ID: 1035154811

View in Genome Browser
Species Human (GRCh38)
Location 7:156903834-156903856
Sequence TTGCAGACCTAGAATTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035154811_1035154817 6 Left 1035154811 7:156903834-156903856 CCATCCTAATTCTAGGTCTGCAA No data
Right 1035154817 7:156903863-156903885 AAGATGGAGCAGGTTCTCGTGGG No data
1035154811_1035154816 5 Left 1035154811 7:156903834-156903856 CCATCCTAATTCTAGGTCTGCAA No data
Right 1035154816 7:156903862-156903884 GAAGATGGAGCAGGTTCTCGTGG No data
1035154811_1035154813 -10 Left 1035154811 7:156903834-156903856 CCATCCTAATTCTAGGTCTGCAA No data
Right 1035154813 7:156903847-156903869 AGGTCTGCAAGCCAAGAAGATGG No data
1035154811_1035154814 -4 Left 1035154811 7:156903834-156903856 CCATCCTAATTCTAGGTCTGCAA No data
Right 1035154814 7:156903853-156903875 GCAAGCCAAGAAGATGGAGCAGG No data
1035154811_1035154818 7 Left 1035154811 7:156903834-156903856 CCATCCTAATTCTAGGTCTGCAA No data
Right 1035154818 7:156903864-156903886 AGATGGAGCAGGTTCTCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035154811 Original CRISPR TTGCAGACCTAGAATTAGGA TGG (reversed) Intergenic
No off target data available for this crispr