ID: 1035158569

View in Genome Browser
Species Human (GRCh38)
Location 7:156934476-156934498
Sequence GCGCCCGGCCCAAGATTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035158559_1035158569 19 Left 1035158559 7:156934434-156934456 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG No data
1035158555_1035158569 26 Left 1035158555 7:156934427-156934449 CCACCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG No data
1035158556_1035158569 23 Left 1035158556 7:156934430-156934452 CCCGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG No data
1035158561_1035158569 13 Left 1035158561 7:156934440-156934462 CCTCCCAAAGTGCTGGGATGACA 0: 3057
1: 295903
2: 265941
3: 152999
4: 135364
Right 1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG No data
1035158564_1035158569 9 Left 1035158564 7:156934444-156934466 CCAAAGTGCTGGGATGACAGGTG 0: 706
1: 72430
2: 207629
3: 250777
4: 204884
Right 1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG No data
1035158557_1035158569 22 Left 1035158557 7:156934431-156934453 CCGCCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG No data
1035158563_1035158569 10 Left 1035158563 7:156934443-156934465 CCCAAAGTGCTGGGATGACAGGT 0: 712
1: 76440
2: 306224
3: 244743
4: 149399
Right 1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035158569 Original CRISPR GCGCCCGGCCCAAGATTCCA GGG Intergenic
No off target data available for this crispr