ID: 1035149729

View in Genome Browser
Species Human (GRCh38)
Location 7:156859880-156859902
Sequence CCTATAAGTCTCCTGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035149729_1035149733 30 Left 1035149729 7:156859880-156859902 CCTGACTTCAGGAGACTTATAGG 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1035149733 7:156859933-156859955 AAAGAATAGAAAAAGATCAATGG No data
1035149729_1035149732 5 Left 1035149729 7:156859880-156859902 CCTGACTTCAGGAGACTTATAGG 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1035149732 7:156859908-156859930 AATAATCAAGACTATGATTTTGG 0: 1
1: 0
2: 2
3: 45
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035149729 Original CRISPR CCTATAAGTCTCCTGAAGTC AGG (reversed) Intronic
900012175 1:124291-124313 ACTGTAAGTCTCCTGAAAGCAGG + Intergenic
900042235 1:480281-480303 ACTGTAAGTCTCCTGAAAGCAGG + Intergenic
900063675 1:715277-715299 ACTGTAAGTCTCCTGAAAGCAGG + Intergenic
901216856 1:7559862-7559884 TCTAGAATTCTCCTGCAGTCAGG - Intronic
903606669 1:24579980-24580002 CCTATGAATCTCCTGGGGTCTGG + Intronic
903671520 1:25038618-25038640 AATATAAGTCTCATGAGGTCAGG - Intergenic
905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG + Intergenic
906568794 1:46818904-46818926 ACTACAAGCCTCCTGAAGGCAGG - Exonic
906926546 1:50123800-50123822 CCTATTTGTCTCATGAAGCCAGG - Intronic
907251838 1:53144656-53144678 CTTATAAGCTTCCTGAAGGCAGG - Intergenic
908550857 1:65207358-65207380 CCTATAAGCTTCCTGAGGGCAGG + Intronic
909085970 1:71170767-71170789 ACTATAAGTCTCATGAGGCCTGG - Intergenic
912853233 1:113145167-113145189 CCTATGGATCTCCTGAGGTCAGG - Intergenic
913175577 1:116270097-116270119 GCTATTATTCTCCTGAAGACAGG + Intergenic
916496237 1:165350414-165350436 GCTATAAGCCTCCTGAAGGCAGG + Intronic
918056867 1:181029441-181029463 CGAATAAGTCTCATGAAATCTGG + Intergenic
918385583 1:184004282-184004304 CATAGAGGTGTCCTGAAGTCTGG + Intronic
919052381 1:192526734-192526756 AATATAAGTTTCATGAAGTCAGG + Intergenic
920675526 1:208035903-208035925 CCTATAAATCTGCAGAAGCCTGG + Intronic
923468956 1:234273275-234273297 CCTATAAGTCTTCAGAAGCTTGG + Intronic
924253167 1:242156266-242156288 CCTATCAGTCTGCTGTATTCAGG - Intronic
1064077375 10:12279962-12279984 CCTATAAATCTCCCCAAGACAGG + Intergenic
1068499071 10:57820253-57820275 CCTACCAGTGTCCTTAAGTCTGG + Intergenic
1068965343 10:62906380-62906402 ACTATAAGTTCCATGAAGTCAGG - Intronic
1071387235 10:85133738-85133760 CCTGAAAGTCTCCTGAATTGGGG + Intergenic
1073255408 10:102147628-102147650 CCTAAAAGTCTCCCCAAGGCAGG - Intronic
1075889599 10:125935272-125935294 ACTATAAGCTTCCTGAAGGCAGG + Intronic
1076309471 10:129494192-129494214 CCTCTTAGTTTCCTGAATTCAGG + Intronic
1076968506 11:116497-116519 ACTGTAAGTCTCCTGAAAGCAGG + Intergenic
1077472869 11:2772428-2772450 CATCTCAGGCTCCTGAAGTCAGG + Intronic
1078395319 11:10976280-10976302 GCTATAAGTCACCAGAAGTTTGG - Intergenic
1080104457 11:28497501-28497523 CTTATAAGTCTTCTGAATGCAGG + Intergenic
1081093011 11:38896294-38896316 GATGTAAGTCTCCAGAAGTCTGG - Intergenic
1082207321 11:49453777-49453799 CCTCTTAGTCTCCTGATTTCTGG + Intergenic
1082770820 11:57206231-57206253 ACCATAAGTTTCTTGAAGTCAGG + Intergenic
1083354699 11:62057593-62057615 CTTGTAAGTTTCATGAAGTCAGG + Intergenic
1084764233 11:71297530-71297552 CCTAAAGATCTCCTGAAGCCAGG - Intergenic
1085093757 11:73741918-73741940 CCTATATGTCTCCTGGAGGCAGG - Intronic
1086516340 11:87617804-87617826 GCTTTAAATCTCCTGAAGACTGG - Intergenic
1086645514 11:89214794-89214816 CCTCTTAGTCTCCTGATTTCTGG - Intronic
1086647953 11:89247953-89247975 CCTCTTAGTCTCCTGATTTCTGG - Intronic
1086734648 11:90290786-90290808 CATCTAATTCTACTGAAGTCAGG - Intergenic
1087029205 11:93685438-93685460 CCTATTAGACTCCTCAAGTGAGG + Intronic
1089928437 11:122283763-122283785 TCTTTAAGTCTCCAGAAATCTGG - Intergenic
1093068494 12:14684259-14684281 CCTATACATTTCCTGAACTCTGG + Intronic
1093325713 12:17772283-17772305 CCCATCAGTATCCTGAATTCAGG - Intergenic
1096971587 12:55670688-55670710 GCTCTATTTCTCCTGAAGTCTGG + Intergenic
1098182435 12:67862261-67862283 GCTTTAAGTGTCATGAAGTCAGG - Intergenic
1099979527 12:89582606-89582628 CATCTCAGCCTCCTGAAGTCTGG - Intergenic
1102658771 12:114506436-114506458 CCAATAAGTCTCCTGGGATCTGG - Intergenic
1107523109 13:41202881-41202903 CCTATTAGTCTCCCAAAGTATGG - Intergenic
1112473609 13:99711259-99711281 CCTCCAAGTCTCCAGAAGTGTGG - Intronic
1114417417 14:22554100-22554122 CCTGCAGGTCTCCTGCAGTCCGG - Intergenic
1114619645 14:24087736-24087758 TCTGTAAGTTTCTTGAAGTCAGG - Intronic
1115408696 14:33048424-33048446 CCTTTCAGTTCCCTGAAGTCAGG + Intronic
1117487460 14:56212758-56212780 CCTACAAGTATCCTGGAGGCTGG + Intronic
1121482242 14:94288159-94288181 GCTATAAGTTTCCTGAAGGCAGG - Intronic
1123137548 14:106043287-106043309 CCGATAAATCACCTGAGGTCAGG + Intergenic
1123953621 15:25311064-25311086 CCTGTAATCCTCCTGAGGTCAGG - Intergenic
1124563945 15:30798320-30798342 CGCATAAGTCTCCTGAACTGGGG + Intergenic
1128991932 15:72267977-72267999 CCGGTAGGTCACCTGAAGTCGGG - Intronic
1133442519 16:5832629-5832651 CCTGTAAGTTCCCTGAAGGCAGG + Intergenic
1134511966 16:14855759-14855781 CCTGTAAGTTCCCTGAGGTCAGG + Intronic
1134699607 16:16254259-16254281 CCTGTAAGTTCCCTGAGGTCAGG + Intronic
1134972222 16:18540412-18540434 CCTGTAAGTTCCCTGAGGTCAGG - Intronic
1142331904 16:89460328-89460350 CCTATAAATGTCCTGAGGTCAGG + Intronic
1142350756 16:89578461-89578483 CCTAAAAGTCTCCTGGTGGCCGG + Intronic
1142452171 16:90182623-90182645 ACTGTAAGTCTCCTGAAAGCAGG - Intergenic
1143558065 17:7674853-7674875 CCTATGAGCCGCCTGAGGTCTGG - Exonic
1151812392 17:76452475-76452497 CTTAGAAGTCCCCTCAAGTCGGG + Intronic
1155300075 18:24420936-24420958 CCTTCAAATCTCCTGAAGTCAGG + Intergenic
1157067247 18:44366519-44366541 CATTTAAGTCTCCTGAAGCTGGG + Intergenic
1160645315 19:186422-186444 ACTGTAAGTCTCCTGAAAGCAGG + Intergenic
1163002229 19:14375626-14375648 CCTCTTAGTCTCCTGGGGTCTGG - Intergenic
1164322159 19:24159055-24159077 CCTATAAGTCTCTTGCTGTATGG - Intergenic
1164810708 19:31153305-31153327 ACTATAAGTCTTCTAAACTCTGG + Intergenic
929322686 2:40564190-40564212 CCTACAAGCCCCTTGAAGTCAGG - Intronic
932488239 2:72099928-72099950 CCTATGTGCCTCCTGAAGTGAGG + Intergenic
937552546 2:123112563-123112585 CTTACAAGTCTCCTGACGGCAGG - Intergenic
939114352 2:138043510-138043532 CCTTTAAGTCCCTTTAAGTCTGG - Intergenic
939124898 2:138165757-138165779 CCTATAGGTCCCCTGATGGCAGG - Intergenic
941875480 2:170428392-170428414 CCTAAAAGACCCCTGAAGTGGGG - Intronic
943279047 2:185907983-185908005 CCTAGAAGTGTCCTTTAGTCTGG - Intergenic
943657378 2:190523992-190524014 CCCATGAGTCTACTGAACTCCGG - Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
948337500 2:237221839-237221861 CCTATTAGGCTCCTAGAGTCAGG - Intergenic
949083613 2:242127266-242127288 ACTGTAAGTCTCCTGAAAGCAGG - Intergenic
1168993783 20:2117032-2117054 TCTACATGGCTCCTGAAGTCTGG + Exonic
1169998009 20:11580979-11581001 ACTATAAGTATCCTGAAGGCAGG - Intergenic
1170534597 20:17327419-17327441 ACTGTAAGTCTCGTGAAGGCAGG + Intronic
1172809067 20:37634092-37634114 CGTGTGAGTTTCCTGAAGTCAGG + Intergenic
1174149892 20:48478514-48478536 CATATCAGTCTCCTGAAATGAGG + Intergenic
949783836 3:7718908-7718930 CTTAGAAGTCTCTTGAAGGCTGG + Intronic
951636826 3:24788205-24788227 CCTAAAAGGCTCCTCAAGTAAGG + Intergenic
954651051 3:52162936-52162958 TTTATTAGTCACCTGAAGTCCGG + Intergenic
954792145 3:53141453-53141475 CCGATAAGTACCCTGAAGACAGG + Intergenic
956609575 3:71108840-71108862 CTCATAAGCCTCCTGAAGGCAGG + Intronic
959969507 3:112393465-112393487 CCTTTAATTCTAATGAAGTCTGG + Intergenic
961092124 3:124122328-124122350 CCAAGAAGGCTCCTGCAGTCTGG - Intronic
963901689 3:150739042-150739064 CCTTTAAGTCTTCTGGATTCAGG + Intergenic
966585628 3:181620936-181620958 CCTATGACTCTCCTGAGGTCAGG + Intergenic
968372368 3:198233104-198233126 ACTGTAAGTCTCCTGAAAGCAGG - Intergenic
969156495 4:5215516-5215538 TCTTTAAGTCTCCTGGAGACAGG + Intronic
969199431 4:5590844-5590866 ACTATAAGTTTCCTGAGGGCTGG - Intronic
978649028 4:110978158-110978180 CCTATAAGCTTTCTGAAGGCAGG + Intergenic
979449894 4:120858326-120858348 CCTAAAGATATCCTGAAGTCTGG - Intronic
981496947 4:145404470-145404492 ACTATAAGTTTCATGAAGGCAGG + Intergenic
981679647 4:147381869-147381891 CCTATAGGTCCCCTGATGGCAGG - Intergenic
982277834 4:153655188-153655210 TCTAAAAGTCTCCTGTTGTCTGG - Intergenic
987637160 5:20558626-20558648 CCCTTCAGTCTCCTCAAGTCTGG + Intronic
990146600 5:52767895-52767917 TCTATAACTCTACTGAATTCAGG + Intergenic
993997185 5:94736958-94736980 ACTATAAGCATCATGAAGTCAGG - Intronic
994387419 5:99148421-99148443 CCTATCAGTGTCCTGTATTCAGG + Intergenic
998731593 5:145083215-145083237 ACTATAAGTCTTCTGAAGAGAGG - Intergenic
999988392 5:157026385-157026407 CCTATAAGTCTCTTGCTGTATGG - Intergenic
1000147272 5:158465798-158465820 GCTATCAGTCCCCTGAAATCAGG + Intergenic
1002731608 5:181338648-181338670 ACTGTAAGTCTCCTGAAAGCAGG - Intergenic
1004258428 6:14086100-14086122 CCTATAAGACTCTGAAAGTCAGG + Intergenic
1005671787 6:28113666-28113688 CCTTCAAGCCTCCAGAAGTCAGG + Intergenic
1007149173 6:39671075-39671097 ACTATAAGCTTCTTGAAGTCAGG - Intronic
1008548317 6:52603285-52603307 CCTAGAACTCCCCAGAAGTCAGG - Intergenic
1009530515 6:64807727-64807749 TCTATAAATCACCTGAAGTATGG + Intronic
1011845871 6:91562203-91562225 CCTACAAGTCCCCTGATGTCAGG - Intergenic
1012069406 6:94593545-94593567 CCTTGAAGTCTCATCAAGTCAGG + Intergenic
1012469005 6:99548689-99548711 CCTATAATCCTCCTGTAGGCAGG + Intronic
1013228660 6:108140881-108140903 ACTATAAGTTTCATGAAGACAGG + Intronic
1013279398 6:108621759-108621781 TCTGTAGCTCTCCTGAAGTCAGG + Intronic
1015890318 6:137963757-137963779 CCTATAAGACTGCTGAGGCCGGG + Intergenic
1021332734 7:19358704-19358726 CTTTTAAGTCACCTTAAGTCAGG - Intergenic
1027839745 7:83293857-83293879 GCTTTAAGCCTACTGAAGTCTGG + Intergenic
1031904688 7:127447389-127447411 CCTATAGATCTCCTGATGACAGG - Intergenic
1033213990 7:139481037-139481059 CATATAAGGCTCCTGAAGCTGGG - Intronic
1035149729 7:156859880-156859902 CCTATAAGTCTCCTGAAGTCAGG - Intronic
1035511907 8:195631-195653 ACTGTAAGTCTCCTGAAAGCAGG + Intronic
1036604528 8:10293786-10293808 CCTGTGAGTCTCCTGATGACTGG + Intronic
1039981712 8:42414006-42414028 CCTTGAAGGCTCCTGGAGTCTGG - Intergenic
1045673613 8:104585451-104585473 CGGGTGAGTCTCCTGAAGTCAGG - Intronic
1047066776 8:121292734-121292756 CCTATAAGTTTCTTGAAATGAGG - Intergenic
1049888932 9:49034-49056 ACTGTAAGTCTCCTGAAAGCAGG + Intergenic
1051374626 9:16390500-16390522 ACCATAAGTTGCCTGAAGTCTGG - Intergenic
1051920243 9:22256685-22256707 CCTATTGGTCTCCTGATGGCAGG + Intergenic
1055214661 9:73844384-73844406 CAAACATGTCTCCTGAAGTCAGG - Intergenic
1056500262 9:87202126-87202148 CCTATAAGTGGCTTGAAGACCGG + Intergenic
1057106418 9:92421932-92421954 CCTATTAATCTCCCAAAGTCTGG - Intronic
1059961146 9:119565555-119565577 TCTACAAGTCTCCTAAAGTATGG + Intergenic
1059986033 9:119821533-119821555 TCAGTAAGTCTCCTCAAGTCAGG + Intergenic
1061919627 9:133775829-133775851 CCTATAACTCTCCAGGAGCCTGG - Intronic
1062756014 9:138291158-138291180 ACTGTAAGTCTCCTGAAAGCAGG - Intergenic
1194333408 X:92614665-92614687 CCTAAATGTCCCCTGATGTCAGG + Intronic
1197996803 X:132385777-132385799 CCAATAAGTTTTCTCAAGTCTGG + Intronic
1200390556 X:155941521-155941543 ACCATAATTCTCCTGAAGTATGG - Intronic
1200642093 Y:5733671-5733693 CCTAAATGTCCCCTGATGTCAGG + Intronic
1200683434 Y:6239646-6239668 CCAGTAAATCACCTGAAGTCAGG + Intergenic
1201049200 Y:9914739-9914761 CCAGTAAATCACCTGAAGTCAGG - Intergenic