ID: 1035160012

View in Genome Browser
Species Human (GRCh38)
Location 7:156943514-156943536
Sequence GACTTACGGCCTCACGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035160012_1035160018 19 Left 1035160012 7:156943514-156943536 CCATCACCGTGAGGCCGTAAGTC No data
Right 1035160018 7:156943556-156943578 ACCTACCTAGCTCAGGTTCCTGG No data
1035160012_1035160015 12 Left 1035160012 7:156943514-156943536 CCATCACCGTGAGGCCGTAAGTC No data
Right 1035160015 7:156943549-156943571 ACTTCCCACCTACCTAGCTCAGG No data
1035160012_1035160020 23 Left 1035160012 7:156943514-156943536 CCATCACCGTGAGGCCGTAAGTC No data
Right 1035160020 7:156943560-156943582 ACCTAGCTCAGGTTCCTGGCAGG No data
1035160012_1035160022 30 Left 1035160012 7:156943514-156943536 CCATCACCGTGAGGCCGTAAGTC No data
Right 1035160022 7:156943567-156943589 TCAGGTTCCTGGCAGGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035160012 Original CRISPR GACTTACGGCCTCACGGTGA TGG (reversed) Intergenic
No off target data available for this crispr