ID: 1035146282

View in Genome Browser
Species Human (GRCh38)
Location 7:156820931-156820953
Sequence CTCAAGGTGAACTGCAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035146279_1035146282 -7 Left 1035146279 7:156820915-156820937 CCTTTGGCAGGTTCCTCTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1035146282 7:156820931-156820953 CTCAAGGTGAACTGCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035146282 Original CRISPR CTCAAGGTGAACTGCAGCAC AGG Intronic
No off target data available for this crispr