 7:103380904-103380926 GTGTGTGTATTCTGTATGTGTGG - Intronic
1030898982 7:115098091-115098113 GTTTGAGTGGTGTGTATGTGTGG + Intergenic
1032239857 7:130152339-130152361 GTGTGTGTGGCTTGTATGTGTGG - Intergenic
1032395602 7:131587393-131587415 GTGTGTGTAGTGTGAGTGTGTGG + Intergenic
1032395620 7:131587688-131587710 GTGTGTGTAGTGTGAGTGTGTGG + Intergenic
1032395626 7:131587749-131587771 GTGTGTGTAGTGTGGGTGTGTGG + Intergenic
1032405762 7:131654373-131654395 GTATGTGTTGTATGGATGTGTGG + Intergenic
1032868998 7:135960477-135960499 GTGCTAGCAGTTAGGATGTGAGG - Intronic
1035140695 7:156757628-156757650 GTGTGAGTAGTTTGGATGTGAGG - Intronic
1035301613 7:157901251-157901273 GTGGGAGGGCTTTGGATGTGGGG - Intronic
1035836626 8:2761416-2761438 GAGTGGGTAGGATGGATGTGGGG - Intergenic
1036104182 8:5822662-5822684 GGGTGAGTAGTTTGGCTGGAAGG + Intergenic
1036426246 8:8647239-8647261 GTGTGTGTGGTTTGTGTGTGTGG - Intergenic
1036546347 8:9772853-9772875 GTGTGTGTAGTGCGTATGTGTGG + Intronic
1037096322 8:14991882-14991904 TTGGGAGTAGATTGGATGAGAGG - Intronic
1037096374 8:14992205-14992227 TTGGGAGTAGATTGGATGAGAGG - Intronic
1037145922 8:15572774-15572796 GTGTGAGAAGAGTGGAGGTGGGG + Intronic
1037992731 8:23332264-23332286 GTGTGGGTTGTGTGTATGTGTGG - Intronic
1040039918 8:42905605-42905627 GTGTGAGTAGAATGGATGCTGGG + Intronic
1040677547 8:49768518-49768540 GTGTGTGTAATTTGTATGTGTGG - Intergenic
1042630071 8:70806272-70806294 GTTTGTGTAGTTTCGATTTGAGG - Intergenic
1043289161 8:78574556-78574578 GTGTGAGTGTTTTGGTTTTGTGG - Intronic
1044511861 8:93090817-93090839 GTGTGAGTTATTTAAATGTGTGG + Intergenic
1045383858 8:101652539-101652561 GTGTGTGTGGTGTGTATGTGTGG + Intronic
1045540352 8:103078450-103078472 GTGTGACTAATTTGGAGCTGTGG - Intergenic
1045914954 8:107457811-107457833 GTGTGTGTAGTGGGTATGTGTGG - Intronic
1047643443 8:126845221-126845243 GTGTGTATAGTATGTATGTGGGG - Intergenic
1047706144 8:127501720-127501742 GTCTGAGCAGCTTGGGTGTGGGG + Intergenic
1047772515 8:128041619-128041641 GTGTGTGTTGTGTGCATGTGTGG + Intergenic
1048930682 8:139313381-139313403 GTGTGAGAAGCTGCGATGTGGGG + Intergenic
1050634154 9:7592510-7592532 ATGGGCATAGTTTGGATGTGGGG + Intergenic
1050721201 9:8592265-8592287 GTGTGAGTGGGTTGAATTTGGGG - Intronic
1053273245 9:36764787-36764809 GTGTGAGTGGTGTGTGTGTGTGG + Intergenic
1053431087 9:38042334-38042356 ATGTGTGCAGTTTGGAGGTGAGG - Intronic
1053803883 9:41781298-41781320 GTGTGTGTACTTTGTGTGTGTGG - Intergenic
1053803884 9:41781326-41781348 GTGTGTGTAGTTTGTGTGTGTGG - Intergenic
1053803892 9:41781579-41781601 GTGTGTGTACTTTGTGTGTGTGG - Intergenic
1053803898 9:41781884-41781906 GTGTGTATAGTTTGTGTGTGTGG - Intergenic
1053803899 9:41781972-41781994 GTGTGTGTACTTTGTGTGTGTGG - Intergenic
1053803905 9:41782322-41782344 GTATGTGTAGTTTGTGTGTGTGG - Intergenic
1053803907 9:41782468-41782490 GTGTGTGTAGTTTGTGTGTGTGG - Intergenic
1053803908 9:41782513-41782535 GTATGTGTAGTTTGTGTGTGTGG - Intergenic
1053803909 9:41782599-41782621 GTGTGTGTAGTTTGTGTGTGTGG - Intergenic
1053803912 9:41782687-41782709 GTGTGTATAGTTTGTGTGTGTGG - Intergenic
1054141373 9:61532858-61532880 GTGTGTGTGGTTTGTGTGTGTGG + Intergenic
1054141375 9:61533073-61533095 GTATGTGTAGTTTGTGTGTGTGG + Intergenic
1054141376 9:61533133-61533155 GTATGTGTAGTTTGTGTGTGTGG + Intergenic
1054141384 9:61533487-61533509 GTGTGTGTACTTTGTGTGTGTGG + Intergenic
1054192184 9:61992650-61992672 GTGTGTGTAGTTTGTGTGTGTGG - Intergenic
1054192190 9:61992871-61992893 GTGTGTGTACTTTGTGTGTGTGG - Intergenic
1054192192 9:61992916-61992938 GTGTGTGTACTTTGTGTGTGTGG - Intergenic
1054192194 9:61992961-61992983 GTGTGTGTACTTTGTGTGTGTGG - Intergenic
1054192209 9:61993749-61993771 GTATGTGTAGTTTGTGTGTGTGG - Intergenic
1054192210 9:61993809-61993831 GTATGTGTAGTTTGTGTGTGTGG - Intergenic
1054192211 9:61993895-61993917 GTGTGTGTAGTTTGTGTGTGTGG - Intergenic
1054192212 9:61993966-61993988 GTGTGTGTAGTTTGTGTGTGTGG - Intergenic
1054192216 9:61994185-61994207 GTGTGTATAGTTTGTGTGTGTGG - Intergenic
1054461060 9:65463206-65463228 GTGTGTGTAGTTTGTGTGTGTGG + Intergenic
1054461063 9:65463294-65463316 GTGTGTGTAGTTTGTGTGTGTGG + Intergenic
1054461064 9:65463380-65463402 GTGTGTGTAGTTTGTGTGTGTGG + Intergenic
1054461067 9:65463569-65463591 GTATGTGTAGTTTGTGTGTGTGG + Intergenic
1054461070 9:65463625-65463647 ATGTGTGTACTTTGTATGTGGGG + Intergenic
1054461071 9:65463717-65463739 GTGTGTATAGTTTGTGTGTGCGG + Intergenic
1054461073 9:65463758-65463780 GTGTGTGTGGTTTGTGTGTGTGG + Intergenic
1054461077 9:65463934-65463956 GTGTGTGTACTTTGTGTGTGTGG + Intergenic
1054461083 9:65464385-65464407 GTGTGTGTACTTTGTGTGTGTGG + Intergenic
1054461085 9:65464430-65464452 GTGTGTGTACTTTGTGTGTGTGG + Intergenic
1054461087 9:65464475-65464497 GTGTGTGTACTTTGTGTGTGTGG + Intergenic
1054461092 9:65464571-65464593 GTGTGTATAGTTTGTGTGTGTGG + Intergenic
1054646190 9:67594506-67594528 GTGTGTATAGTTTGTGTGTGTGG + Intergenic
1054646194 9:67594725-67594747 GTGTGTGTAGTTTGTGTGTGTGG + Intergenic
1054646195 9:67594796-67594818 GTGTGTGTAGTTTGTGTGTGTGG + Intergenic
1054646196 9:67594882-67594904 GTATGTGTAGTTTGTGTGTGTGG + Intergenic
1054646197 9:67594942-67594964 GTATGTGTAGTTTGTGTGTGTGG + Intergenic
1054983440 9:71234037-71234059 TTGGGAGCAGTTTGGCTGTGTGG + Intronic
1056114478 9:83428496-83428518 GTGTGTGTGGTTTATATGTGTGG - Intronic
1056661559 9:88547418-88547440 GTGTGTGTAGGTTATATGTGTGG - Intronic
1056926780 9:90841227-90841249 GTGTATGTAGTTTGTGTGTGTGG + Intronic
1056926814 9:90842182-90842204 GTGTATGTAGTTTGTGTGTGTGG + Intronic
1057020729 9:91695526-91695548 GTGTGTGTGGTGTGTATGTGTGG + Intronic
1057335319 9:94150596-94150618 GTGTGAGAAGGTTGGATGGTTGG + Intergenic
1057496804 9:95567681-95567703 GGGTGCGTAGTGTGTATGTGTGG + Intergenic
1057496808 9:95567740-95567762 GTGTGTGTAGTGTGTATGTGTGG + Intergenic
1059171486 9:112129202-112129224 GTGGTGATAGTTTGGATGTGAGG + Intronic
1059248046 9:112865031-112865053 GTGTGTGTAGTGTGTGTGTGGGG - Intronic
1060200597 9:121650051-121650073 GTGTGAGTATATTTTATGTGTGG + Intronic
1060600094 9:124871477-124871499 GTGGGAGGAGCTTGGGTGTGAGG + Intronic
1061235462 9:129339735-129339757 GTGTGAGTTGTGTATATGTGAGG + Intergenic
1061235537 9:129340905-129340927 GTGTGAGTTGTGTGTGTGTGAGG + Intergenic
1061277204 9:129576203-129576225 GTGTGAGGAGTGTGTGTGTGAGG - Intergenic
1061277207 9:129576250-129576272 GTGTGAGGAGTGTGTGTGTGAGG - Intergenic
1061290469 9:129647929-129647951 GTGTGAGTGGTGTGTGTGTGTGG - Intergenic
1062059160 9:134485716-134485738 GTGTGAGTAGTTTATTTGTGGGG + Intergenic
1062107004 9:134761094-134761116 GTGTGGGTTGTGTGCATGTGTGG - Intronic
1062139267 9:134946731-134946753 GTGTGAATAGTCTGTATGTCTGG - Intergenic
1062234865 9:135502942-135502964 GTGGGAGTAGACTGGAGGTGAGG + Intronic
1203417027 Un_KI270334v1:1020-1042 TTGTGTCTAGTTTGTATGTGCGG - Intergenic
1203417179 Un_KI270335v1:349-371 TTGTGTCTAGTTTGTATGTGCGG - Intergenic
1203417288 Un_KI270338v1:995-1017 TTGTGTCTAGTTTGTATGTGCGG - Intergenic
1203403997 Un_KI270511v1:4184-4206 TTGTGTGTAGTTTTTATGTGAGG + Intergenic
1189070451 X:37857519-37857541 GTTTGGGCAGTTGGGATGTGGGG + Intronic
1189323365 X:40098841-40098863 GTGGGAATTGTTTGGAGGTGGGG + Intronic
1190245012 X:48685330-48685352 TTGTGAGAGGTTTGGATTTGGGG - Intronic
1190493052 X:51001953-51001975 GAGTGGGGAGTGTGGATGTGGGG + Intergenic
1190511578 X:51178696-51178718 GAGTGGGGAGTGTGGATGTGGGG - Intergenic
1193197612 X:78653103-78653125 GTGTGTGTAGGGTGGAGGTGGGG - Intergenic
1198117064 X:133554655-133554677 GGGTGAGTAGTTTGGTGGGGAGG - Intronic
1198702725 X:139415027-139415049 GTGTGTGTAGTTTTGATGCAGGG + Intergenic
1200043911 X:153389591-153389613 GTGTGTGTGGTGTGTATGTGTGG - Intergenic
1200043924 X:153389740-153389762 GTGTGTGTGGTGTGTATGTGTGG - Intergenic
1200044020 X:153390851-153390873 GTGTGTGTGGTGTGTATGTGTGG - Intergenic
1200044106 X:153391783-153391805 GTGTGTGTGGTGTGTATGTGTGG - Intergenic
1201081078 Y:10247606-10247628 GTCTGTGTAGTTTTTATGTGCGG + Intergenic
1201081465 Y:10254584-10254606 GTCTGTGTAGTTTTTATGTGCGG + Intergenic
1201081881 Y:10262078-10262100 GTCTGTGTAGTTTTTATGTGCGG + Intergenic
1201082257 Y:10318797-10318819 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201082598 Y:10324926-10324948 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201082938 Y:10331052-10331074 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201083261 Y:10336841-10336863 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201083583 Y:10342627-10342649 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201083905 Y:10348414-10348436 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201084228 Y:10354207-10354229 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201084549 Y:10359989-10360011 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201085173 Y:10371233-10371255 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201085501 Y:10377191-10377213 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201085824 Y:10382977-10382999 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201086144 Y:10388762-10388784 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201086466 Y:10394553-10394575 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201086791 Y:10400348-10400370 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201087115 Y:10406134-10406156 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201087436 Y:10411919-10411941 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201087757 Y:10417703-10417725 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201088079 Y:10423491-10423513 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201088404 Y:10429282-10429304 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201089034 Y:10440692-10440714 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201089357 Y:10446477-10446499 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201089679 Y:10452263-10452285 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201090304 Y:10463502-10463524 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201090626 Y:10469285-10469307 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201090952 Y:10475073-10475095 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201091275 Y:10480861-10480883 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201091599 Y:10486655-10486677 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201091923 Y:10492441-10492463 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201092246 Y:10498226-10498248 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201092585 Y:10504352-10504374 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201092908 Y:10510138-10510160 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201093168 Y:10514742-10514764 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201093489 Y:10520528-10520550 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201094003 Y:10529716-10529738 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201094333 Y:10535672-10535694 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201094674 Y:10541798-10541820 GTCTGTGTAGTTTTTATGTGCGG - Intergenic
1201095043 Y:10598296-10598318 GTCTGTGTAGTTTTTATGTGCGG + Intergenic
1201095377 Y:10604423-10604445 GTCTGTGTAGTTTTTATGTGCGG + Intergenic
1201095707 Y:10610382-10610404 GTCTGTGTAGTTTTTATGTGCGG + Intergenic
1201096028 Y:10616161-10616183 GTCTGTGTAGTTTTTATGTGCGG + Intergenic
1201681598 Y:16651130-16651152 ATGTGAATTTTTTGGATGTGGGG + Intergenic