ID: 1035160216

View in Genome Browser
Species Human (GRCh38)
Location 7:156944614-156944636
Sequence CAGATCCTGCAGCTCCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035160205_1035160216 29 Left 1035160205 7:156944562-156944584 CCTCTTCTTCTCTGACAGGGAAG No data
Right 1035160216 7:156944614-156944636 CAGATCCTGCAGCTCCTGGACGG No data
1035160211_1035160216 -7 Left 1035160211 7:156944598-156944620 CCCCAGCCTCTCTTGGCAGATCC No data
Right 1035160216 7:156944614-156944636 CAGATCCTGCAGCTCCTGGACGG No data
1035160210_1035160216 -4 Left 1035160210 7:156944595-156944617 CCTCCCCAGCCTCTCTTGGCAGA No data
Right 1035160216 7:156944614-156944636 CAGATCCTGCAGCTCCTGGACGG No data
1035160213_1035160216 -9 Left 1035160213 7:156944600-156944622 CCAGCCTCTCTTGGCAGATCCTG No data
Right 1035160216 7:156944614-156944636 CAGATCCTGCAGCTCCTGGACGG No data
1035160212_1035160216 -8 Left 1035160212 7:156944599-156944621 CCCAGCCTCTCTTGGCAGATCCT No data
Right 1035160216 7:156944614-156944636 CAGATCCTGCAGCTCCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035160216 Original CRISPR CAGATCCTGCAGCTCCTGGA CGG Intergenic
No off target data available for this crispr