ID: 1035148640

View in Genome Browser
Species Human (GRCh38)
Location 7:156846612-156846634
Sequence CTGAATGTATAGATGAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1100
Summary {0: 1, 1: 2, 2: 25, 3: 194, 4: 878}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035148640 Original CRISPR CTGAATGTATAGATGAAGTT GGG (reversed) Intronic
900296322 1:1952984-1953006 TTGAATCTATAGATCAATTTGGG - Intronic
900811906 1:4809818-4809840 TTGAATCTATAGATCAAGTTGGG - Intergenic
901155218 1:7132216-7132238 TTGAATGTATAGGTGAATTTGGG + Intronic
902903930 1:19540353-19540375 TTGAATCCATAGATCAAGTTGGG + Intergenic
903150959 1:21408418-21408440 TTGAATCTATAGATCAATTTGGG + Intergenic
903185760 1:21628112-21628134 CTGAATGAATGAATGAAGGTTGG + Intronic
903644169 1:24882350-24882372 CTGAATCTATAGATCAGGTTGGG + Intergenic
904217874 1:28938269-28938291 CTGAATCTGTAGATTAATTTGGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904958823 1:34314033-34314055 TTGAATCTATAGATCAAATTGGG + Intergenic
904985295 1:34542314-34542336 TTGAATCTATAGATTAAGTTGGG - Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
905558102 1:38903650-38903672 TTGAATCTATAGATCAACTTGGG - Intronic
905840451 1:41172508-41172530 TTGAATCTATAGATGACTTTTGG - Intronic
905963893 1:42072231-42072253 TTGAATCTATAGATCAAATTGGG + Intergenic
906731723 1:48088081-48088103 ATGAATGTATAGATCAATTTGGG + Intergenic
906951609 1:50339054-50339076 TTGAATCTATAGATCAAGTTAGG + Intergenic
907102413 1:51849054-51849076 TTGAATTTATAGATTAATTTGGG - Intronic
907282201 1:53357447-53357469 CTAAATGTATACATTAATTTAGG + Intergenic
907327296 1:53647148-53647170 CTGAATCTCTAGATAAATTTGGG - Intronic
907887650 1:58608115-58608137 CTGATTGTATAAATGAACATTGG - Intergenic
907963075 1:59301034-59301056 TTGAATGTATACATTAATTTGGG + Intronic
908012693 1:59797333-59797355 CTGAATCTGTAGATCAATTTGGG + Intergenic
908272231 1:62433202-62433224 CTAAAGGTATAGAAGAAGTGTGG - Intergenic
908793613 1:67808866-67808888 CTGAATCTATAGGTCAAGTTAGG - Intronic
909098280 1:71317252-71317274 TTGAATCTATAGATCAAGCTGGG - Intergenic
909174616 1:72340586-72340608 TTGAATGTGTAGATAAATTTGGG + Intergenic
909179261 1:72400342-72400364 TTGAATCTATAGATCAAGCTGGG + Intergenic
909387163 1:75071141-75071163 TTTAATGTATAGATCAAATTAGG - Intergenic
909887013 1:80954525-80954547 CTGAATCTACAGATCAATTTGGG - Intergenic
910372668 1:86533652-86533674 TTGAATCTATACATCAAGTTGGG + Intergenic
910412321 1:86959867-86959889 CTGAATCTATAGATCACGTTGGG - Intronic
910513436 1:88032777-88032799 TTGAATTTATAGATTAATTTAGG - Intergenic
910628116 1:89330008-89330030 CTGAATGTATAAATTACCTTGGG - Intergenic
910679494 1:89847890-89847912 CTGCATGTATATATGAGGTAGGG + Intronic
910768238 1:90804038-90804060 ATGAATTTATAGATCATGTTGGG + Intergenic
910816484 1:91296592-91296614 CTGAATATAAAGATTAATTTGGG + Intronic
911250068 1:95565559-95565581 TTGAATCTATAGATCAATTTGGG + Intergenic
911425731 1:97708704-97708726 CTGAATCTATAGATCTAATTGGG + Intronic
911800598 1:102133179-102133201 CTGAATCTATAAATTAATTTGGG - Intergenic
911970218 1:104425399-104425421 TTGAATCTATAGATAAATTTTGG - Intergenic
912083334 1:105967145-105967167 TTGAATTTATAGATTAATTTTGG + Intergenic
912325586 1:108757144-108757166 TTGTATGTATATATGAAGATGGG + Intronic
913028134 1:114867320-114867342 TTGAATCTGTAGATCAAGTTGGG + Intronic
913348818 1:117835155-117835177 CAGAAAGTATACATTAAGTTGGG + Intergenic
913423572 1:118701000-118701022 CTGAATCTATAGATTACTTTGGG + Intergenic
913664953 1:121039062-121039084 TTGAATCTTTAGATCAAGTTGGG - Intergenic
914016344 1:143822333-143822355 TTGAATCTTTAGATCAAGTTGGG - Intergenic
914161440 1:145138666-145138688 TTGAATCTTTAGATCAAGTTGGG + Intergenic
914325191 1:146607133-146607155 TTAAATCTATAGATGAATTTGGG - Intergenic
914511914 1:148340827-148340849 TTGAATTTATAGATCAAATTAGG + Intergenic
914654961 1:149730875-149730897 TTGAATCTTTAGATCAAGTTGGG - Intergenic
915088169 1:153402695-153402717 CTGAATCTATAGGTTACGTTTGG - Intergenic
915707343 1:157858010-157858032 CTAAATCTATAGATCAATTTAGG - Intronic
916145881 1:161739034-161739056 CTGAAGGTATAGAAGCAGGTGGG + Intergenic
916565300 1:165970765-165970787 CTGACTGCATAGATTAATTTTGG + Intergenic
916775635 1:167960909-167960931 TTGAATCTATAGAACAAGTTGGG + Intronic
916879863 1:169010085-169010107 CTGCATGGATAGAAGAAGTGTGG + Intergenic
917008332 1:170441407-170441429 TTGAATCTATAGATCAATTTGGG - Intergenic
917060135 1:171028594-171028616 CTGAATCTATAAATTAACTTGGG + Intronic
917129330 1:171724645-171724667 TTGAACCTATAGATGAATTTGGG - Intronic
917157129 1:172015334-172015356 TTGAATCTATAGATTAAGTTGGG + Intronic
917344684 1:174017166-174017188 CTTAATGTATAGAAGAAACTAGG - Intronic
917568572 1:176237710-176237732 CTGAATCTATAGATCATGTTAGG + Intergenic
917986180 1:180321357-180321379 CTGAATTTATAGATTACTTTGGG + Intronic
918090041 1:181282700-181282722 TTGAATCTACAGATCAAGTTGGG + Intergenic
918227713 1:182500574-182500596 CTGAATCTATAGATCATTTTGGG + Intronic
918274127 1:182935245-182935267 CTGGATCTACAGATCAAGTTGGG + Intronic
918539895 1:185619727-185619749 ATGAATCTATAGATCAAGTTGGG + Intergenic
918539921 1:185620413-185620435 TTGACTCTATAGATCAAGTTGGG - Intergenic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
918665658 1:187147259-187147281 TTGAATCTATAGATCAAGTTGGG + Intergenic
918719423 1:187834314-187834336 ACGAATTTATAAATGAAGTTGGG - Intergenic
919004197 1:191873416-191873438 CTGAATCTATAGACCAATTTTGG - Intergenic
919329362 1:196149845-196149867 CTGAATCTATAGATTATTTTGGG - Intergenic
919717051 1:200789725-200789747 TTGAATCTGTAGATCAAGTTGGG + Intronic
919935096 1:202245971-202245993 ATGAATGGATAGATGAAGGGAGG - Intronic
919935125 1:202246062-202246084 ATGAATGGATAGATGAAGGGAGG - Intronic
919935245 1:202246393-202246415 ATGAATGGATAGATGAAGGGAGG - Intronic
920836823 1:209518853-209518875 CTGAAAGTATAGAAGCAGCTTGG + Intergenic
920926941 1:210350342-210350364 TTGAATCTATAGATTAAGTTGGG + Intronic
921093289 1:211863545-211863567 TTGAATCTACAGATCAAGTTGGG + Intergenic
921200097 1:212796394-212796416 CTGATTGTATTGATGAAGCATGG + Intronic
921605501 1:217149010-217149032 ATAAATCTATAGATCAAGTTGGG - Intergenic
922181444 1:223236917-223236939 TTGAATCTATAGAGCAAGTTGGG + Intronic
922631438 1:227117295-227117317 CTGAATTTATAGGTCAATTTAGG - Intronic
922656021 1:227384206-227384228 TTGAATTTATAGATCAAGTTAGG - Intergenic
923059840 1:230461338-230461360 TTGAATCTATAGATCAAGTTAGG - Intergenic
923420083 1:233804790-233804812 TTAAATCTATAGATCAAGTTGGG - Intergenic
923429043 1:233903278-233903300 TTGAATCTATAGATGAAGTTGGG + Intergenic
923619071 1:235562721-235562743 TTGAATCTACAGATCAAGTTGGG + Intronic
923775322 1:236973054-236973076 AGGAATCTATAGATGAAGCTGGG - Intergenic
924214257 1:241804231-241804253 TTGAATTTTTAGATCAAGTTGGG - Intergenic
924377106 1:243422627-243422649 TTGCATGTTTAGATGATGTTAGG + Intronic
924398174 1:243647015-243647037 TTAAATCTATAGATGAATTTTGG + Intronic
924485918 1:244484254-244484276 TTGAATGTATAAATCAAGTTGGG - Intronic
924862013 1:247935316-247935338 CTGTATGTATAAATGAAATAAGG - Intergenic
1063061279 10:2556151-2556173 ATGAATCTATATATTAAGTTGGG + Intergenic
1063132669 10:3192210-3192232 GTGAATTTATAGATGGAATTTGG + Intergenic
1063297648 10:4823553-4823575 CTGAATGTTTAGATCAGTTTGGG - Intronic
1063350914 10:5354173-5354195 CTGAATAGATTGGTGAAGTTAGG - Intergenic
1063740444 10:8812648-8812670 CTGAATCTATAGATTAATCTCGG - Intergenic
1063895191 10:10672862-10672884 TTGAATTTGTAGATCAAGTTGGG + Intergenic
1063976475 10:11421572-11421594 TTGAATCTATAGACCAAGTTAGG - Intergenic
1064634664 10:17351665-17351687 CTGAATGCATAAATGAAATGTGG + Intronic
1064838110 10:19557838-19557860 TTGAATCTATAAATTAAGTTGGG + Intronic
1065270126 10:24021520-24021542 CTGAATCTGTAGATAAAATTGGG - Intronic
1065277703 10:24102464-24102486 TTGAATCTATACATCAAGTTGGG - Intronic
1065327738 10:24564684-24564706 TTGAATCTATAGATGAGTTTGGG + Intergenic
1065365531 10:24932708-24932730 TTGAATCTATAGATCAATTTGGG - Intronic
1065394738 10:25222397-25222419 GGGAATGTATTGATGAAGTGGGG - Intronic
1065592096 10:27273681-27273703 TTGAATTTATAGACGAATTTAGG + Intergenic
1065658264 10:27976670-27976692 TTGAATTTATAGACGAATTTAGG - Intronic
1065941700 10:30570384-30570406 TTGAGTCTATAGATCAAGTTGGG + Intergenic
1065954441 10:30680723-30680745 TTGAATTTATAGATCGAGTTGGG + Intergenic
1066043147 10:31572204-31572226 CTAACTCTATAGATAAAGTTGGG - Intergenic
1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG + Intergenic
1067941893 10:50663582-50663604 CTGTATGGATATATGAAGTGGGG + Intergenic
1068776056 10:60869590-60869612 ATGGATGTATAAATGAACTTGGG - Exonic
1069022891 10:63508547-63508569 TTGAATCTATAGATCAAGTTGGG + Intergenic
1069154287 10:65006192-65006214 CTGAATCTATAGATCAAGTTGGG + Intergenic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1070863136 10:79688533-79688555 CTGTATGGATATATGAAGTGGGG + Intergenic
1070945203 10:80385177-80385199 TTGAATCTATAGTTCAAGTTGGG + Intergenic
1071036638 10:81255312-81255334 CTGAATCTGTAGATCAATTTGGG + Intergenic
1071081018 10:81811284-81811306 TTGAATCTATTGATCAAGTTGGG - Intergenic
1071498305 10:86185049-86185071 TTGAATCTATAGATTAATTTGGG + Intronic
1072038574 10:91586553-91586575 CTGAGTGGATGGATGAAGTCTGG - Intergenic
1072123778 10:92427842-92427864 TTGAGTCTATAGATCAAGTTGGG - Intergenic
1072173362 10:92890037-92890059 TTGAATCTATAGATGAAGTTGGG + Intronic
1072174543 10:92905342-92905364 TTGAATCTGTAGATCAAGTTGGG + Intronic
1072469957 10:95704220-95704242 ATGAATCTATACATGAATTTGGG - Intergenic
1072828402 10:98631877-98631899 CTGAATGGATGAATGAAGTAAGG - Intronic
1073378876 10:103062606-103062628 CTCAATGTGTAGATGATATTTGG + Intronic
1073693389 10:105836404-105836426 CAGTGTGTATAGATGAATTTTGG + Intergenic
1073957099 10:108885171-108885193 CTGAATCTATAGATCACTTTGGG - Intergenic
1074463267 10:113658411-113658433 TTGAATGTATAGATTAATTGGGG + Intronic
1074918036 10:117977529-117977551 CTTAATCTGTAGATAAAGTTTGG - Intergenic
1075488030 10:122842675-122842697 CTGAATTTATAGATCAACCTGGG + Intronic
1075501210 10:122976353-122976375 TTGAATCTATAGATCAAGTTGGG - Intronic
1076020998 10:127073228-127073250 GTGAATCTGTAGATCAAGTTGGG - Intronic
1076159333 10:128230685-128230707 TTAAATCTGTAGATGAAGTTGGG + Intergenic
1076352612 10:129828253-129828275 CTGAATCTGTAGATCAATTTTGG + Intergenic
1076633076 10:131864037-131864059 TTGAACCTATAGATCAAGTTGGG - Intergenic
1076635264 10:131877851-131877873 TTGAATCTATAGAGGAAGTCAGG - Intergenic
1076669950 10:132114666-132114688 TTGAATCTATAGATCAATTTGGG + Intronic
1076775598 10:132696258-132696280 TTGAATCTATAGCTGAAGTTGGG - Intronic
1077290810 11:1791105-1791127 TCGAATCTACAGATGAAGTTGGG + Intergenic
1077901205 11:6490472-6490494 GTGAATATATAGATGAATGTGGG - Intronic
1077951898 11:6968352-6968374 CTGAATATATAAATTACGTTGGG + Intronic
1078554134 11:12304985-12305007 TTGAATCTATAGATAAATTTGGG + Intronic
1078612431 11:12832437-12832459 AAGAATGTATAGATTAAATTTGG - Intronic
1078881604 11:15454835-15454857 TTGAATCTATAGATCAATTTGGG + Intergenic
1078968875 11:16382167-16382189 CTGAATGTTTTGATGATGGTTGG - Intronic
1079019651 11:16899000-16899022 TTGAATATATAGATTAATTTAGG - Intronic
1079072644 11:17361256-17361278 TTGAATCTAGAGATCAAGTTGGG + Intronic
1079107782 11:17583878-17583900 TTGAATTTATAGATCAATTTGGG + Intronic
1079564300 11:21862865-21862887 TTGAATCTATAAATCAAGTTGGG + Intergenic
1080209297 11:29767238-29767260 CTGAATCTATAAATTACGTTGGG + Intergenic
1080273537 11:30476814-30476836 CTGAATCTACAGATCAATTTAGG + Intronic
1080533824 11:33202285-33202307 CTGAATCTATAAATGAGGTTGGG + Intergenic
1080900592 11:36486723-36486745 CTGAATGTTGATTTGAAGTTTGG - Intergenic
1081221132 11:40463579-40463601 CTCAATGTAAAAAAGAAGTTTGG + Intronic
1081839761 11:46190584-46190606 CTGAATCTATAAATCAAGTTGGG - Intergenic
1082130232 11:48479776-48479798 ATGAATGCATAGATTAAGTTGGG + Intergenic
1082246878 11:49933888-49933910 ATGAATGTATAGATAAAGTTGGG - Intergenic
1082563753 11:54650689-54650711 ATGAATGCATAGATTAAGTTGGG + Intergenic
1083018683 11:59483534-59483556 TTGATTGTATAGATTAATTTGGG - Intergenic
1083494388 11:63037884-63037906 CTGAATCTATAAATGACCTTGGG + Intergenic
1083608761 11:63994960-63994982 CTGAATGTGTATATGCTGTTGGG + Intronic
1083916838 11:65751698-65751720 TTGAATCTATAGACCAAGTTAGG + Intergenic
1084015493 11:66377787-66377809 CTTAATCTATAGATCAAGTTGGG + Intergenic
1084339409 11:68484953-68484975 TTGAATCTGTAGATCAAGTTAGG + Intronic
1084697891 11:70767136-70767158 CTGGCTGTAGAGATGATGTTAGG + Intronic
1084999881 11:73022664-73022686 TTGAATGTATAGATCATATTGGG - Intronic
1085568382 11:77537042-77537064 CTGAATGTGTAGATCACTTTGGG - Intronic
1085654768 11:78303732-78303754 CTGAATCTATTGATCAATTTAGG + Intronic
1085837166 11:79969383-79969405 TTGAATGTATAGATCACTTTGGG - Intergenic
1085928222 11:81047993-81048015 GTGTATATATATATGAAGTTTGG - Intergenic
1085938617 11:81180921-81180943 TTGAACCTATAGATCAAGTTTGG + Intergenic
1086000651 11:81980962-81980984 TTGAATCTATAGATCAACTTTGG + Intergenic
1086037064 11:82428929-82428951 TTGAATTTATAAATAAAGTTGGG - Intergenic
1086808271 11:91270728-91270750 CCAAATGTGTAGATGAAATTAGG - Intergenic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1087399278 11:97644137-97644159 CTGAATCTCTAAATGAATTTGGG - Intergenic
1087623607 11:100570220-100570242 ATGAATTTATAAATGAAGCTTGG - Intergenic
1087637882 11:100723345-100723367 TTCAATCTATAGATCAAGTTGGG + Intronic
1088208984 11:107431480-107431502 CTAAATGTATAGATAAATTAAGG - Intronic
1088288786 11:108213579-108213601 TTGAATGTATCGGTGAATTTTGG - Intronic
1088370110 11:109079647-109079669 CTGAATCTATAAATTAACTTGGG + Intergenic
1088710343 11:112502390-112502412 TTGAATCTATAGATCAAATTGGG + Intergenic
1088838489 11:113601919-113601941 CTGAATTTATAGATGTACTCAGG - Intergenic
1088960624 11:114661175-114661197 TTGAATCTATAGATCAATTTTGG - Intergenic
1088995473 11:114992320-114992342 GCGAATGTATAGATTAAATTTGG + Intergenic
1089107047 11:116019583-116019605 TTGAATCTATAGATTAATTTAGG + Intergenic
1089172759 11:116526790-116526812 TTGAGTGTATAGATTAATTTGGG - Intergenic
1090113051 11:123937044-123937066 TTGAATCTATAGATCAAATTGGG + Intergenic
1090138852 11:124231125-124231147 TTGAATGTATAGATGAATATGGG + Intergenic
1090143125 11:124287303-124287325 TTGAATTTATAGATCAAATTGGG + Intergenic
1090219660 11:125008092-125008114 GTTAATGTATATATCAAGTTGGG + Intronic
1090754405 11:129776587-129776609 TGGAATCTATAGATCAAGTTGGG - Intergenic
1090841476 11:130492062-130492084 CTGGATCTATAGATCAAGTTAGG + Intergenic
1091454318 12:594753-594775 TTGAATCTATAGATCAAGTTAGG - Intronic
1091949130 12:4577695-4577717 TTGAATCTACAGATTAAGTTGGG + Intronic
1092058547 12:5527174-5527196 ATGAATTTATAGATTATGTTGGG + Intergenic
1092327642 12:7550187-7550209 ATGAATGTATAAATGAACTCGGG + Intergenic
1093109965 12:15139388-15139410 TTGAATCTATAGGTTAAGTTGGG + Intronic
1093298550 12:17422955-17422977 TTGAATTTATAGATCAAGGTGGG + Intergenic
1093343203 12:18005433-18005455 TTGAATCTATAGATCAAGCTGGG - Intergenic
1093488198 12:19675793-19675815 CTGAATTTATAGATCAATTTGGG + Intronic
1093759088 12:22886124-22886146 TTGAATCTATAGATCAAGTTGGG + Intergenic
1094124519 12:27009320-27009342 CTGAATATATACATTAATTTAGG + Intronic
1094145404 12:27223249-27223271 TTAAATCTATAGATCAAGTTGGG - Intergenic
1094252220 12:28376069-28376091 CTGAATCTGTAGATGTAGGTAGG + Intronic
1094758661 12:33501920-33501942 CTGAATCTATAGATCACTTTGGG + Intergenic
1095222526 12:39633998-39634020 CTGAATGTATAAATTACTTTGGG + Intronic
1095239019 12:39834830-39834852 CTAAATGTCAAGTTGAAGTTGGG - Intronic
1095736509 12:45562399-45562421 CTGAATGGATAAATGAATTGTGG - Intergenic
1095833708 12:46614622-46614644 TTGAATCTATAGATGAATTTAGG - Intergenic
1095835540 12:46634540-46634562 TTGAATCTGTAGATCAAGTTGGG + Intergenic
1096288311 12:50319404-50319426 TTGAATTTATAGATTAATTTGGG + Intergenic
1096379483 12:51143966-51143988 TTGAACCTATAGATGAATTTGGG - Intronic
1096568567 12:52502683-52502705 TTGAATCTGTAGATCAAGTTGGG + Intergenic
1096932709 12:55231930-55231952 TTGAATCTATAGATAAAGTTGGG - Intergenic
1097778682 12:63678012-63678034 TTGAATATATAGATCAAGTTGGG + Intergenic
1098132456 12:67364675-67364697 CTGTCTCTTTAGATGAAGTTAGG - Intergenic
1098242831 12:68485933-68485955 CTGGATATATAGATCAATTTAGG - Intergenic
1098906229 12:76165443-76165465 CTGAATGTATAAATTACTTTGGG + Intergenic
1098982165 12:76968328-76968350 CTGAATATATAAATGAATGTAGG + Intergenic
1099821406 12:87715693-87715715 CTGAATGTAAAGATTACTTTGGG - Intergenic
1099950775 12:89300610-89300632 CTGACTATATAGATTAATTTGGG - Intergenic
1100298376 12:93284207-93284229 TTGAATCTATAGATCAATTTAGG - Intergenic
1100879725 12:99003397-99003419 CTGAATCTATAGATTACTTTCGG + Intronic
1100894586 12:99166684-99166706 TTGAATGTATAGATATATTTGGG - Intronic
1101142211 12:101808187-101808209 TTGAATCTGTAGATGAAGTTGGG - Intronic
1101279157 12:103233390-103233412 CTGAATCTATAGATCAAGTTGGG + Intergenic
1101525748 12:105528024-105528046 TTGAATTTATAGATCAATTTTGG + Intergenic
1102203168 12:111072181-111072203 CTGAGTCTATAGATCAAGTTGGG + Intronic
1102319833 12:111923009-111923031 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1103653385 12:122451171-122451193 CTGAATGTATATATATGGTTAGG - Intergenic
1104711005 12:130986216-130986238 TTGAATATATAGATCAATTTGGG + Intronic
1105614892 13:22002669-22002691 CTGAAGGTGGAGCTGAAGTTGGG + Intergenic
1105654156 13:22417026-22417048 TTGAATCTATTGATGAGGTTGGG - Intergenic
1105832860 13:24180557-24180579 CTGAATCTGTAGCTGAATTTGGG + Intronic
1106150143 13:27092291-27092313 CTGAACCTATAGATGAAGTTGGG - Intronic
1106556650 13:30815033-30815055 TTGACTCTATAGATGAAGCTGGG + Intergenic
1106771644 13:32966834-32966856 TTGAATCTATAGATCAAGTTGGG + Intergenic
1106897388 13:34318754-34318776 TTGAATGTATAGATTAGTTTGGG + Intergenic
1107177874 13:37420840-37420862 TTGTAGGTATAGGTGAAGTTGGG + Intergenic
1107640864 13:42441754-42441776 CTGATTGTATATGTGATGTTGGG - Intergenic
1107660178 13:42631110-42631132 ATGAATAGAGAGATGAAGTTTGG + Intergenic
1107767542 13:43753235-43753257 TTGAATCTATAGATCAATTTGGG + Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1107847333 13:44529996-44530018 CTGAATCTAAAGATCAAGTTGGG - Intronic
1108342170 13:49508030-49508052 TTGCATTTATAGATGAATTTGGG + Intronic
1108903240 13:55438798-55438820 TTGAATCTATAGATAAATTTGGG - Intergenic
1109087478 13:57993780-57993802 TTAAATCTATAGATTAAGTTGGG + Intergenic
1109111209 13:58320223-58320245 CTGAATGTTTCTATGCAGTTGGG + Intergenic
1109511465 13:63380288-63380310 CTGAATTATTAGATGAAGATTGG + Intergenic
1109608862 13:64737207-64737229 TTGCATGTATAGATGCAATTGGG + Intergenic
1109880401 13:68466301-68466323 CTGAATCTATAGATGGCTTTAGG + Intergenic
1110446463 13:75588228-75588250 CTGAAAGAATATATAAAGTTGGG - Intronic
1110577657 13:77078486-77078508 CTCAAAGTATAGGTGAAGTAAGG + Intronic
1110827015 13:79983202-79983224 CAGAATCTATAGATCAAGTTGGG + Intergenic
1111071872 13:83180033-83180055 TGGAATGTATAGATTAATTTAGG + Intergenic
1111302595 13:86365221-86365243 CTTAATAAAAAGATGAAGTTTGG + Intergenic
1111341129 13:86887859-86887881 TTGAATCTATAGATCAATTTGGG - Intergenic
1111702021 13:91702705-91702727 CTGAATCTATAGATGGCTTTAGG + Intronic
1111787842 13:92813818-92813840 CTGAATGTACAGATTAATTTAGG - Intronic
1112976399 13:105324077-105324099 CAGAAATGATAGATGAAGTTGGG - Intergenic
1113222178 13:108117964-108117986 TTGATTGTATAGATTAATTTGGG + Intergenic
1113658319 13:112085223-112085245 TGGAATCTATAGATGAATTTTGG + Intergenic
1113980696 13:114272541-114272563 CTAAATGTAGAGATGCAGTTTGG - Intronic
1114103162 14:19396036-19396058 CTGAATCTATAAATGACTTTGGG + Intergenic
1114273701 14:21122119-21122141 CTGAATGAATGGATGAATTCTGG - Intergenic
1114505931 14:23213430-23213452 TTGAATCTATAGATCAAATTGGG - Intronic
1114520756 14:23333700-23333722 CTGAATCTGTAGATCAATTTAGG + Intergenic
1114908730 14:27164627-27164649 TTGAATGTATAGATTAAGTTGGG + Intergenic
1115169424 14:30487343-30487365 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115639877 14:35327832-35327854 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115686542 14:35802596-35802618 TTGAATCTATAGATCAATTTGGG - Intronic
1115719170 14:36141301-36141323 TTGAATCTATAGATCAAGTTGGG + Intergenic
1116192963 14:41683871-41683893 CTGAATCTATAGATTACCTTGGG - Intronic
1116356116 14:43933415-43933437 TTGAATCTATAAATCAAGTTTGG - Intergenic
1116665782 14:47773186-47773208 TTGAATTTACAGATCAAGTTTGG - Intergenic
1116692845 14:48132745-48132767 ATGAATGTACAGATCCAGTTTGG - Intergenic
1117607677 14:57447305-57447327 TTGACTCTATAGATCAAGTTTGG + Intergenic
1118270263 14:64336873-64336895 CTGAATGAAGAGAGGAAGTTAGG - Intronic
1118463286 14:66006773-66006795 TTGAATGTAGAGATCAATTTGGG + Intergenic
1118546964 14:66901943-66901965 CTGAATGTCTAGATTACATTGGG + Intronic
1118667651 14:68087277-68087299 CTGAACCTATGGATTAAGTTTGG + Intronic
1118794273 14:69126488-69126510 TTGAATCCATAGATGAAGTTGGG - Intronic
1118840910 14:69510262-69510284 TTGAATCTATAGATCAAGTTGGG + Intronic
1119046008 14:71319948-71319970 CTGAATATATAGTAGAAATTTGG + Intergenic
1119801159 14:77446517-77446539 TTGAATGTACAGATCAATTTTGG - Intronic
1119822394 14:77628720-77628742 CTGAATCTGTAGATCAATTTGGG - Intergenic
1120336242 14:83159109-83159131 CTGAATCTATAGATTAATTTGGG - Intergenic
1120581832 14:86261153-86261175 ATGAATCTATAGATCAAATTTGG + Intergenic
1121036825 14:90712684-90712706 CTGAATCTTTAGATCAATTTGGG - Intronic
1121430872 14:93887397-93887419 TTGAATCTATAGATCAAGTTGGG + Intergenic
1121785004 14:96651187-96651209 TTCAATGTATAGATCAATTTGGG + Intergenic
1122017810 14:98811130-98811152 AAGAATGAATACATGAAGTTAGG + Intergenic
1122381728 14:101312055-101312077 CTGAATCTATAGATCAAATTGGG - Intergenic
1123453463 15:20390735-20390757 TTGAATCTATAGATCAATTTTGG + Intergenic
1123860274 15:24458877-24458899 CTGAAAGTATACATAAAGTGGGG - Intergenic
1123969835 15:25497220-25497242 ATGAATCTATGGATCAAGTTGGG - Intergenic
1124078141 15:26465729-26465751 CTGACCTTATAGAAGAAGTTAGG - Intergenic
1124114027 15:26822625-26822647 TTGAATCTATAGATTAATTTAGG - Intronic
1124599624 15:31122752-31122774 TTGCATCTATAGATCAAGTTGGG - Intronic
1124713746 15:32037481-32037503 TTGAATCTGTAGATCAAGTTGGG + Intronic
1124968044 15:34453922-34453944 CTGAATTTATAAATGAATTTTGG + Intergenic
1126084478 15:44999042-44999064 TTGAAGGTCTAGATGAAATTTGG - Intergenic
1126658625 15:51008800-51008822 TTGAATCTAAAGATCAAGTTGGG + Intergenic
1126863405 15:52910422-52910444 CTTAATCTATAGATCGAGTTGGG - Intergenic
1127697670 15:61467701-61467723 TTGAATGTATAGATCAATTTGGG - Intergenic
1128339918 15:66814282-66814304 TTGAATCTATAGAACAAGTTGGG - Intergenic
1128406689 15:67348690-67348712 TTGAATTTATAGATCAATTTGGG - Intronic
1128421719 15:67497932-67497954 TTGAATCTATAGATCAATTTGGG - Intronic
1128967687 15:72076668-72076690 TTGAATCTATAGATGAGTTTTGG - Intronic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1132364863 15:101250231-101250253 CTTACTGTATGGATAAAGTTTGG - Intronic
1132422311 15:101681343-101681365 CTGACTTTATAGATCAACTTGGG + Intronic
1133580540 16:7140550-7140572 ATGAATGCATTGATGAATTTGGG + Intronic
1133645170 16:7757265-7757287 CTGAATGGATAAATGAAATGTGG + Intergenic
1133863626 16:9620577-9620599 TTGAATCTATAGATCAAATTAGG - Intergenic
1134438162 16:14280879-14280901 TTGAATCTACAGATGAATTTGGG - Intergenic
1135273732 16:21092038-21092060 TTGAATCTATAGATCAAGTTGGG - Intronic
1135466357 16:22689021-22689043 TTGAATCTATACATCAAGTTGGG + Intergenic
1135802999 16:25516614-25516636 ATGAATGTAAAAATAAAGTTAGG - Intergenic
1135996076 16:27249828-27249850 TTGAATCTATAGATCAATTTGGG + Intronic
1137436634 16:48459875-48459897 TTGAATCTATAGATCAAGTTAGG + Intergenic
1137552369 16:49447292-49447314 CTGAATCTGTAGATAAATTTGGG + Intergenic
1137908151 16:52347264-52347286 CTGAATTTGTAGATCAATTTAGG - Intergenic
1138176602 16:54905222-54905244 TTGAATTTCTAGATCAAGTTGGG - Intergenic
1138289465 16:55834385-55834407 ATGAATGTGTAAATGAAGTGTGG + Intergenic
1139121825 16:64028190-64028212 TTGAATCTATAGATCAAGCTGGG + Intergenic
1140008373 16:71103814-71103836 TTAAATCTATAGATGAATTTGGG + Intronic
1140243146 16:73222642-73222664 CTGAATCTATAAATCATGTTGGG - Intergenic
1140786850 16:78350677-78350699 CTGAATGCATAGATGAAATGTGG - Intronic
1141037222 16:80638406-80638428 TTGAGTCTATAGATCAAGTTGGG - Intronic
1141194101 16:81846700-81846722 TTGAATCTATAGATGAAGCCAGG - Intronic
1141902462 16:87000870-87000892 CTGAATCTATAGATCGATTTGGG - Intergenic
1143308111 17:5964809-5964831 TTGAATCTATAGATCAAGTTAGG + Intronic
1143681268 17:8477671-8477693 CTGACTGAATGAATGAAGTTGGG + Intronic
1143989892 17:10948323-10948345 TTGAATCTACAGATCAAGTTTGG + Intergenic
1144048463 17:11474914-11474936 TTGAATCTATAGATCAAGTTGGG + Intronic
1144546762 17:16203874-16203896 CTGAAATTGTAGGTGAAGTTTGG - Intronic
1145045213 17:19608879-19608901 CTGAATCTGTAGATCAACTTAGG - Intergenic
1145299609 17:21623435-21623457 CTGAAATTGTAGGTGAAGTTTGG + Intergenic
1145350672 17:22079832-22079854 CTGAAATTGTAGGTGAAGTTTGG - Intergenic
1145735663 17:27229500-27229522 ATAAATTTATAGATGAATTTGGG - Intergenic
1145738737 17:27253768-27253790 TTGAATCTATAAATGAACTTGGG - Intergenic
1146554105 17:33808593-33808615 CTGAATCTATGGATCAAGTTGGG + Intronic
1146612227 17:34317741-34317763 TTGAAGGTACAGATCAAGTTGGG - Intergenic
1146815754 17:35940891-35940913 ATGAATGGATAGACGAAGTATGG - Intronic
1146839694 17:36142155-36142177 TTGAATCTATAGATTAATTTGGG - Intergenic
1146970911 17:37071362-37071384 CTGACTCTATAGATCAATTTGGG + Intergenic
1147033854 17:37664710-37664732 TTGAATTTATAGATAAATTTGGG + Intergenic
1147062254 17:37889934-37889956 CTGAATCTCCAGATGAGGTTAGG + Intergenic
1147467212 17:40619589-40619611 ATAAATGTATGGTTGAAGTTGGG - Intergenic
1148144119 17:45351018-45351040 TTGAATGTATAGATACATTTTGG - Intergenic
1148893678 17:50827143-50827165 GTGAATCTATAGATCTAGTTGGG + Intergenic
1149236575 17:54597718-54597740 TTGAATATATAGATTAGGTTTGG - Intergenic
1149508774 17:57219248-57219270 TTGAATCTATAGGTCAAGTTGGG - Intergenic
1149631780 17:58131634-58131656 CTGAATGTATAAATTACCTTGGG - Intergenic
1149853613 17:60058180-60058202 CTGAATCTATAGATCAAGTTGGG + Intronic
1149939719 17:60850882-60850904 CTGAATGCATAGATCAACTTAGG - Intronic
1150480987 17:65510453-65510475 CTGAATCTATAGATCAATTTGGG - Intergenic
1150951751 17:69810385-69810407 CTGAATGTCAAAATGAAATTGGG - Intergenic
1151012157 17:70512643-70512665 CTGAATCTATAGAAGAAACTGGG - Intergenic
1151374540 17:73677371-73677393 TTGAATGTATAGATTGATTTGGG - Intergenic
1153115049 18:1644905-1644927 CTGAATGTATAAATTACCTTGGG - Intergenic
1153504738 18:5785248-5785270 CTGAATGGATATAAAAAGTTGGG - Intergenic
1153751358 18:8234179-8234201 CTGAATCTATAGATCAATTTGGG + Intronic
1153941102 18:9978159-9978181 CTGAATGTATAAATTACCTTGGG + Intergenic
1154282884 18:13022752-13022774 TTGAATGTATAGGTGAAGTTGGG + Intronic
1154290912 18:13105934-13105956 CTGAATATGTAGATCAATTTAGG - Intronic
1154319392 18:13333968-13333990 TTGAATCTATTGATGAAGCTGGG + Intronic
1154951320 18:21212893-21212915 ATGAATCTATAGATCAAGTTGGG + Intergenic
1155185821 18:23385751-23385773 CTGCATGTTTAGAGGAACTTGGG + Intronic
1155456916 18:26027017-26027039 ATGAATTTATAGATTAATTTGGG - Intronic
1155665338 18:28300838-28300860 CAGAATCTATAGATCAAGATGGG - Intergenic
1155766370 18:29638497-29638519 TTCAATCTATAGATGAAGATGGG + Intergenic
1156258244 18:35420104-35420126 TTGAATATATAGATTAATTTAGG + Intergenic
1156281653 18:35645073-35645095 TTGAATTTATAGATTAATTTTGG + Intronic
1156285164 18:35686275-35686297 CTGAATTTATATATGAATTTGGG - Intronic
1156813844 18:41284781-41284803 TTGAATCTATAGATTAAGTTGGG - Intergenic
1157343156 18:46798401-46798423 TTGATTCTATAGATCAAGTTGGG - Intergenic
1157871861 18:51237210-51237232 TCAAATGTATAGATGAATTTGGG + Intergenic
1157961840 18:52162981-52163003 TTGAATCTATAGATCAATTTGGG + Intergenic
1158261892 18:55615149-55615171 TTGAATCTATAGATTAATTTGGG + Intronic
1158701036 18:59747007-59747029 TTGAATCTATAGATGAAGATAGG + Intergenic
1159037183 18:63289047-63289069 CTGAATGGATGAATGAAGTATGG - Intronic
1159588488 18:70305625-70305647 TTGAATCTATAGATCAATTTTGG + Intronic
1159742553 18:72190537-72190559 TTTAATGTATAGATACAGTTGGG + Intergenic
1159872625 18:73775662-73775684 TTGAATGTACAAATGAATTTGGG - Intergenic
1160472616 18:79151017-79151039 CTGAATCTACAGATCAATTTAGG - Intronic
1160536229 18:79595257-79595279 TTGAATCTATAGATCAAATTGGG - Intergenic
1160561335 18:79758470-79758492 TTGAATGTGTAGATCAAATTGGG + Intergenic
1161184791 19:2910038-2910060 TTGAATCTATAGATCAAGTTGGG + Intronic
1161881971 19:6961447-6961469 TTGGATCTATAGATCAAGTTGGG + Intergenic
1163219644 19:15907705-15907727 CTGAATCTATAGATTTAGTTGGG - Intergenic
1163226852 19:15968490-15968512 TTGAATCTATAGATCAAGTTGGG - Intergenic
1164122323 19:22277367-22277389 CTGAATGTATAAATTACTTTGGG - Intergenic
1164546302 19:29166709-29166731 CTAAATCTATAGATAAATTTTGG - Intergenic
1164644790 19:29850580-29850602 CTGAAGCTATAGATCAATTTGGG - Intergenic
1164815529 19:31198851-31198873 CTGAGTCTATAGATCAAGTTGGG - Intergenic
1164893784 19:31850296-31850318 TTGAATCTATAGATCAAGTTGGG - Intergenic
1165375951 19:35442056-35442078 CTGAATCCATAGATCAATTTGGG - Intergenic
1165876516 19:39011464-39011486 CTGAATCTGTAGATCAATTTAGG + Intronic
1166582176 19:43910908-43910930 ATGAATATATAGATGAGTTTGGG - Intergenic
1166922997 19:46244243-46244265 TTGAATATATAGATCAATTTGGG - Intergenic
1167400367 19:49263507-49263529 CTGAATCTGTAGATCAATTTGGG - Intergenic
1167975078 19:53219618-53219640 CTTAATGTAAACATGAACTTTGG - Intergenic
925392547 2:3506619-3506641 CTGAACCTATAGATTAAGTTTGG - Intronic
925565364 2:5247968-5247990 CTGAATCTATAGATCAAGTTGGG - Intergenic
925701258 2:6640645-6640667 CTGAAAATATAGATGAACTCAGG - Intergenic
926002141 2:9342087-9342109 CTGAATGTGTAGATCAATTAGGG - Intronic
926481829 2:13408489-13408511 TTGAATCTATAGATCAATTTTGG - Intergenic
926540557 2:14174849-14174871 TTGAATTTATAGATTAATTTGGG - Intergenic
926566284 2:14478430-14478452 TTGAAGGTATTGAAGAAGTTAGG + Intergenic
926954951 2:18284222-18284244 ATACATGTATATATGAAGTTGGG - Intronic
927002173 2:18808953-18808975 CTGAAACTATAGATGAACTTAGG - Intergenic
927033581 2:19149144-19149166 TTGAATGTATAGATTAATTTGGG - Intergenic
927607399 2:24499359-24499381 TTAAATATATAGATGAATTTTGG + Intronic
927736606 2:25528964-25528986 CTGAATCTAAAGATCAAATTGGG - Intronic
927740426 2:25564283-25564305 CTGAATCTGTAGATGAATTGGGG + Intronic
928191257 2:29171165-29171187 TTGACTATATAGATCAAGTTGGG + Intronic
928493519 2:31808053-31808075 CTGAATCCATAGATCAACTTAGG + Intergenic
928524263 2:32123456-32123478 CTGAATCGATATATGAACTTGGG - Intronic
928729363 2:34212968-34212990 TTAAATGTATATATTAAGTTTGG - Intergenic
928812939 2:35251046-35251068 TTGTATGCATAGATAAAGTTAGG + Intergenic
928851157 2:35748824-35748846 CTGAATCTATAGGTCAATTTGGG - Intergenic
929491712 2:42402951-42402973 TTGAATTTATAGATCAATTTGGG + Intronic
929717705 2:44330186-44330208 CTGATTGTATAATTGAAGTTGGG - Intronic
929767820 2:44864038-44864060 CTGAATCTATAGATCAAATTGGG - Intergenic
929900367 2:45995932-45995954 TTGAATATATAGATCGAGTTTGG + Intronic
929906718 2:46052569-46052591 TTGAATGTAGAGATCAATTTGGG - Intronic
930251014 2:49033973-49033995 CTGAAGGAAAAGATGAAGTGAGG + Intronic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
930537531 2:52662846-52662868 TTGAATCTATAGATAAATTTTGG - Intergenic
930593760 2:53360393-53360415 TTGAATGTGTAGATCAATTTTGG + Intergenic
930977720 2:57484341-57484363 TTGAATCTGTAGATCAAGTTGGG + Intergenic
931021542 2:58049888-58049910 ATGAATGAATGAATGAAGTTTGG + Intronic
931339452 2:61385281-61385303 CTGAATCTATAGATGAATTTCGG - Intronic
931580619 2:63768455-63768477 TTGAATTTATAGATGAAATTGGG + Intronic
931865078 2:66400851-66400873 CTGATTTTACAGATTAAGTTGGG + Intergenic
931865517 2:66406318-66406340 TTGAATCTATAGATTAACTTGGG - Intergenic
931965306 2:67526968-67526990 TTGAATCTACAGATAAAGTTGGG - Intergenic
931993414 2:67814489-67814511 TTGAATATATAGATCAATTTAGG - Intergenic
932189521 2:69728925-69728947 TTGAATTTATAGATCAATTTGGG + Intronic
932470840 2:71955149-71955171 TTGAATATATAGATCAAGTTGGG + Intergenic
932743368 2:74309589-74309611 TTGCATCTATAGATCAAGTTGGG + Intronic
933403122 2:81823862-81823884 ATGAATGAATTGATAAAGTTAGG + Intergenic
933409031 2:81901614-81901636 TTGAATCTCTAGATTAAGTTGGG - Intergenic
933512031 2:83252691-83252713 CTGAATGTATAGATTGCTTTGGG - Intergenic
933793354 2:85901390-85901412 ATGTATGTAAAGATGAAATTTGG - Intergenic
933838817 2:86268554-86268576 TTGAATCTATAGATCAAGTTGGG - Intronic
933855388 2:86408943-86408965 TTGAATCTATAGATAAATTTGGG - Intergenic
934016003 2:87882659-87882681 TTGAATTTATAGATCAATTTGGG + Intergenic
935396256 2:102612394-102612416 CTGAATATATATTTGAAGGTAGG - Intergenic
935452008 2:103220686-103220708 CTGCATGTTAAGATGAAGGTTGG - Intergenic
935456631 2:103276742-103276764 CTGACTTTGAAGATGAAGTTAGG + Intergenic
935518612 2:104077348-104077370 TTAAATCTATAGATCAAGTTGGG + Intergenic
935519630 2:104088458-104088480 CTGAATCTGTAGATTAACTTGGG + Intergenic
935703170 2:105831204-105831226 CTGAATGTATAGATCACTTTAGG - Intronic
935875944 2:107507847-107507869 TTGAATCTATAGAGCAAGTTGGG + Intergenic
936005167 2:108880342-108880364 TTGTATCTATAGATCAAGTTGGG - Intronic
936125384 2:109785010-109785032 CTGGGTCTATAGATCAAGTTTGG - Intergenic
936219309 2:110586458-110586480 CTGGGTCTATAGATCAAGTTTGG + Intergenic
936736824 2:115455231-115455253 TTCAATGTATAGATCAATTTTGG - Intronic
936781027 2:116032759-116032781 CTGAATCTATAGATCAATTTTGG + Intergenic
937396360 2:121539087-121539109 TTGAATGTTTAGATCAATTTGGG - Intronic
937422557 2:121770513-121770535 ATGAATGTATAGATAAAATGTGG - Intergenic
937497633 2:122440198-122440220 CTGAATTTATAGATTAATTTAGG - Intergenic
937743563 2:125384837-125384859 CTGAATCTATAGATCAAATTGGG - Intergenic
937838697 2:126502134-126502156 TTGAATCTGTAGATGAAATTGGG - Intergenic
938113106 2:128582331-128582353 TTGAATCTGTAGATGAATTTGGG + Intergenic
938198113 2:129350091-129350113 TTGAATGTATAGATCAAGTTGGG + Intergenic
938554326 2:132410533-132410555 TTGAATCTATAGATCAATTTTGG + Intergenic
938834577 2:135087453-135087475 TTGAATATATAGATTAACTTGGG + Intronic
939120188 2:138107221-138107243 CAGAATATAGAGATGAGGTTTGG + Intergenic
939216816 2:139249272-139249294 TTGAATCTATAGATTACGTTGGG + Intergenic
939747922 2:146000854-146000876 CTGAATCTGTAGATCAATTTGGG - Intergenic
939802294 2:146724920-146724942 TTGAATTTATAGATCAAGTTGGG - Intergenic
939849059 2:147282270-147282292 CTGAATCTATAAATTATGTTGGG - Intergenic
939871516 2:147531465-147531487 CTGTTTTTATGGATGAAGTTTGG + Intergenic
939911979 2:147994280-147994302 TTGAATTTATAGATCAAGGTTGG - Intronic
940206526 2:151208751-151208773 CTATATTTATAGATGAATTTAGG - Intergenic
940472908 2:154121393-154121415 TTGAATTTATAGATCAAGTTGGG + Intronic
940559094 2:155271498-155271520 CTGAATTTATAGATAACTTTGGG - Intergenic
940619312 2:156090930-156090952 TTGAAACTATAGATCAAGTTGGG + Intergenic
940714156 2:157200147-157200169 TTGAATCTATAGATCAAGTTGGG - Intergenic
940732600 2:157410654-157410676 CTGAATCTACAGATTAAGTTGGG + Intergenic
940852038 2:158697134-158697156 TTGAATCTATAGATCAAGTTGGG - Intergenic
941073581 2:160982302-160982324 TTGAATCTATAGATTACGTTGGG - Intergenic
941216499 2:162715874-162715896 TTAAATGTATAGATTAATTTGGG + Intronic
941242594 2:163058088-163058110 TTGAGTCTATAGATCAAGTTAGG + Intergenic
941803380 2:169686367-169686389 TTGAATGTGTAGATCAATTTGGG + Intronic
942012807 2:171780004-171780026 CTGAATTTATAGATCAATTTGGG - Intergenic
942235544 2:173900872-173900894 TTGAATCTATAGATTAATTTGGG - Intergenic
942271427 2:174279493-174279515 TTGAATCTATAGATCAATTTGGG + Intergenic
942405054 2:175645303-175645325 CTGAATCTATAGAGCAAGTTGGG + Intergenic
942887587 2:180945964-180945986 TTGAATGTATAGATCAATTTGGG + Intergenic
943277356 2:185884141-185884163 TTGAATCTATAAATTAAGTTGGG - Intergenic
943455449 2:188102313-188102335 CTGAATGTATCAATCAATTTTGG - Intergenic
943918636 2:193673431-193673453 TTGAATTTATAGATGAATTTGGG - Intergenic
944392730 2:199234783-199234805 CTGAATCTATAAATCTAGTTGGG + Intergenic
944640609 2:201721236-201721258 TTGAATCTATAGATTAATTTGGG - Intronic
944700753 2:202243881-202243903 CTGAATCTATATATCAAGTTGGG + Intergenic
945021485 2:205576861-205576883 TTGAATCTGTAGATCAAGTTGGG + Intronic
945327836 2:208503348-208503370 TTGAATCTATAGATCAATTTTGG + Intronic
945341420 2:208660471-208660493 ATGCATGTATAGATCAATTTGGG + Intronic
945472572 2:210244164-210244186 CTGAATCTATTGATCAAATTGGG + Intergenic
945674226 2:212835727-212835749 TTGAATCTATAGATGAAGTTAGG + Intergenic
945787267 2:214256979-214257001 TGGAATGTATAGATTAATTTGGG + Intronic
945953198 2:216059956-216059978 CTGAATCTACAGATCAATTTGGG + Intronic
946270230 2:218586131-218586153 CTGAATCTATAGATCAGTTTGGG - Intronic
946462659 2:219882788-219882810 CTAAATGTATAGATTTAGTATGG - Intergenic
946749091 2:222875013-222875035 TTGAATGGAGAGGTGAAGTTAGG + Intronic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
947030696 2:225790193-225790215 TTGAATCTATAGATCAAGTTAGG + Intergenic
947258674 2:228195503-228195525 CTGAATTTATATATTAATTTGGG + Intergenic
947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG + Intronic
948043249 2:234921597-234921619 CTGAGTCTATAGATTAATTTGGG - Intergenic
948070929 2:235124091-235124113 CTGAATGTATAAATCAAAGTTGG + Intergenic
948240274 2:236426201-236426223 CTGAATCTATAGATCACTTTGGG + Intronic
948649538 2:239432017-239432039 CTGAATTTATAGATTAATTTAGG + Intergenic
1169032933 20:2426070-2426092 TTGAATCTATAGATCAAGCTAGG + Intronic
1170161491 20:13317365-13317387 TTGAATCTATAGATCAAGTTGGG - Intergenic
1170378152 20:15725159-15725181 TTGAATCTATAGATCAAGTTGGG + Intronic
1170402036 20:15997270-15997292 TTGAATGTATAGATCGATTTAGG + Intronic
1170689495 20:18600668-18600690 TTGAGTCTGTAGATGAAGTTGGG + Intronic
1170788565 20:19489116-19489138 CTGAATGTATAGATTGAATTAGG - Intronic
1171110180 20:22473493-22473515 GTGAATTTTTAGAGGAAGTTGGG - Intergenic
1171117003 20:22533700-22533722 CTAAAGGTTAAGATGAAGTTGGG - Intergenic
1171355239 20:24539645-24539667 CTGAATCTATAGATAACTTTGGG + Intronic
1171415338 20:24975597-24975619 TTGAATCTATAGATTAAGGTTGG - Intronic
1171432921 20:25096608-25096630 TTGAATCTATAGATTAAGTTAGG - Intergenic
1171560922 20:26124818-26124840 CTGAAATTGTAGGTGAAGTTTGG - Intergenic
1172785115 20:37463675-37463697 TTGAATCTATAGATCAATTTGGG + Intergenic
1173368696 20:42414807-42414829 TTGAATTTATAGATTAATTTAGG - Intronic
1173482489 20:43414284-43414306 TTAAATGTATAGATCAATTTTGG - Intergenic
1173651602 20:44669560-44669582 CTGAATGGATATAGAAAGTTGGG + Intergenic
1176703929 21:10095176-10095198 TTGAATGTATACATAAAATTTGG - Intergenic
1177023240 21:15889157-15889179 CTGGATTTATAGATGAATTTGGG - Intergenic
1177125498 21:17188406-17188428 TTGAATCTATAGATCAATTTGGG - Intergenic
1177349581 21:19919423-19919445 TTGAATCTCTAGATCAAGTTGGG - Intergenic
1177468740 21:21526552-21526574 CTGACTCTACAGATCAAGTTGGG - Intronic
1177560986 21:22753509-22753531 CTGAAATTAAAGATGATGTTTGG - Intergenic
1177679389 21:24345564-24345586 TTGAATCTATAGATGACTTTGGG + Intergenic
1177733776 21:25062903-25062925 ATCAATGTATAAATGAAGTTTGG - Intergenic
1177799221 21:25811396-25811418 TTGAATCTATAGATCAATTTGGG - Intergenic
1178031500 21:28531867-28531889 TTGAATCTATAGATCAAGTTGGG + Intergenic
1178774112 21:35532784-35532806 CAGAATGTATAAATGAATTGGGG - Intronic
1179623794 21:42635956-42635978 ATGAATGTATATATGTAGCTTGG - Intergenic
1180003798 21:45009812-45009834 CTGAATGTGCAGATCAATTTGGG + Intergenic
1180094223 21:45547913-45547935 CTGAATCTATGGATCAATTTGGG - Intergenic
1180477866 22:15728330-15728352 CTGAATCTATAAATGACTTTGGG - Intergenic
1181611728 22:24018830-24018852 TTGAATGTATAAATTAACTTGGG + Intronic
1181769362 22:25114083-25114105 CTGGTTGAATAAATGAAGTTGGG + Intronic
1182407338 22:30147110-30147132 TTGAATGTATAGATCAATTTGGG - Intronic
1182824263 22:33250102-33250124 TTGAATCTACAGATAAAGTTAGG + Intronic
1182977072 22:34633497-34633519 CTGAATCTATAGATTACTTTGGG - Intergenic
1183141129 22:35940704-35940726 ATGAATGGATAAATGAAGTATGG + Intronic
1183882750 22:40849115-40849137 TTGAGTGAATAGATGAAGGTAGG - Intronic
1184539964 22:45115196-45115218 GTGAATCTGTAGATGAATTTGGG - Intergenic
1184613216 22:45619253-45619275 TTGAATCTATAGATGGATTTAGG + Intergenic
1185164149 22:49248627-49248649 TTGAATCTATAGATCAATTTAGG + Intergenic
949292227 3:2480680-2480702 TCGAATCTATAGATCAAGTTGGG - Intronic
949389875 3:3548423-3548445 TTGAATCTATAGATCAAGTTAGG + Intergenic
949950495 3:9225083-9225105 CTGAATCTTTTTATGAAGTTTGG - Intronic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
950352148 3:12365969-12365991 TTGAATCTATAGATCAAGTTGGG + Intronic
950513507 3:13448106-13448128 CTGAAACTATAGGTGAATTTGGG - Intergenic
950843517 3:15990769-15990791 TTGAATCTATAGATCAATTTGGG + Intergenic
950959115 3:17085986-17086008 TTGAATCTATATATCAAGTTGGG - Intronic
950994137 3:17476662-17476684 CTGAATCTATAGATCAATTTGGG + Intronic
951133110 3:19071994-19072016 GTGAATGTATAGATCAGGTTGGG - Intergenic
951265920 3:20566657-20566679 TTGAATCTATAAATCAAGTTGGG + Intergenic
951331283 3:21371626-21371648 CTGAATATATTGATCAAGTTGGG + Intergenic
951430421 3:22600535-22600557 GTGAATTTATAGATCAATTTGGG - Intergenic
951533070 3:23716351-23716373 CTGAATCTATAGATCAAGCTGGG + Intergenic
951675252 3:25232757-25232779 ATGATTGTATAGATAAAGTACGG - Intronic
951974078 3:28483551-28483573 TTGAATTTATATATCAAGTTGGG + Intronic
951988770 3:28651802-28651824 TTGAATGTGTACATGATGTTCGG - Intergenic
952128135 3:30327149-30327171 TTGAATCTATACATCAAGTTGGG - Intergenic
952169056 3:30785255-30785277 TTGAATGTAAACATGAAATTGGG + Intronic
952191951 3:31032722-31032744 CTGAATCTATATATAAAATTGGG + Intergenic
952196202 3:31077807-31077829 CTGAATGTAGAGATGTTATTTGG + Intergenic
952426239 3:33177292-33177314 TTCAATCTATAGATCAAGTTGGG + Intronic
952473262 3:33678842-33678864 TTGAATCCATAGATCAAGTTGGG - Intronic
952611395 3:35215016-35215038 TTGAATCTATAGATAAACTTGGG + Intergenic
952703930 3:36357450-36357472 TTGAATCTATAGATCAAGTTGGG + Intergenic
952778990 3:37075633-37075655 TTAAATGTATAGATTAATTTAGG - Intronic
953192778 3:40703727-40703749 TTGACTCTATAGATCAAGTTGGG + Intergenic
953313586 3:41904920-41904942 TTGAATGTGTAGATCAATTTAGG - Intronic
953422733 3:42767508-42767530 TTGAATCTATAGATCAAGTTGGG - Intronic
953600102 3:44354478-44354500 TTGAATCTATAGATCAAGTTGGG + Intronic
953890318 3:46746798-46746820 ATGAATTTATAGATTAATTTTGG - Intronic
954311213 3:49769191-49769213 CTGAATTTATAGATTCATTTGGG - Intronic
954583214 3:51714685-51714707 GTGTATGTTTCGATGAAGTTGGG + Intronic
954846090 3:53557919-53557941 CTGAATCTATAGATCGATTTGGG + Intronic
954979001 3:54726335-54726357 CTGAATGTATAAATTACTTTGGG - Intronic
955169990 3:56554272-56554294 TTGAATCTATAGATCAAGTTGGG + Intergenic
956628420 3:71290024-71290046 CTGAATTTATAGACCAAGCTAGG + Intronic
956690266 3:71871475-71871497 TTAAATCTATAGATGAATTTGGG - Intergenic
956993686 3:74798765-74798787 TTGAATCTATAAATTAAGTTGGG - Intergenic
957400440 3:79705744-79705766 CTGAATCTATAGAACAAGTTGGG + Intronic
957876495 3:86153841-86153863 TTGAATGTTTACATGCAGTTTGG + Intergenic
957969994 3:87371081-87371103 ATGAATGTAAAGATGAGATTTGG - Intergenic
958001732 3:87759324-87759346 TTGAATCTATAGATCAAGTTGGG - Intergenic
958098651 3:88980438-88980460 CTGAATTTATATATGAAGCCAGG - Intergenic
958443724 3:94189085-94189107 TTGAATCTATAGACCAAGTTGGG + Intergenic
958444532 3:94198800-94198822 CTGAATGTGTAGATGGCTTTTGG + Intergenic
958581826 3:96035889-96035911 TTGCATCTATAGATCAAGTTGGG + Intergenic
958902016 3:99898350-99898372 TGGAATGAAAAGATGAAGTTGGG - Intronic
959275376 3:104270713-104270735 CTAAATGTACACATGAACTTAGG + Intergenic
959499935 3:107094949-107094971 TTGAATCTATAGATCAAGTTGGG - Intergenic
959793478 3:110393473-110393495 CTGAATCTATAGATAAAGAAGGG - Intergenic
959872815 3:111348281-111348303 CCTAATGTAAAGGTGAAGTTTGG - Intronic
960020370 3:112945146-112945168 TTGAATACATAGATCAAGTTGGG - Intronic
960220557 3:115103274-115103296 TTGAATCTATAGATCAATTTGGG - Intronic
960364660 3:116756523-116756545 CTGAATGCCTGGTTGAAGTTAGG + Intronic
960478153 3:118156928-118156950 TTGAATCTGTAGATGAATTTTGG - Intergenic
960547321 3:118930806-118930828 CTGAATCTATAGATCAATTTAGG - Intronic
960559258 3:119064603-119064625 CTGAAACTATAGATTAATTTGGG + Intronic
960822966 3:121753734-121753756 TTGAATCTACAGATAAAGTTGGG - Intergenic
960889250 3:122429629-122429651 TTGAATCTATAGATCAAGTTGGG - Intronic
960982898 3:123248656-123248678 TTGAATCTATAGACCAAGTTGGG - Intronic
961478223 3:127161997-127162019 GTGAAGGTATAGATGTAGATGGG - Intergenic
961732477 3:128976405-128976427 TTGAATATATAGATTAATTTGGG - Intronic
962000680 3:131292480-131292502 TTGCATCTATTGATGAAGTTGGG + Intronic
962194322 3:133347202-133347224 TTGAATCTGTAGATCAAGTTGGG + Intronic
962690572 3:137893485-137893507 CTGGATTTTTAGATGAAGTAAGG + Intergenic
963014992 3:140814744-140814766 TTGAATTTATAGATCAAGCTGGG - Intergenic
963392554 3:144685598-144685620 TTGAATTTATAAATGAATTTGGG - Intergenic
963823878 3:149930392-149930414 TTGAATTTATAAATCAAGTTGGG + Intronic
964460814 3:156925003-156925025 TTGAATCTATAGATCAATTTGGG + Exonic
965077656 3:164000140-164000162 ATGAATTTATAGAGAAAGTTTGG - Intergenic
965326527 3:167310917-167310939 ATGAATCTATAGATCAAGTTGGG - Intronic
965848922 3:172998104-172998126 TTGAATCTATGGATCAAGTTTGG + Intronic
966131542 3:176646228-176646250 TTAAATCTATAGATCAAGTTGGG - Intergenic
966166792 3:177028672-177028694 TTGAATTTATAGGTGAAATTAGG - Intronic
966178445 3:177165417-177165439 TTGAATTTGTAGATCAAGTTGGG - Intronic
966275684 3:178164552-178164574 TTGAATCTATAGATAAAATTTGG - Intergenic
967008030 3:185403084-185403106 CTCTATGTATAGCTGAGGTTTGG - Intronic
967085049 3:186087107-186087129 CTGAACCTATAGATAAATTTGGG - Intronic
967430371 3:189377593-189377615 TTAAATCCATAGATGAAGTTGGG + Intergenic
967456861 3:189697619-189697641 TTGAATGTATACATCAAGTTGGG + Intronic
967490402 3:190084131-190084153 CTGAATCTACACATCAAGTTAGG + Intronic
967676957 3:192311519-192311541 ATGAATGGATAAATAAAGTTTGG - Intronic
968535130 4:1121549-1121571 TTGAATCTATAGAACAAGTTGGG - Intergenic
968840250 4:2998784-2998806 TTGAATCTATAGATCAATTTGGG - Intronic
969062194 4:4445756-4445778 TTGAATTTATAGATCAATTTGGG - Intronic
970049049 4:11891607-11891629 CTGATTATATAGGTCAAGTTGGG - Intergenic
970090063 4:12396259-12396281 CTTAATGAACAGATGATGTTAGG - Intergenic
970949813 4:21741534-21741556 CTTAAAGTATAGATGATGCTGGG - Intronic
971086611 4:23283737-23283759 TTGAATGTATACATTAATTTGGG + Intergenic
971526004 4:27620038-27620060 TTGAATCTATAGATCAATTTGGG - Intergenic
972165428 4:36277856-36277878 CTGAAAGTAAAGATGAACTTAGG - Intergenic
972810898 4:42584781-42584803 TTGAATATATATCTGAAGTTTGG - Intronic
973028711 4:45308403-45308425 CTGAATATATAAATCAAGTTGGG + Intergenic
973267344 4:48224124-48224146 CTGAATGTACAGGTGGAGTTGGG + Intronic
973272543 4:48276391-48276413 ATGAATGGATACAAGAAGTTAGG - Intergenic
974153938 4:58045934-58045956 TTGGATGTGTAGATGAATTTTGG + Intergenic
974170238 4:58257524-58257546 TTGAATTTATAGATCAAGTTGGG - Intergenic
974854908 4:67449358-67449380 TTGAATCTGTAGATTAAGTTGGG - Intergenic
974930383 4:68354541-68354563 CCAAATCTATAGATGAAATTAGG - Intergenic
975958394 4:79870276-79870298 TTGAAGCTATAGATCAAGTTGGG - Intergenic
976005614 4:80425966-80425988 TTGAATTTGTGGATGAAGTTGGG + Intronic
976060301 4:81119946-81119968 TTGAATTTATAGATCAAGTTGGG + Intronic
976989492 4:91347536-91347558 TTTAATGTATTGATCAAGTTGGG + Intronic
977086968 4:92612516-92612538 TTGAATGTATAAATCAATTTGGG + Intronic
977232856 4:94472694-94472716 CGGCATTTATAGATAAAGTTGGG + Intronic
977454478 4:97240730-97240752 TTGAATCTATAGATCAAGTTGGG - Intronic
977482965 4:97601855-97601877 CTAAATTTATAGATCAAGTTGGG + Intronic
977768487 4:100829065-100829087 CTGAATCTAGGGATGATGTTAGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
977953168 4:102997247-102997269 TTGAATCTATAGATTAATTTGGG + Intronic
978045448 4:104120479-104120501 TTGAATGTATAGATCACTTTGGG - Intergenic
978129397 4:105176690-105176712 CTGAATCTATAGATCAAGTTGGG - Intronic
978176508 4:105738454-105738476 CTGAATCTATAGATCACTTTTGG + Intronic
978262487 4:106777357-106777379 CTGTATTTATAGATAAATTTGGG - Intergenic
978263882 4:106798610-106798632 CTGTATGTATAGATTATATTTGG + Intergenic
978271060 4:106891749-106891771 GTGAATGTATAGATCAAATTAGG - Intergenic
978415481 4:108471144-108471166 TTGAATCCATAGATCAAGTTGGG - Intergenic
978440017 4:108723852-108723874 CTGAATGAATATAGAAAGTTGGG + Intergenic
978475267 4:109121025-109121047 TTGAATCTATAGATTAAGATGGG - Intronic
978596864 4:110387290-110387312 CTGAATGTATAAATTACCTTGGG + Intronic
978826900 4:113035580-113035602 AGGAATGTGTAGATGAATTTAGG + Intronic
978881918 4:113714950-113714972 TTGAATTTATAGATTAATTTGGG + Intronic
978948881 4:114532747-114532769 TTGAATATATAGATCAATTTGGG - Intergenic
979026720 4:115586903-115586925 TTGAATGTATAAATAAATTTGGG + Intergenic
979045976 4:115865018-115865040 CCTAATATATAGATCAAGTTAGG - Intergenic
979130068 4:117032958-117032980 CTGAATGTATAAATTACTTTGGG + Intergenic
979633155 4:122925887-122925909 CTGAATGAATAAATGAAGGGTGG + Intronic
979903360 4:126252265-126252287 TTGAACCTATAGATCAAGTTGGG - Intergenic
979952594 4:126912718-126912740 TTGAATCTATAAATCAAGTTGGG - Intergenic
980336643 4:131483171-131483193 CTGAATGTATTTATGATTTTGGG - Intergenic
980376146 4:131951519-131951541 TTGAATGTATACATAAAATTTGG - Intergenic
981167167 4:141574423-141574445 CTAAAAGTATAAATGATGTTGGG - Intergenic
981185516 4:141797731-141797753 CTGAATCTATATATCAAGTCGGG + Intergenic
981273720 4:142874229-142874251 CTGAAGCTATAGATTAATTTTGG - Intergenic
981874973 4:149531037-149531059 TTGAATATATACATGAAGTATGG - Intergenic
982079442 4:151773681-151773703 TTGAATCTATAGATTAATTTGGG + Intergenic
982134499 4:152260535-152260557 TTGAATCTATAGATCAATTTGGG - Intergenic
982161176 4:152571060-152571082 CAGAATCTATAGATCAAGTTGGG + Intergenic
982491412 4:156034370-156034392 TTGAATCTATAGATCAAGTTGGG + Intergenic
982588818 4:157278042-157278064 TTGAATCTATAAATCAAGTTGGG - Intronic
982799198 4:159682096-159682118 TTGAATCTATAGACTAAGTTGGG - Intergenic
982895416 4:160916100-160916122 CTGATTCTATAGATCAAGTTGGG + Intergenic
983461723 4:168032639-168032661 TTGAATCTATAGATCAATTTAGG + Intergenic
983571614 4:169214496-169214518 TTGAATCTATAGATCAAGTTGGG + Intronic
984074310 4:175155494-175155516 CTGAATCTATACATCAATTTTGG + Intergenic
984636632 4:182117856-182117878 TTGAATCTGTAGATCAAGTTGGG + Intergenic
985352344 4:189078419-189078441 TTGAATCTATAGATCAATTTTGG - Intergenic
985479444 5:99310-99332 CTGAATTTATAGATCACTTTAGG + Intergenic
987162553 5:15159205-15159227 ATGAATGTATAAATGAATTAGGG - Intergenic
987819634 5:22946331-22946353 CTGAATCTACAGAGGAACTTGGG + Intergenic
988007438 5:25435066-25435088 TTGAATCTATAGATCAAGTTGGG - Intergenic
988186991 5:27877844-27877866 ATGAATCTATAGATCAAGTTGGG + Intergenic
988537958 5:32085911-32085933 CCGAATCTATAGATGACTTTGGG + Intronic
988647701 5:33112282-33112304 GTGAATCTACAGATCAAGTTGGG + Intergenic
988662062 5:33281621-33281643 ATTAATGAATGGATGAAGTTTGG - Intergenic
989022348 5:37023462-37023484 CAGAAAGTACAGATGAAGTATGG - Intronic
989288689 5:39735423-39735445 TTGAATCTATAGATTAAGTTGGG + Intergenic
990096978 5:52128087-52128109 TTGAATCTATAGATCAAGTTGGG - Intergenic
990104470 5:52240195-52240217 CTGAATGTGTATATCAATTTGGG + Intergenic
990969039 5:61483005-61483027 ATGAATGGATACATTAAGTTGGG - Intronic
991008082 5:61851220-61851242 TTGAATTTATAGATCAAATTGGG - Intergenic
991119146 5:62991077-62991099 TTGAATCTGTAGATCAAGTTGGG + Intergenic
991285265 5:64967351-64967373 TTGAATGTATAAATTAATTTGGG - Intronic
991429948 5:66534006-66534028 CTGAATTGAAAGATGATGTTAGG - Intergenic
992101820 5:73415421-73415443 CTGAATGAATAGAAGACCTTTGG + Intergenic
992276644 5:75127697-75127719 CTGAATCTATAGATCAATTTGGG + Intronic
992316164 5:75557396-75557418 TTGAGTGTATAGATGAAGTTGGG + Intronic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
992467996 5:77026193-77026215 TTGAATGTATAGATTTATTTAGG - Intergenic
992485812 5:77193734-77193756 TTGAATCTATAGATCAATTTAGG + Intergenic
992533653 5:77676186-77676208 CTGACTCTACAGATCAAGTTGGG - Intergenic
992544686 5:77801062-77801084 TTGAATCTATGGATCAAGTTAGG - Intronic
992601074 5:78400433-78400455 TTGAATCTGTAGATCAAGTTGGG + Intronic
992694269 5:79269503-79269525 TTGAATTTATAGATCAAGTTAGG + Intronic
993054067 5:82960286-82960308 TTGAATTTATAGATTAATTTTGG - Intergenic
993172856 5:84442478-84442500 TTGAATTTATAGATAAAGATGGG - Intergenic
993381081 5:87208608-87208630 CTGAATGTATAGATTACTTTGGG + Intergenic
993576394 5:89606885-89606907 CTGAATTGATAGGTGAAGATGGG + Intergenic
993935842 5:94001213-94001235 ATGAACCTATAGATTAAGTTGGG + Intronic
994617498 5:102123770-102123792 TTGAATCTATAGATCAAGTTGGG + Intergenic
994976475 5:106813621-106813643 TTGGTTCTATAGATGAAGTTGGG + Intergenic
995145125 5:108779358-108779380 TTGAATCTATAAATGAAATTGGG + Intronic
995147419 5:108802263-108802285 TTGAATGTATAGATAAATTTGGG + Intronic
995262027 5:110115338-110115360 CTGAATGTATATATTAATATAGG - Intergenic
995285344 5:110382309-110382331 TTAAATCTATAGATCAAGTTGGG + Intronic
995891451 5:116957188-116957210 ATGAATATATAGATTAATTTAGG - Intergenic
996120695 5:119668420-119668442 TTGAATCTATAAATTAAGTTGGG + Intergenic
996592897 5:125167779-125167801 TTGAATCTGTAGATCAAGTTGGG - Intergenic
996778931 5:127161914-127161936 TTGAATCTATAGATCAAGTTGGG + Intergenic
996803003 5:127424436-127424458 TTGAATCTATAGATCAATTTGGG + Intronic
997156729 5:131569149-131569171 TTGAATCTATAGATTAATTTGGG - Intronic
997370425 5:133356364-133356386 CTGGATTTAGAGATGAAGTCTGG + Intronic
997698099 5:135877523-135877545 ATGAATGAATAAATGAATTTTGG - Intronic
998178823 5:139921170-139921192 TTGAATCGATAGATCAAGTTGGG - Intronic
998595772 5:143528492-143528514 CTGAATGACAAGATGCAGTTAGG + Intergenic
999456620 5:151721896-151721918 CACAATGTATAAATGAATTTTGG - Intergenic
999564765 5:152845922-152845944 TTGAATTTGTAGATCAAGTTGGG + Intergenic
1000238745 5:159389015-159389037 CTGAATCTATAGATCAAGTTGGG + Intergenic
1000405225 5:160880370-160880392 TTGAACCTATAGATCAAGTTTGG - Intergenic
1000913824 5:167055474-167055496 TTGAATCTATAGATCAAGTTGGG + Intergenic
1001136184 5:169104528-169104550 TTGAATGCATTGATGAACTTTGG + Intronic
1001351991 5:170977608-170977630 ATGAATGGATAGATAAAATTTGG + Intronic
1001462630 5:171931098-171931120 TTGAATCTATAGATCCAGTTGGG - Intronic
1001870054 5:175145951-175145973 TTGAATCTATAGAACAAGTTGGG - Intergenic
1002550253 5:179983705-179983727 CTGAATGTATACATCCACTTGGG + Intronic
1002611648 5:180422907-180422929 CTGAATCTGTAGATTAACTTTGG + Intergenic
1002695097 5:181082237-181082259 TTGAATCTGTAGATGAAATTAGG - Intergenic
1002769194 6:275656-275678 CTGAATCCATAGATCAACTTGGG + Intergenic
1002892211 6:1344914-1344936 TTGAACCTATAGATCAAGTTTGG - Intergenic
1003114550 6:3274907-3274929 TGGAATGTATAGATCAATTTGGG - Intronic
1003375838 6:5576721-5576743 CTGAATGAATACATAAAGTTGGG - Intronic
1003580698 6:7337899-7337921 CTGAATCAATAAATGAACTTGGG + Intronic
1004033418 6:11896287-11896309 TTGAATCTATAGATCAAGTTGGG + Intergenic
1004435349 6:15587321-15587343 TTGCATGTATAGATCAATTTGGG - Intronic
1004678492 6:17868465-17868487 CTGCATGTATATATGAAGTTCGG + Intronic
1004788646 6:18998534-18998556 TTGAATTTATAAATCAAGTTGGG + Intergenic
1004969852 6:20897592-20897614 CTGAATATATAACTGAAGATTGG - Intronic
1005007532 6:21303935-21303957 TTGAATCTATAGATCAACTTAGG - Intergenic
1005129148 6:22484498-22484520 CTCAATCTATAGATCAAGTTGGG - Intergenic
1005216836 6:23538856-23538878 TTGAATCTATAGATTAAGTTGGG + Intergenic
1005228199 6:23667590-23667612 TTGAATTTATAGATCAAATTGGG + Intergenic
1005613368 6:27548103-27548125 CAGAAAGCATAGAAGAAGTTCGG - Intergenic
1005631402 6:27711588-27711610 CTGAATGAATTTATGAAGTAAGG - Intergenic
1005646351 6:27842456-27842478 CTATATGTCTATATGAAGTTTGG + Intronic
1006445856 6:34079448-34079470 CTGAATGCAACGATGAAGCTGGG - Intronic
1006822319 6:36907087-36907109 CTGAATGAGTGAATGAAGTTGGG - Intronic
1008186141 6:48393345-48393367 TTAAATCTATAGATGAACTTGGG - Intergenic
1008233469 6:49013946-49013968 ATGAATGTCTAGAGGGAGTTTGG + Intergenic
1008740931 6:54607161-54607183 TTGAATCTATAAATCAAGTTGGG + Intergenic
1008751529 6:54739023-54739045 CTTATTTTATAGATGAATTTTGG + Intergenic
1008863115 6:56175704-56175726 TTGAATCTGTAGATCAAGTTAGG - Intronic
1008873070 6:56295509-56295531 TTGAATCCATAGATGAAGTTAGG + Intronic
1008948071 6:57121441-57121463 TTGAATATATAGATCAAGTTAGG + Intronic
1009641547 6:66343533-66343555 CTGAAAGTTTAGCTGAACTTAGG + Intergenic
1009888529 6:69653698-69653720 CTGAATCTGTAGATTAATTTGGG - Intergenic
1010040173 6:71372449-71372471 CTGAATCTACAGATCAACTTGGG + Intergenic
1010219310 6:73433900-73433922 TTGAATCTATAGATAAATTTGGG - Intronic
1010538318 6:77059342-77059364 TTGAATTTATAGATAAATTTGGG + Intergenic
1011067998 6:83349891-83349913 GTGAATGTAGATATCAAGTTCGG - Intronic
1011505109 6:88033238-88033260 TTGAATCTACAGATCAAGTTGGG + Intergenic
1011707078 6:90012242-90012264 CTGAATCTACTGATGAATTTAGG + Intronic
1012034540 6:94116209-94116231 TTGAATGTATAAATCAATTTTGG + Intergenic
1012061171 6:94483609-94483631 TTGAATATATAGATAAATTTGGG + Intergenic
1012256136 6:97034577-97034599 TTGAATGTATAGATCATTTTGGG + Intronic
1012332200 6:98006486-98006508 ATGAATCTGTAGATCAAGTTAGG + Intergenic
1012462576 6:99480317-99480339 TTGAATGTGTAGATCAATTTGGG - Intronic
1012580136 6:100857935-100857957 CTGAATCTACAGATCAATTTGGG + Intronic
1012702036 6:102470858-102470880 CTGAATCTATATATCAACTTGGG + Intergenic
1012735630 6:102938009-102938031 CTGAATCTATAGATTAAGTTGGG + Intergenic
1012803968 6:103871124-103871146 CTGAAAATATACAGGAAGTTGGG - Intergenic
1012822184 6:104099795-104099817 TTGAATTGATAGATAAAGTTAGG - Intergenic
1012828450 6:104177268-104177290 GTGCATGTATACATTAAGTTTGG - Intergenic
1013306956 6:108857135-108857157 TTGAATCTATAGATCAAGTTGGG + Intronic
1013440679 6:110163657-110163679 TTGAATCTACAGATCAAGTTGGG - Intronic
1013466496 6:110421810-110421832 TTGAATTTTTAGATTAAGTTAGG - Intergenic
1013683802 6:112555039-112555061 TTGAATCTATAGATCAAGGTGGG + Intergenic
1013965806 6:115953802-115953824 TTGAATAAATAGATTAAGTTGGG - Intronic
1014063196 6:117096835-117096857 CTGAATCTATAAATTACGTTGGG + Intergenic
1014521013 6:122441954-122441976 TTGAATCTATAGATCAGGTTGGG - Intergenic
1014634905 6:123833493-123833515 TTGAAGCTATAGATCAAGTTGGG + Intronic
1014784645 6:125604461-125604483 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1015893752 6:137996563-137996585 GTGAATCTATAGATTAATTTGGG - Intergenic
1015925506 6:138306386-138306408 CTGAATCTATACATCAATTTGGG - Intronic
1016169932 6:140999925-140999947 TTGAATCTATAGGTCAAGTTGGG + Intergenic
1016177085 6:141093678-141093700 TTGAATTTATAGATTAAGTTGGG + Intergenic
1016193233 6:141297002-141297024 CTGAATCTATAGGTTAATTTAGG + Intergenic
1016267768 6:142252543-142252565 CGGAGTTTATAGATGAAGTCAGG + Intergenic
1016533769 6:145088762-145088784 CAGAATGTATCAATGAAATTAGG + Intergenic
1016720693 6:147293875-147293897 CTGAATGTGAAGAAGAAGATAGG + Intronic
1016868314 6:148791287-148791309 CTGAATGTATGGATGAGCATTGG + Intronic
1017419812 6:154262045-154262067 CTGAATGGAAAGATAAAGTAGGG + Intronic
1017624375 6:156333286-156333308 TTGAATCTATATATCAAGTTGGG + Intergenic
1018097571 6:160404516-160404538 TTGAATATATACATCAAGTTGGG - Intronic
1018372224 6:163178664-163178686 ATTAATGTAAAGATTAAGTTTGG - Intronic
1019092254 6:169548254-169548276 CTGAATGTGTAGATCGAATTGGG - Intronic
1019836829 7:3394587-3394609 TTGAATGTATAGATCAATTTGGG + Intronic
1020075732 7:5257508-5257530 TTGAATCTATAGATCAAGTAGGG - Intergenic
1020573730 7:9899071-9899093 CTGAATCTATAGATTTATTTGGG - Intergenic
1020587909 7:10094069-10094091 CGGACTCTATAGATTAAGTTGGG + Intergenic
1020662716 7:11001461-11001483 TTGAATCTATAGATCAAGTTGGG + Intronic
1020979567 7:15051262-15051284 CAAAATGTATAGATTAATTTAGG - Intergenic
1021042580 7:15881512-15881534 TTGAATGTATAGATAACTTTAGG - Intergenic
1021060199 7:16101880-16101902 CTGAATCTATAAATTACGTTGGG - Intronic
1021084402 7:16405003-16405025 CAGAAGGAAGAGATGAAGTTAGG + Intronic
1021086533 7:16426818-16426840 TTGAATTTATAGATTAATTTTGG + Intergenic
1021211457 7:17858561-17858583 TTGAATCTATAGATGAATTTAGG - Intronic
1021331526 7:19344174-19344196 TTGAATGTGTAGATTAAGCTGGG + Intergenic
1021437708 7:20639918-20639940 TTGAATCTATAGATAAATTTGGG + Intronic
1022075117 7:26961099-26961121 TTGAATCTATAGATCAAGTTTGG - Intronic
1022236211 7:28463494-28463516 CTGAATGTGTAGATCAACTGTGG + Intronic
1022296367 7:29058088-29058110 TTGAATCTATGGATCAAGTTGGG + Intronic
1022420672 7:30219839-30219861 TTGACTTTATAGATAAAGTTGGG - Intergenic
1022688955 7:32626686-32626708 CTGAATCTGTAGATCAAGTTGGG - Intergenic
1022900540 7:34805108-34805130 TTGAATTTATAGATCACGTTGGG - Intronic
1022937614 7:35195678-35195700 CTGAATATATAGATCAAGTTGGG + Intergenic
1023193524 7:37609553-37609575 ATGAATGTAAAGAAGAAGTTTGG + Intergenic
1023597032 7:41840899-41840921 CTGAATCCACAGATCAAGTTGGG + Intergenic
1023838756 7:44083722-44083744 TTGAATCTATAGATCAAGCTGGG + Intergenic
1024032441 7:45474383-45474405 TTGAATCTATAGCTTAAGTTGGG - Intergenic
1024221328 7:47289817-47289839 TTGAATCTATAGATGAAATTAGG - Intronic
1024409062 7:49017971-49017993 CTGAATGTATACACCAATTTGGG - Intergenic
1024422174 7:49181670-49181692 CTGAATGTCTAGAGGAACCTAGG - Intergenic
1024482616 7:49880355-49880377 CTGAATTTATAGATAACTTTGGG + Intronic
1024690110 7:51791551-51791573 TTGAATCTATAGATCAAATTGGG - Intergenic
1024924147 7:54595094-54595116 CTGAATTTATAGATTAATTTGGG - Intergenic
1025203346 7:56976049-56976071 TTGAATCTATAGATCAAGTAGGG + Intergenic
1025276912 7:57590543-57590565 CTGAAATTGTAGGTGAAGTTTGG + Intergenic
1025639924 7:63356628-63356650 CTGAATATGTAGATCTAGTTGGG + Intergenic
1025642775 7:63391464-63391486 CTGAATATGTAGATCTAGTTGGG - Intergenic
1025668598 7:63600878-63600900 TTGAATCTATAGATCAAGTAGGG - Intergenic
1025769034 7:64486408-64486430 ATTAATGTAAAGATGAAATTTGG + Intergenic
1026221700 7:68404012-68404034 TTGAATGTTTAGATCAATTTGGG - Intergenic
1027387976 7:77677297-77677319 TTGAATCTATAGATGAAGTTGGG + Intergenic
1027415623 7:77970913-77970935 CTGACTCTATAGATCAATTTGGG + Intergenic
1027582003 7:80009171-80009193 TTGAATCTACAGATTAAGTTTGG - Intergenic
1027928560 7:84500062-84500084 CTGAATCTATAGATCACATTGGG + Intergenic
1027938097 7:84634959-84634981 CTGAATGTATAGATTGCTTTGGG + Intergenic
1028004314 7:85542877-85542899 TTGAATCTATATATCAAGTTGGG + Intergenic
1028294584 7:89112686-89112708 TTAAATCTATAGATCAAGTTGGG + Intronic
1028372516 7:90109918-90109940 TTGAATATATAGATCAAGTTGGG - Intergenic
1028543722 7:91974667-91974689 TTGAATCTGTAGATGAATTTGGG + Intronic
1028627545 7:92894296-92894318 CTGAATCTATAAATTATGTTGGG + Intergenic
1028835795 7:95373704-95373726 CTAAATGTCTGGCTGAAGTTGGG - Intronic
1029316412 7:99719075-99719097 TTAAATGTATAGATCAATTTAGG - Intronic
1029833776 7:103288324-103288346 TTGAATATATAGATCAAGTTGGG + Intergenic
1030180159 7:106698858-106698880 TTGAATCTATAGATCAAGGTAGG + Intergenic
1030257173 7:107523076-107523098 TTGAATTCATAGATCAAGTTGGG + Intronic
1030522538 7:110616155-110616177 CTGAATCTATAGATCACTTTTGG + Intergenic
1030545987 7:110895593-110895615 CTGAATCTATAGAGCAATTTAGG + Intronic
1030623883 7:111822309-111822331 CTCAATGTATAGAGGAAGAAGGG - Intronic
1030790424 7:113720403-113720425 TTGAATCTACAGATCAAGTTTGG - Intergenic
1031112944 7:117633081-117633103 TTGAATCTATAGATGGAGTTGGG + Intronic
1031160678 7:118164096-118164118 CTGAATCTACAGATTAATTTAGG + Intergenic
1031879836 7:127185042-127185064 TTGAATTTATAGACCAAGTTGGG - Intronic
1031924405 7:127625055-127625077 TTGAGTCTATAGATCAAGTTGGG + Intergenic
1032963437 7:137067403-137067425 CTGGAGGAATAGATGCAGTTGGG + Intergenic
1033060494 7:138101847-138101869 TTGAATCTACAGATGAATTTGGG - Intronic
1033864711 7:145674544-145674566 TTGAATTTATAGATAATGTTTGG - Intergenic
1033876494 7:145825448-145825470 CTTAATGTATATATCAATTTAGG + Intergenic
1034019238 7:147623676-147623698 CTGAATCTATAGATCACTTTGGG - Intronic
1034024969 7:147691492-147691514 TTGAATCTGTAGATCAAGTTAGG - Intronic
1034181587 7:149142931-149142953 CTGAATGTAAAACTGAAGATGGG - Intronic
1034354370 7:150440973-150440995 TTGAATGTATAGATCAATTTTGG + Intergenic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1035188790 7:157147100-157147122 CTGAATTGGTAGATCAAGTTGGG + Intronic
1035576689 8:712213-712235 TTGAATGTGTATATCAAGTTAGG + Intronic
1036198079 8:6739355-6739377 TTGAAGATATAGATGAATTTGGG + Intronic
1036210732 8:6838704-6838726 CTGAATGTATAGATTAATTAAGG - Intergenic
1036580383 8:10068852-10068874 CTGAATCTCCAGATCAAGTTGGG + Intronic
1037034495 8:14148675-14148697 CTGATTGTATAGAATGAGTTTGG - Intronic
1037056494 8:14448563-14448585 CTGAGTGTAATCATGAAGTTAGG - Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037105366 8:15100524-15100546 TTGAATCTACAGATAAAGTTGGG - Intronic
1037140364 8:15511940-15511962 TTGAATCTATAGATAAATTTAGG - Intronic
1037369552 8:18160931-18160953 ATAAATTTATAGATCAAGTTGGG - Intergenic
1037956136 8:23060706-23060728 TTGAATGTATAGATCACTTTAGG + Intronic
1038051138 8:23813071-23813093 TTGAACGTATAGATAAATTTAGG + Intergenic
1038097195 8:24327463-24327485 CTGAATCTATAAATTATGTTGGG - Intronic
1038166592 8:25091267-25091289 CTAAATGTTTACATGTAGTTGGG - Intergenic
1038273009 8:26091785-26091807 TTGAATCTACAGATCAAGTTGGG - Intergenic
1038322958 8:26546058-26546080 TCGAATGTATAGATCCAGTTGGG + Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038752513 8:30309154-30309176 TTGAATCTATGGATCAAGTTGGG + Intergenic
1039011125 8:33094100-33094122 CTGAATCCATAGATCAATTTGGG - Intergenic
1039015723 8:33146766-33146788 CTGAATGTACTGATTTAGTTAGG - Intergenic
1039178519 8:34837109-34837131 TTGAATATATAGATAAACTTGGG + Intergenic
1039347121 8:36718050-36718072 TTGATTGTATAGATTAAGTTGGG + Intergenic
1039358776 8:36851144-36851166 TTGAATCTATAGATAAATTTTGG + Intronic
1039624428 8:39032995-39033017 TTGAATGTATAGATCAAGTTGGG + Intronic
1039666074 8:39529789-39529811 CTGAATCTACAGATCAATTTGGG - Intergenic
1039852945 8:41386970-41386992 CTGAATCTATTGGTCAAGTTGGG - Intergenic
1039924873 8:41920624-41920646 TTGAGTCTATAGATCAAGTTGGG - Intergenic
1040450017 8:47536217-47536239 CTGAATCTACAAATCAAGTTGGG - Intronic
1040605909 8:48930936-48930958 CTGGTTGTACAGATGCAGTTTGG + Intergenic
1040624183 8:49126656-49126678 GTGAATCTATAGATGGAGTTGGG + Intergenic
1041093175 8:54323339-54323361 TTGAATCTATAGATTAAGTTGGG - Intergenic
1041391717 8:57353054-57353076 ATGAATGGATACATGAAGTGTGG - Intergenic
1041715606 8:60929147-60929169 CTGACTGCATGGATGTAGTTGGG + Intergenic
1041879148 8:62727766-62727788 TTGAATATATAGACTAAGTTGGG - Intronic
1041892306 8:62883127-62883149 TTGAATCTATAGATTAAGTTGGG + Intronic
1042152819 8:65807102-65807124 CTGAATCTGTAGATCAATTTGGG + Intronic
1042366657 8:67944941-67944963 TTGAATCTATAGATCAAATTGGG - Intergenic
1042371594 8:67997682-67997704 GTGAATCTATAGATCAATTTTGG + Intronic
1042474277 8:69228601-69228623 TTGAATCTATAGATCAATTTGGG - Intergenic
1042493354 8:69428102-69428124 ATGAATGTATAGATAAACTGTGG - Intergenic
1042673808 8:71294662-71294684 TTGAATTTATAGATCAAATTGGG - Intronic
1042689072 8:71476646-71476668 TTGAATGTGTAGATCAATTTGGG - Intronic
1042974351 8:74449396-74449418 TTGAATTTATAGATCAATTTGGG + Intronic
1043234759 8:77849348-77849370 TTGAATTTATAGATCAAGTTAGG + Intergenic
1043662492 8:82761695-82761717 TTGAATTTATAGGTGAATTTGGG - Intergenic
1043793834 8:84510073-84510095 TTGAATCTATGGATAAAGTTGGG + Intronic
1043828898 8:84964092-84964114 TTGAATTTATAGATCAAATTAGG - Intergenic
1043860427 8:85310176-85310198 ATGAATGTATAGATGAACTAAGG - Intergenic
1043945389 8:86245408-86245430 TTGAATCTATAAATGAATTTGGG - Intronic
1044078144 8:87848654-87848676 CTGAATCTATAGATTTATTTGGG - Intergenic
1044322298 8:90816877-90816899 TTGAATCAATAGATTAAGTTGGG + Intronic
1045151368 8:99412117-99412139 CTGAATGTATAAATTACTTTGGG + Intronic
1045400762 8:101815042-101815064 TTGAATCTATAGATCAAGTTAGG - Intronic
1045587221 8:103552025-103552047 CTGAATGTATAAATTACCTTGGG - Intronic
1045851874 8:106710017-106710039 CTGAATATATAGGTGAATTTAGG - Intronic
1046024112 8:108701828-108701850 TTGAATCTATAGATCAATTTGGG - Intronic
1046113611 8:109757647-109757669 TTGAATCTATAGATCAAATTGGG + Intergenic
1046242960 8:111522423-111522445 CTGAATTTGTAGATCAATTTGGG + Intergenic
1046388669 8:113538783-113538805 TTGAATCTACAGATCAAGTTAGG + Intergenic
1046434822 8:114173973-114173995 TTGAATCTATAGATGAATTTGGG - Intergenic
1046484238 8:114864712-114864734 TTGAATCTATAGATCAAGTTGGG - Intergenic
1046926183 8:119791727-119791749 CTGATTGTATTGATGGATTTGGG - Intronic
1047128329 8:121988311-121988333 TTGAATCTATAGATCAAGCTGGG - Intergenic
1048025325 8:130581491-130581513 CTGACTCTATAGATCAACTTGGG + Intergenic
1048175370 8:132147631-132147653 ATGAATGGATGGATGAAGATGGG + Intronic
1048548609 8:135411602-135411624 ATGAATTTATAGAACAAGTTGGG + Intergenic
1048667775 8:136682952-136682974 CTTAATGTGAAGATGAAATTTGG + Intergenic
1048682510 8:136859760-136859782 CTGAATCTATAGATTAAGTTGGG + Intergenic
1049295616 8:141833846-141833868 TTGAATCTATAGATGAACTTCGG + Intergenic
1050002146 9:1088700-1088722 TTGAATGTACAGATTAATTTGGG + Intergenic
1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG + Intronic
1050914961 9:11120403-11120425 TTGAATATATTGATCAAGTTGGG + Intergenic
1050924241 9:11242592-11242614 CTGAATTTATAGATAGAGTTAGG + Intergenic
1050929661 9:11307575-11307597 CTGAATGCTAAGATGAAGCTGGG - Intergenic
1051064092 9:13080895-13080917 TTGAATGTATAAATCAATTTGGG - Intergenic
1051116421 9:13699079-13699101 CTGAATCTATAGATCAAGTGGGG + Intergenic
1051312456 9:15791164-15791186 CTGAATGTATAAATTACCTTGGG + Intronic
1051317239 9:15853142-15853164 TTGAATTTATAGATCAATTTGGG + Intronic
1051797910 9:20895382-20895404 TTGAATGTATAGATGAAGTTAGG + Intronic
1051807660 9:21013570-21013592 CTGAATCTACAGATCAATTTGGG + Intronic
1052405002 9:28048262-28048284 CTGTATTTATAGATTTAGTTGGG - Intronic
1052615611 9:30836482-30836504 TTGACTCTATAGATCAAGTTGGG + Intergenic
1052632847 9:31062722-31062744 TTGAATGAATACTTGAAGTTTGG - Intergenic
1052665532 9:31490427-31490449 ATAAATCTATAGATCAAGTTTGG + Intergenic
1053641196 9:40082203-40082225 TTGAATGTATACATAAAATTTGG - Intergenic
1053764943 9:41383260-41383282 TTGAATGTATACATAAAATTTGG + Intergenic
1054321937 9:63678495-63678517 TTGAATGTATACATAAAATTTGG - Intergenic
1054543555 9:66294417-66294439 TTGAATGTATACATAAAATTTGG + Intergenic
1055015352 9:71611414-71611436 GTAAATCTATAGATCAAGTTGGG - Intergenic
1055378671 9:75682028-75682050 TTGAATTTATAGATCAAGTAGGG - Intergenic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1055906432 9:81299868-81299890 TTGAATCTATATATCAAGTTTGG - Intergenic
1056171739 9:83992048-83992070 TTGAATCTATAGATGAATTTGGG + Intronic
1056241348 9:84650021-84650043 CTGAATCTGTAGATCATGTTGGG + Intergenic
1057264731 9:93607605-93607627 CTAAATGTGTAGATCAAATTGGG + Intronic
1057425683 9:94947542-94947564 CTGAATGTAAAAATGAAATATGG - Intronic
1057473400 9:95378610-95378632 TTGAATTTATAGATCAATTTGGG + Intergenic
1057823738 9:98355648-98355670 CTGAATGTATAGATCAAGTTGGG - Intronic
1057838094 9:98463318-98463340 CTGAATCTGTAGATCAATTTAGG - Intronic
1058205034 9:102094231-102094253 TTGAATCTATAGGTCAAGTTGGG - Intergenic
1058368564 9:104237141-104237163 ATGAATTTGTAGATGAAATTGGG - Intergenic
1058488481 9:105467870-105467892 CTGAAGGTCTGGACGAAGTTGGG + Intronic
1059009004 9:110436222-110436244 CTGTGGTTATAGATGAAGTTAGG - Intronic
1059881738 9:118697899-118697921 TTGAATCTATAGATCAAATTTGG - Intergenic
1059916335 9:119105950-119105972 CTGAATGCTTAGAAGAGGTTAGG - Intergenic
1060433647 9:123573351-123573373 TTGAATCTATAGATCAATTTAGG + Intronic
1060446464 9:123693106-123693128 GTGTATATATAGATGAATTTTGG + Intronic
1060573122 9:124661963-124661985 CTGGATGTGTAGTTGAAGATGGG - Intronic
1060754198 9:126199737-126199759 CTAAATGTATATATTAATTTAGG - Intergenic
1060871324 9:127043094-127043116 CTGGATCTATTGATCAAGTTGGG - Intronic
1061361488 9:130145286-130145308 CTGAATTTGTAGATCAATTTGGG - Intergenic
1061447118 9:130645746-130645768 ATGAATCTATAGATCAATTTGGG + Intergenic
1061651829 9:132056787-132056809 CTGAATGTGTCCATGGAGTTGGG - Intronic
1062072254 9:134562735-134562757 TTGAATGAATAGATTAAGTGAGG - Intergenic
1062188784 9:135235438-135235460 CTGAATGTATATATCAATTAGGG - Intergenic
1062594455 9:137292446-137292468 TTGAATCTGTAGATGAATTTGGG + Intergenic
1202788966 9_KI270719v1_random:65271-65293 TTGAATGTATACATAAAATTTGG - Intergenic
1203442116 Un_GL000219v1:19094-19116 TTGAATGTATAAATGACCTTGGG + Intergenic
1203512924 Un_KI270741v1:138003-138025 TTGAATGTATAAATGACCTTGGG + Intergenic
1186226967 X:7409697-7409719 CTGACTATATAGATTAAGTCTGG + Intergenic
1186668682 X:11746390-11746412 ATGAATCTATAGATCAATTTAGG + Intergenic
1186911054 X:14166219-14166241 TTGAATTTATAGATTAATTTTGG + Intergenic
1187335803 X:18380463-18380485 TTGAATCTATAGATCAAATTGGG + Intergenic
1187436057 X:19270620-19270642 CTGAATCTCTAAATGAATTTGGG - Intergenic
1187808758 X:23152054-23152076 TTGAATTTATAGATCAATTTGGG - Intergenic
1188180936 X:27054672-27054694 TTGAATGTATACATCAATTTTGG + Intergenic
1188234491 X:27710357-27710379 TTGAATATATAGATAAATTTGGG + Intronic
1188726353 X:33588339-33588361 CTGAATACATAGATTAAGTTTGG + Intergenic
1189424765 X:40888871-40888893 TTAAATCTATAGATCAAGTTGGG + Intergenic
1189527740 X:41842740-41842762 CTGAATCTATAGATCAATTTGGG + Intronic
1189548176 X:42065563-42065585 TTGAATCTATAGATTAAGTTAGG + Intergenic
1189891944 X:45611895-45611917 TTTAATGGATAGATGAAGTTGGG + Intergenic
1190399491 X:50018041-50018063 CTGAACCTGTAGATCAAGTTGGG + Intronic
1190402456 X:50051582-50051604 TTGAATCTATAGATCAAGCTGGG + Intronic
1190547119 X:51539608-51539630 TTGAATCTATAGATCAAGTTGGG + Intergenic
1190547855 X:51548301-51548323 TTGAATGTATACATCAATTTGGG + Intergenic
1190551778 X:51589871-51589893 CTGAATCTATAGATCAAGTTGGG - Intergenic
1190625458 X:52333737-52333759 TTGAATCTATACATTAAGTTTGG + Intergenic
1190836749 X:54108355-54108377 TTGAATTTATAGATTAATTTGGG - Intronic
1190965363 X:55295151-55295173 CTGAATCTATAAATTACGTTGGG + Intergenic
1191173821 X:57479055-57479077 ATGAATGTATAAATGACCTTGGG + Intronic
1191684520 X:63875976-63875998 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1191691998 X:63949768-63949790 CTGAATCTGTAGATTCAGTTGGG + Intergenic
1191752849 X:64562133-64562155 CTGAATTTATAAATTAATTTGGG - Intergenic
1192275869 X:69630373-69630395 CTGAATGAATAGGTAAAGTCAGG - Intronic
1192303408 X:69930958-69930980 TTGAATCTATAGATCAATTTTGG - Intronic
1192375864 X:70561078-70561100 TTGAATCTATAGATCAATTTGGG + Intronic
1192540465 X:71965675-71965697 TTGAATCCATAGATCAAGTTGGG + Intergenic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1192774173 X:74224432-74224454 CTGAATTTGTAGATTAATTTTGG - Intergenic
1192931691 X:75813554-75813576 CTGAATGTATAGATTGCTTTAGG - Intergenic
1193139716 X:78014889-78014911 CAAAATGGATAGATGAAGTATGG - Intronic
1193399274 X:81022451-81022473 TTGAATCTATAGATCAAGTTGGG - Intergenic
1193967893 X:88011065-88011087 CTTAATGAAAAGATGAAGTTTGG - Intergenic
1194234801 X:91369623-91369645 TTGAATCTATAGATCAAGTTAGG + Intergenic
1194750270 X:97676671-97676693 CTGAATCTATAGATTACTTTGGG + Intergenic
1194891078 X:99380051-99380073 CTGAATACATAAATGAAGTTGGG - Intergenic
1194970764 X:100341081-100341103 CAGAATGTTTAGATGGACTTGGG - Intronic
1195209887 X:102644370-102644392 CTGAATTTATAGATTAAATTTGG + Intergenic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1195293842 X:103456114-103456136 CTGAATGTATAAATTACCTTGGG + Intergenic
1195300133 X:103521536-103521558 CTGAATCTATAGATCAGTTTTGG - Intergenic
1195587339 X:106579931-106579953 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1195785120 X:108511386-108511408 CTGAATGCTTAGATCAATTTGGG - Intronic
1195788311 X:108552711-108552733 CTGAATCTATAGATAAATTGGGG - Intronic
1195806056 X:108767138-108767160 CTGAATCTATAGATTAATTCGGG + Intergenic
1195856835 X:109340996-109341018 CTCAAAGTATATATGAAGTGGGG + Intergenic
1196370174 X:114968822-114968844 CTGAATATATAGATTACTTTGGG - Intergenic
1196495198 X:116316864-116316886 CTGAAGGTGGAGATGAAATTAGG + Intergenic
1197352720 X:125398158-125398180 CTGAATTTATAAATTGAGTTAGG + Intergenic
1197539440 X:127738579-127738601 TTGAATGTATAGATCAAGTTGGG - Intergenic
1197638363 X:128941633-128941655 CTGAATGATAAGATGAGGTTTGG - Intergenic
1197730835 X:129808143-129808165 TTGAATCTATAGATCAATTTGGG - Intronic
1198141986 X:133813504-133813526 CTGAAAGGATAGGTAAAGTTAGG + Intronic
1198726503 X:139683408-139683430 TTGAATCTGTAGATGAATTTAGG - Intronic
1198842549 X:140874146-140874168 TTGAATCTATATATCAAGTTAGG - Intergenic
1198842630 X:140875311-140875333 GTGAATGGATAAATGAAGTTTGG + Intergenic
1198888893 X:141370196-141370218 CTGAATCTATAAATTAATTTGGG - Intergenic
1199128488 X:144155885-144155907 TTGAATTTATAGATCAATTTGGG - Intergenic
1199147447 X:144385621-144385643 TTCAATTTATAGATGAATTTGGG + Intergenic
1199444443 X:147905717-147905739 TTGAATCTATAGATCAAGTAGGG - Intergenic
1199613786 X:149639516-149639538 TTAAATATATAGATCAAGTTAGG - Intergenic
1199702614 X:150394510-150394532 CTGAATCTATAGATCAAATTGGG + Intronic
1200853566 Y:7911519-7911541 CTGCCATTATAGATGAAGTTTGG + Intergenic
1201899223 Y:19030475-19030497 CTTAATCTATAGATCAATTTAGG + Intergenic