ID: 1035157765

View in Genome Browser
Species Human (GRCh38)
Location 7:156928264-156928286
Sequence GCTCAAGTATGTGCACTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035157761_1035157765 7 Left 1035157761 7:156928234-156928256 CCTGATAAGATCTCAGGAGCTGG 0: 38
1: 178
2: 299
3: 290
4: 305
Right 1035157765 7:156928264-156928286 GCTCAAGTATGTGCACTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035157765 Original CRISPR GCTCAAGTATGTGCACTAAG AGG Intergenic
No off target data available for this crispr