ID: 1035147638

View in Genome Browser
Species Human (GRCh38)
Location 7:156835865-156835887
Sequence TTCTAAGTGAAATTAGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035147638 Original CRISPR TTCTAAGTGAAATTAGAGGT TGG (reversed) Intronic
901029201 1:6296870-6296892 TTTTAAGTGAAATAAGAGTCAGG - Intronic
903367758 1:22815483-22815505 TTCTCAGTGAAACCTGAGGTGGG + Intronic
903974652 1:27141537-27141559 TTCTACGGGAGTTTAGAGGTGGG - Intronic
905153326 1:35950775-35950797 TTCAAGGTGTATTTAGAGGTTGG - Intronic
905716595 1:40156932-40156954 ATCCAAGTGAAATTAAATGTTGG + Intergenic
908017688 1:59861350-59861372 TAATAAGTTAAATTAGAAGTGGG - Intronic
912459507 1:109821570-109821592 TTCTGAGTGTAAGTAGAGGTAGG - Intergenic
912768944 1:112444691-112444713 TTTTAAATGATATTAGAGTTTGG - Intronic
913211475 1:116586116-116586138 TTCTGAGTGACATCAGAGGAGGG + Intronic
914409547 1:147412782-147412804 TCCAAAATGAAATAAGAGGTTGG - Intergenic
916295453 1:163214173-163214195 TTCTTGGTGAAATTAGACTTAGG - Intronic
918192957 1:182193494-182193516 TTCAAGGTGAGATTTGAGGTGGG + Intergenic
918435779 1:184511402-184511424 TACTATGTGAAAATAGAGGTTGG + Intronic
919512530 1:198483656-198483678 TTTTAAATGAAATAAGAGGTAGG - Intergenic
921030016 1:211328216-211328238 TTCTAGTTCAAATTAGAGTTAGG - Intronic
921748012 1:218759661-218759683 GAGTAAGTGAAAATAGAGGTGGG + Intergenic
922575077 1:226655796-226655818 TTCTCAGTGCAATTTGGGGTGGG + Intronic
924663073 1:246040434-246040456 TTCTAAGAGAAGTGAGACGTTGG - Intronic
1062949250 10:1485084-1485106 TTCTATGTGCACTTATAGGTAGG + Intronic
1063405042 10:5785708-5785730 TTCTAGTTGAAATTAGTGTTGGG - Intronic
1063586827 10:7359468-7359490 TTCTGAGTGGAATTCGAGGGGGG - Intronic
1064766425 10:18679060-18679082 TTCTAAATAAAATAACAGGTGGG - Exonic
1066109684 10:32184828-32184850 TTTTAACTTCAATTAGAGGTCGG + Intergenic
1066927323 10:41713984-41714006 TTCTAAGGGAACTCAGAGGCTGG + Intergenic
1068593115 10:58871292-58871314 TTCTAACAGAAATAACAGGTTGG - Intergenic
1071045423 10:81369225-81369247 TAATAAGTGAAAATAGATGTAGG - Intergenic
1073723298 10:106199555-106199577 TTCTATATGAAATTACATGTGGG + Intergenic
1074062446 10:109979545-109979567 TTCTAAATGAATTTAGCTGTGGG + Intergenic
1074624013 10:115158250-115158272 TTTTCAGTTAAATTAGAGGTTGG + Intronic
1075464480 10:122641408-122641430 TTCTACTAGGAATTAGAGGTGGG + Intronic
1077647406 11:3937891-3937913 TCCTAGGTGAAGTTAAAGGTAGG - Intronic
1077963849 11:7105798-7105820 TTCTAAGTGAAGTATTAGGTTGG - Intergenic
1081432706 11:42993969-42993991 TTTTAATTTAGATTAGAGGTTGG - Intergenic
1083223656 11:61269878-61269900 GTCTCATTGAAATTAGAGTTGGG - Intronic
1086236551 11:84638081-84638103 ATCAAAATGAAAGTAGAGGTTGG - Intronic
1087981869 11:104624245-104624267 TTCAAAGTGAAATTAGTGTTGGG + Intergenic
1089150649 11:116361224-116361246 TACCAAGTGAAATGAAAGGTTGG + Intergenic
1090606806 11:128430299-128430321 TTCTAAGAAAAGTTAGAGCTAGG + Intergenic
1090947802 11:131447426-131447448 CTCTAATTGAAATTAGAGCAGGG - Intronic
1091078569 11:132644078-132644100 TTTTAAATGAATTTATAGGTTGG - Intronic
1092589246 12:9935362-9935384 TTCTAAGTGAAATGGGAAGATGG + Intergenic
1095187295 12:39215496-39215518 TTCTAAATAAAAATAGAGATGGG - Intergenic
1095630812 12:44374575-44374597 TTCTCTGTGAAAGTACAGGTGGG + Intronic
1097766909 12:63536381-63536403 TTCTAAATGTAATTGGAGGCCGG - Intergenic
1097783258 12:63731310-63731332 TTCTAAATGTAATTGGAGGCCGG - Intergenic
1097875508 12:64639386-64639408 CTGTAAGTCAAATTACAGGTGGG - Intronic
1097943665 12:65342044-65342066 TTCTAGGGGAAAATAGAAGTGGG + Intronic
1098316584 12:69199590-69199612 TTTAAGCTGAAATTAGAGGTGGG - Intergenic
1100585997 12:95980165-95980187 TTCAAAGTTTAATTATAGGTTGG + Intronic
1103688379 12:122751012-122751034 TACTAAGGGAACTTAGAGGCCGG - Intergenic
1103791580 12:123475875-123475897 TTTTAAGTGAATTTAGAGGCAGG - Intronic
1104717089 12:131023236-131023258 TTCTAAGTGACACTACAGGAAGG - Intronic
1109716563 13:66228802-66228824 TTCTAAGTGAAAGCAGAGAGAGG + Intergenic
1112433895 13:99376703-99376725 TTCTCAATGAAGTTAGAGGAAGG + Intronic
1113161773 13:107390026-107390048 TTCTAGGTGAAGTTAATGGTTGG + Intronic
1115494861 14:33993119-33993141 TCCTAAGTGAAATAGGAGGCAGG + Intronic
1116756393 14:48953906-48953928 TTCTAAGTGCAATGAAAAGTGGG + Intergenic
1118035031 14:61857394-61857416 CTATGACTGAAATTAGAGGTGGG + Intergenic
1120040059 14:79742543-79742565 TTCTAAATAAAAGTAGAAGTTGG + Intronic
1121194591 14:92058490-92058512 TTCAAAGTGTGATTAGAGCTGGG - Exonic
1121642644 14:95496018-95496040 CTCTGAGTGGAATGAGAGGTGGG - Intergenic
1121884023 14:97526383-97526405 TTCTAAGTGGGATTTGATGTGGG + Intergenic
1126315296 15:47363392-47363414 TTCTAAGGTAAATTACATGTGGG + Intronic
1126410043 15:48363931-48363953 TTCACAGTGAAATGAGAGATTGG + Intergenic
1128409283 15:67377758-67377780 TTTAAAGTAAAAATAGAGGTGGG + Intronic
1133094394 16:3431632-3431654 GCCTAAGTGAGATTAGAGCTGGG + Intronic
1133508590 16:6435930-6435952 TGCTAAGTGAAGTTCGTGGTGGG - Intronic
1134637371 16:15802743-15802765 TTCTAAATAAAATCACAGGTGGG - Intronic
1135619326 16:23941464-23941486 TTATAAGTGAAATTAGACCATGG - Intronic
1136174663 16:28508352-28508374 TTCTGGGTGACAGTAGAGGTTGG - Intronic
1137791989 16:51182907-51182929 TTCTAAGTGACATTAGGGAATGG + Intergenic
1140829750 16:78740295-78740317 TTCTAAGTGAAATTACCCGTCGG + Intronic
1141402905 16:83766326-83766348 TTTTAAATCAAATTATAGGTTGG + Intronic
1146326201 17:31888366-31888388 TTCTAAGTTAGTTGAGAGGTTGG - Intronic
1148011220 17:44483221-44483243 GTCTAAGAGATATGAGAGGTAGG - Intronic
1150286652 17:63958380-63958402 TTACAAGTGAAATTATATGTTGG + Intronic
1150675375 17:67241905-67241927 TTCAAAGCGAAGTTAGTGGTTGG - Intronic
1152333687 17:79687692-79687714 TTCAAAGAGAAATTAGAATTTGG + Intergenic
1153371992 18:4328313-4328335 TACTAAGTGAAAAGAGATGTAGG - Intronic
1153973753 18:10248656-10248678 TTCTAAGCCAAATGAGATGTAGG - Intergenic
1157533331 18:48440541-48440563 TTTTAAGGGAAAGTAGAGGGAGG + Intergenic
1158188664 18:54800706-54800728 TTCTTGGTGAGATTAGAGTTGGG - Intronic
1164158528 19:22611232-22611254 TTCTAATGGAAATCAGAGTTTGG + Intergenic
1164859391 19:31550930-31550952 CTCAGAGTGAAAATAGAGGTGGG - Intergenic
1165611140 19:37154308-37154330 TTGTAAGTGAATTAAGAGTTTGG - Intronic
927625676 2:24715716-24715738 TGCTGAGAGAAATTAGAGGGGGG + Intronic
929235561 2:39601744-39601766 TCCTAAGAGAAATGAGATGTAGG - Intergenic
929245303 2:39695671-39695693 GTGTAAGTGAAGTTGGAGGTAGG + Intronic
929629452 2:43444574-43444596 TTCTATGAGAAATTGGAGCTTGG - Intronic
931263571 2:60640647-60640669 TTCAAAGTAAAAATAGAGGGTGG - Intergenic
931274024 2:60728102-60728124 TTCTCTGTGAAATTAGAGCCAGG - Intergenic
932345073 2:70990021-70990043 TTCTGAGTAAAATTAGAAGAAGG + Intronic
932690256 2:73907136-73907158 TTTTAAGTGAAAGAAGAGGTAGG - Intronic
933173210 2:79147361-79147383 TTAAAAGTGAGATTAGTGGTGGG - Intergenic
933801469 2:85963601-85963623 TTATAAATCAAATTAGAGGCGGG - Intergenic
933805993 2:85998334-85998356 TTCTGAGTGAAATTACAGCCTGG + Intergenic
935300253 2:101687691-101687713 CTCTGAGTGAAATAGGAGGTAGG + Intergenic
935548984 2:104431492-104431514 TCGTAAGTGAAATTGGAGATGGG - Intergenic
937291848 2:120786476-120786498 TTCTCAGTGGAATTGCAGGTTGG - Intronic
942164499 2:173228941-173228963 CTATAAGTCAAATTAGAGTTTGG - Intronic
942339744 2:174931367-174931389 CTCTAATTGAAATTAGAGTTTGG - Intronic
943121857 2:183746592-183746614 TTCACAGTGAAATTGCAGGTGGG - Intergenic
943516564 2:188894791-188894813 TTCTTAGTGGAGTTAGAGGTAGG - Intergenic
944617399 2:201475850-201475872 TTGTAAGTGAAAATTGAGGGAGG + Intronic
944676850 2:202040576-202040598 TTTTCAGTGAAATTAAAGATGGG - Intergenic
945359796 2:208883600-208883622 TTCTTGTTGACATTAGAGGTGGG + Intergenic
945904009 2:215570398-215570420 TTCTGAGATAAATTAGAGCTTGG - Intergenic
946879083 2:224159687-224159709 TTCAACATGAAATTAGAGTTGGG + Intergenic
1169653121 20:7891987-7892009 TTCTAGGTGATATTAAATGTTGG - Intronic
1170343747 20:15359085-15359107 TTCTAAGTGAAAAATCAGGTCGG - Intronic
1170349793 20:15426292-15426314 TCTTATGTGAAATTATAGGTTGG - Intronic
1173083857 20:39895781-39895803 TTCTAAAAGAAATGAGAGGGAGG + Intergenic
1174779813 20:53378658-53378680 TAATAAATGAAATTTGAGGTAGG + Intronic
1175527245 20:59643803-59643825 TTCTAAGTGAAAAGGGGGGTGGG + Intronic
1176064568 20:63187936-63187958 TTCCAAGTGAATTTAGGGATGGG + Intergenic
1176969955 21:15253670-15253692 TTGTAAGTGAAAGAGGAGGTAGG + Intergenic
1178368448 21:32007233-32007255 ATCTAAGGGAACTTGGAGGTGGG + Intronic
1178860470 21:36285008-36285030 TGCTAACTGAAAATGGAGGTAGG + Intronic
1184328107 22:43807004-43807026 ATCAAAGTGAAAATTGAGGTAGG - Intronic
949237271 3:1824671-1824693 ATCTAGCTGAAATTAGAAGTAGG - Intergenic
949687899 3:6599086-6599108 TGCTAAGTGGAAGTAGAGGATGG + Intergenic
949792260 3:7805845-7805867 TTTTAATTGAAATTTGAAGTAGG + Intergenic
950225800 3:11233611-11233633 TTCTAAGTGAAGGGAGAGGCTGG - Intronic
950608918 3:14112257-14112279 TTCTAAGTGAAGGGAGAGGCTGG - Exonic
951187767 3:19734170-19734192 TAGTGAGTGAAATTATAGGTTGG + Intergenic
951503076 3:23412483-23412505 CTCTTTGTGAAGTTAGAGGTAGG + Intronic
953481818 3:43258451-43258473 TACTAAGGGAACTCAGAGGTCGG - Intergenic
954044002 3:47913764-47913786 TTCTAAGTGAAATAAGTCATGGG + Intronic
954776202 3:53020758-53020780 TACTAAGTAAAAGTAGAGGCCGG + Intronic
955887900 3:63619889-63619911 TCCTAAGTGAACTTATAAGTGGG - Intergenic
956412836 3:68996310-68996332 TTATCAGTGAAATTAAGGGTCGG + Intronic
956452430 3:69387411-69387433 TTCTAAGGGAAAATGGAGGCTGG - Intronic
957479116 3:80769049-80769071 TTATATTTGAAATTAGAGATTGG + Intergenic
958863865 3:99477525-99477547 TTGTGTGTGAAATTATAGGTTGG + Intergenic
959882512 3:111460972-111460994 TTCTCAGTGAAATAATAGATGGG + Intronic
961725987 3:128930839-128930861 ATCTAAGTGCATTAAGAGGTAGG + Intronic
963055647 3:141184445-141184467 TGCTATGTGATTTTAGAGGTTGG - Intergenic
964069818 3:152618104-152618126 TTTTAAGTAAAATTATAGTTTGG + Intergenic
965684653 3:171289334-171289356 TTCTAAGTTAAATTGGAGTTTGG + Intronic
966040939 3:175487052-175487074 CTCTAAGTGAAATGAGAGAAAGG - Intronic
967155839 3:186691677-186691699 TTCTAAGAGAAGTTAGACATTGG - Intergenic
968034010 3:195530007-195530029 GTATATGTGAAAATAGAGGTTGG - Intronic
970716924 4:18937183-18937205 TTCAAAGAGGAATTAGAGCTAGG - Intergenic
971046651 4:22812431-22812453 TTGAAAGTGGAATTTGAGGTTGG - Intergenic
972249531 4:37285004-37285026 TTCTATGTGTAAGTACAGGTAGG + Intronic
972276564 4:37563551-37563573 TTGTGAGTGTAATTAGAGATAGG - Intronic
972801829 4:42483818-42483840 TTCTAAGTCAAATCACAGTTTGG - Intronic
972862822 4:43191869-43191891 TACTAAATGAAATTATAGGCGGG + Intergenic
973828046 4:54729096-54729118 TTCTAAGTGACATTAGTATTTGG - Intronic
974366454 4:60955821-60955843 CTGTAAGTGAATTCAGAGGTAGG + Intergenic
977969980 4:103201787-103201809 TTCTGAGAGAAATCAGAGGGTGG - Intergenic
978521245 4:109618011-109618033 TTACAAATGAAATCAGAGGTGGG - Intronic
978866452 4:113518389-113518411 TTAAAAGTGAAATTAGATTTTGG - Intronic
979188499 4:117829299-117829321 ATCAAAGTGAATTAAGAGGTAGG + Intergenic
979847429 4:125533732-125533754 TTGTAATTCAAATTAGATGTAGG + Intergenic
981042018 4:140231979-140232001 ATCTAAGTGAAGATAGAGATAGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
984002104 4:174261284-174261306 TTCTATTTGAAATTAAAGGCTGG - Intronic
985077575 4:186231709-186231731 CTGTAAGGGAAATTAGAGGCAGG - Intronic
987526402 5:19056086-19056108 TTCTAAGTTAAATTATATTTTGG + Intergenic
988654899 5:33199693-33199715 CTTTAAGTGAAATGATAGGTAGG - Intergenic
989636492 5:43541446-43541468 TTAAAAGTGAAATGATAGGTGGG - Intronic
990388984 5:55299370-55299392 TGCTAAGTGAAAAGGGAGGTGGG + Intronic
990517274 5:56541973-56541995 TTCAATGTGAACTTATAGGTTGG + Intronic
990685683 5:58298203-58298225 TTCTAAATGAAAGAAGAGGGAGG + Intergenic
991682408 5:69152176-69152198 TTCTAAGTGAAGTAAGAGAATGG - Intergenic
992620638 5:78589168-78589190 TTCTAAAAAAAATTAGAAGTTGG + Intronic
996600478 5:125257014-125257036 TTCTATGTGAATTTAAGGGTGGG + Intergenic
996934061 5:128927826-128927848 TTCTAAGTGGAAGTGGGGGTTGG - Intronic
998667405 5:144314123-144314145 TTCTAAGTGAAATGAAAGTGAGG - Intronic
1001008602 5:168076791-168076813 TTCTAAGTGAAACCAGATGTTGG + Intronic
1004612586 6:17258209-17258231 TTCTATGTGAAATTACTTGTTGG + Intergenic
1006428091 6:33978660-33978682 CTCTAAATGAGATTAGACGTGGG + Intergenic
1008623918 6:53299389-53299411 TTCAAAGTGAAAATACAGATTGG + Intronic
1008828545 6:55729879-55729901 CTCTAAGAGAAATCAGTGGTTGG - Intergenic
1009932736 6:70195356-70195378 CCCTAAGTGAAACTCGAGGTTGG - Intronic
1011016546 6:82762613-82762635 TGGGAAGTGGAATTAGAGGTAGG + Intergenic
1012957460 6:105586723-105586745 TTTTAAGTGAAAAGACAGGTGGG - Intergenic
1015365752 6:132395655-132395677 TACTAACTGAAATTAAAGGATGG + Intronic
1015931059 6:138360193-138360215 TTCTAAGAGAAAAGAGAGATTGG + Intergenic
1016307659 6:142700377-142700399 TTATGAGTGAAATTTGGGGTGGG + Intergenic
1016488151 6:144566220-144566242 TTGTCAGTGAAGTTGGAGGTAGG + Intronic
1016802382 6:148179829-148179851 TTTGAAGTGAAGTTTGAGGTAGG + Intergenic
1016922083 6:149306028-149306050 TTCTAAGAGAAATAAGATGAAGG + Intronic
1018373567 6:163190384-163190406 TTGAAAGTGAAAATAGAGGTCGG + Intronic
1018397926 6:163394517-163394539 CTCTGACTAAAATTAGAGGTTGG - Intergenic
1018718086 6:166550705-166550727 TTTAAAGTGAAATTAGGGTTGGG + Intronic
1018747569 6:166774350-166774372 TTCTCAGTGAAATTAGTGCATGG + Intronic
1020840833 7:13215633-13215655 TTATAAGTGACATTAGAGAGTGG + Intergenic
1021893807 7:25214426-25214448 TTCTAACAAAATTTAGAGGTAGG + Intergenic
1022659744 7:32355619-32355641 TGCTAAGGGAACTTAGAGGAGGG - Intergenic
1022976510 7:35562582-35562604 TTATAAGTGAAAATGGATGTTGG - Intergenic
1024591194 7:50886378-50886400 ATTTAAGTGTAATTAGATGTTGG + Intergenic
1028193087 7:87875316-87875338 TGCTAAGGGAAATGAGAGTTTGG - Intronic
1028336504 7:89663720-89663742 TTCTCAGTAAGATAAGAGGTAGG - Intergenic
1028953050 7:96658126-96658148 TCCCAAGTGAAATTAGAGGATGG + Intronic
1029150080 7:98474059-98474081 TTCTATCTAAAATTAGAAGTTGG + Intergenic
1031370725 7:120962194-120962216 TACTAAATCAAATTAGAAGTTGG - Intronic
1031795481 7:126168958-126168980 TACTAAGTGAACTCAGAGGCTGG + Intergenic
1034145264 7:148865321-148865343 GTGTAAGTTAAATTAGATGTTGG - Intronic
1034825025 7:154254360-154254382 TAGTAGGTGTAATTAGAGGTAGG + Intronic
1035147638 7:156835865-156835887 TTCTAAGTGAAATTAGAGGTTGG - Intronic
1037864140 8:22429592-22429614 TTATAAATGAAATTAAAGGTTGG - Intronic
1040972897 8:53156618-53156640 TTCCAAGCAGAATTAGAGGTTGG - Intergenic
1041132299 8:54714220-54714242 TTCTAAGTTAAACTACAGGCTGG - Intergenic
1041835922 8:62215213-62215235 TTGTAAGAGAAATTACACGTTGG - Intergenic
1042321315 8:67478462-67478484 TTGTAACTGACATTTGAGGTTGG + Intronic
1042777188 8:72445778-72445800 TTATCATTGAAATCAGAGGTAGG + Intergenic
1042922090 8:73930006-73930028 TTCTATATGGTATTAGAGGTTGG - Intergenic
1043273847 8:78368493-78368515 TTCTCTGTGAAATAAGAGTTTGG - Intergenic
1043282873 8:78490085-78490107 TTCTAAATGATATTAGAAGATGG - Intergenic
1044044085 8:87408642-87408664 TTTTAAAACAAATTAGAGGTTGG + Intronic
1044642967 8:94404574-94404596 TTCCAACTGAAAGTACAGGTTGG + Intronic
1045226761 8:100254925-100254947 TGCTATGAAAAATTAGAGGTGGG - Intronic
1045789760 8:105968919-105968941 TTCTAGGTGAAATTAACAGTAGG + Intergenic
1047534076 8:125703349-125703371 TTCTATGTGAAATGAGAAGCTGG + Intergenic
1050126763 9:2364226-2364248 GTCTAAGTGAAAATAGAACTTGG + Intergenic
1050681372 9:8115622-8115644 TTCAAAGTGATCTCAGAGGTAGG - Intergenic
1050740748 9:8817328-8817350 TTCTAAATAAAATTAAAGATAGG - Intronic
1051593400 9:18799119-18799141 AGCTAAGTGAATTTAGAGGGAGG - Intronic
1051735528 9:20194465-20194487 TTCTAAATTAATTTATAGGTTGG + Intergenic
1051977604 9:22970873-22970895 TTTTCAGTGACATCAGAGGTGGG - Intergenic
1052757988 9:32561207-32561229 TTCTAAGAGGAATTAGAGTTGGG - Intronic
1055237767 9:74144420-74144442 ATCTAAGTGAAAGTAAAGATGGG - Intergenic
1057014801 9:91642285-91642307 TTCAAAGTTAAAGTAGTGGTTGG + Intronic
1061534170 9:131237372-131237394 TTCTAAGAGAAATTACAAATGGG - Intergenic
1186752115 X:12631979-12632001 TTTAATGTGAAATTAGAGGTTGG - Intronic
1186979191 X:14940753-14940775 TTCCAAGTGACATTACAGGTAGG - Intergenic
1187424903 X:19168459-19168481 ATCTTAGTGAAAATAGAAGTTGG - Intergenic
1188926055 X:36045181-36045203 TTCTATGTGATATTAGCTGTTGG + Intronic
1189588075 X:42481647-42481669 CTCTAAGTCAAATTATTGGTAGG - Intergenic
1190997554 X:55624778-55624800 TGTTAAGTAAAGTTAGAGGTGGG + Exonic
1194928677 X:99861222-99861244 TTTTAAGACAAATTAGAGGAGGG + Intergenic
1195130290 X:101844334-101844356 TTAGAAGTGAAATTAAATGTGGG + Intronic
1195175987 X:102315939-102315961 TTAGAAGTGAAATTAAATGTGGG - Intronic
1195182877 X:102371154-102371176 TTAGAAGTGAAATTAAATGTGGG + Intronic
1196253882 X:113493275-113493297 TTCCAATGGAAATTAGAGTTGGG + Intergenic
1197265274 X:124362606-124362628 ATCTAAATAAAATTAGATGTGGG - Intronic
1198113868 X:133526214-133526236 TTCTAAGTGAAATGAGCCCTAGG + Intergenic
1198174609 X:134143043-134143065 TTCTAAGTTAAGTTGGAGTTTGG - Intergenic
1198754936 X:139972729-139972751 TTCTAAGTCAGGTCAGAGGTTGG + Intergenic
1198810341 X:140529762-140529784 TGCTAATTGAAATTTGAGCTGGG + Intergenic
1198816970 X:140601809-140601831 TTCTGAGTTAAATCATAGGTGGG + Intergenic
1199490008 X:148387598-148387620 CTTTAAGTGAAAACAGAGGTAGG - Intergenic
1201361292 Y:13152767-13152789 TTCTAAATTAAATTATAGATTGG + Intergenic