ID: 1035163823

View in Genome Browser
Species Human (GRCh38)
Location 7:156971584-156971606
Sequence TACCTTGGCCTCCCAAACAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1987
Summary {0: 1, 1: 2, 2: 28, 3: 318, 4: 1638}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035163819_1035163823 13 Left 1035163819 7:156971548-156971570 CCGTATGTTATACAGGCTGGCCT 0: 1
1: 2
2: 35
3: 708
4: 4492
Right 1035163823 7:156971584-156971606 TACCTTGGCCTCCCAAACACCGG 0: 1
1: 2
2: 28
3: 318
4: 1638
1035163820_1035163823 -7 Left 1035163820 7:156971568-156971590 CCTCAAGTGATCCTCTTACCTTG 0: 10
1: 362
2: 3745
3: 18605
4: 57740
Right 1035163823 7:156971584-156971606 TACCTTGGCCTCCCAAACACCGG 0: 1
1: 2
2: 28
3: 318
4: 1638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035163823 Original CRISPR TACCTTGGCCTCCCAAACAC CGG Exonic
900115907 1:1027844-1027866 CACCTTGGCCACCCTCACACTGG + Intronic
900178522 1:1301506-1301528 GGCCTTGGCCTCCCAAACGCTGG + Intronic
900271377 1:1791017-1791039 TCCCTTGGCCTCCCCTCCACAGG + Intronic
900531992 1:3159018-3159040 CGCCTTGGCCTCCCAAATGCTGG + Intronic
901176101 1:7300426-7300448 TGCCTTGGCCTCCCAAAGTATGG - Intronic
901472359 1:9466383-9466405 TACCTCGGCCTCCCAAAGTGCGG - Intergenic
901549883 1:9988241-9988263 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
901575705 1:10199099-10199121 TGCCTTGGCCTCCCAAAATGTGG + Intergenic
901583441 1:10265482-10265504 CACCTTGACCTCCCAAAGAGTGG + Intronic
901693844 1:10991853-10991875 TGCCTTGGCCTCCCAAACCTGGG - Intergenic
901838654 1:11940011-11940033 CACCTTGGCCCCCCAAAGACCGG + Intronic
902217096 1:14941166-14941188 TGCCTCGGCCTCCCAAAGTCTGG + Intronic
902278509 1:15357374-15357396 TGCCTCGGCCTCCCAAATTCTGG - Intronic
902355342 1:15894781-15894803 TGCCTTGGCCTCCCAAATGCTGG + Intronic
902842440 1:19083766-19083788 TACCTTGGCCTCCCAAGTGCTGG + Intronic
903081992 1:20817922-20817944 CTCCTTGGCCTCCCAAAGACGGG + Intronic
903092492 1:20933946-20933968 TACTTTGGCCTCCCAAAATGTGG + Intronic
903179850 1:21599682-21599704 TCCCTTGCCCTCCCCAACCCGGG + Intronic
903232329 1:21929519-21929541 TACCTTGGTCTCCCAAAGTGTGG + Intronic
903243171 1:21997437-21997459 CACCTTGGCCTCCCAAAGTGTGG - Intronic
903289882 1:22303394-22303416 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
903495579 1:23764636-23764658 TACCTTGGCCTCCAAAGTGCAGG + Intergenic
903561577 1:24231969-24231991 TACCTGGGCCTCAGAACCACAGG - Intergenic
903591170 1:24457009-24457031 CACCTTGGCCTCCAAAGTACTGG + Intronic
903593754 1:24478478-24478500 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
903616460 1:24662362-24662384 TGCCTTGGCCTCCCAAATGCTGG + Intronic
903781904 1:25826081-25826103 TGCCTCGGCCTCCCAAATGCTGG + Intronic
903806242 1:26007578-26007600 CACCTCAGCCTCCCAAGCACTGG + Intergenic
903807338 1:26014907-26014929 CACCTCGGCCTCCCAAATGCTGG - Intergenic
903871520 1:26438473-26438495 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
903921725 1:26804478-26804500 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
903948713 1:26981104-26981126 TGCCTTGGCCTCCCAAAGTATGG + Intergenic
903953732 1:27011273-27011295 TACCTTGGCTTCCCACAGAGGGG - Intronic
903961389 1:27059930-27059952 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
903975142 1:27144758-27144780 CACCTTGGCCTCCCAAAGTGCGG - Intronic
903990885 1:27268663-27268685 CACCTCGGCCTCCCAAGTACTGG + Intronic
904020621 1:27461908-27461930 CACCTTGGCCTCCCAAAGTGTGG + Intronic
904114676 1:28153043-28153065 CACCTTGGCCTCCCAAATGCTGG - Intronic
904133747 1:28294944-28294966 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
904161824 1:28527759-28527781 CACCTTGGCCTCCCAAAGTGCGG - Intronic
904366048 1:30011480-30011502 TGCCTTGGCCTCTCAAACTGTGG + Intergenic
904521304 1:31098216-31098238 AACCTTGGCCTCCCAAGTGCTGG + Intergenic
904628189 1:31820562-31820584 CACCTTAGCCTCCCAATAACTGG - Intergenic
904642614 1:31941711-31941733 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
904650474 1:32002039-32002061 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
904656163 1:32049302-32049324 TACCTTGGCCTTCCAAAGTTTGG + Intronic
904812722 1:33173952-33173974 CACCTTGGCCTCCCAAGAGCTGG + Intronic
905059131 1:35124227-35124249 CACCTTGGCCTCCCAAAACATGG + Intergenic
905063446 1:35159443-35159465 TGCCTTGGCCTCCCACAGGCTGG + Intergenic
905113209 1:35613287-35613309 CACCTTGGCCTCCCAAAGTGCGG - Intronic
905161998 1:36044688-36044710 CACCTTGGCCTCCCAAAGTGCGG + Intronic
905238176 1:36564868-36564890 TACCTTGGCCTCCCAAAATGTGG + Intergenic
905332852 1:37219122-37219144 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
905559091 1:38912217-38912239 TGCCTCAGCCTCCCAAAGACTGG + Intronic
905562596 1:38939411-38939433 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
905645176 1:39620297-39620319 CACCTTGGCCTCCCAAAGTGAGG - Intergenic
905754377 1:40496448-40496470 TTCCTTGACCTCCCAATTACAGG - Intergenic
905986684 1:42291550-42291572 TGCCTTGGCCTCCCAAATGCTGG - Intronic
906156271 1:43615812-43615834 CACCTTGGCCTCCCAAGTGCTGG + Intronic
906162174 1:43658318-43658340 TGCCTTGGCCTCCCAAATGCTGG + Intronic
906171449 1:43729326-43729348 TTCCTTGGCCTCCCAAAGTACGG + Intronic
906322150 1:44823479-44823501 TACCTTGGCCCACCAAAGGCTGG + Intronic
906452815 1:45966480-45966502 CACCTTGGCCTCCCAAAGTGTGG - Intronic
906469659 1:46117818-46117840 TACCCTGGCCTCCCAAGTGCTGG - Intronic
906483190 1:46214616-46214638 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
907006776 1:50922208-50922230 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
907024111 1:51098378-51098400 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
907024409 1:51101360-51101382 CACCTTGGCCTCCCAAACGCTGG - Intergenic
907026827 1:51128441-51128463 CACCTTGGCCTCCCAAAGTGCGG - Intronic
907038829 1:51239662-51239684 TCCCTCAGCCTCCCAAAGACTGG + Intronic
907117566 1:51982502-51982524 TGCCTCGGCCTCCCAAAGTCTGG - Intronic
907120247 1:52002089-52002111 TGCCTCGGCCTCCAAATCACAGG - Intergenic
907128307 1:52072300-52072322 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
907130687 1:52094555-52094577 CGCCTTGGCCTCCCAAATGCTGG - Intergenic
907183505 1:52591054-52591076 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
907307724 1:53522658-53522680 CACCTTGGCCTCCCAAAATGTGG - Intronic
907436751 1:54454595-54454617 TACCTTGACCTCCCAAAGTGCGG + Intergenic
907633540 1:56108845-56108867 CGCCTTGGCCTCCCAAAGTCTGG - Intergenic
908168951 1:61485862-61485884 AACCTTTGCCTCCCACACACGGG - Intergenic
908177465 1:61569931-61569953 TGCCTTGGCCTCCCAAAATCTGG + Intergenic
908189352 1:61685753-61685775 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
908240813 1:62187651-62187673 TGCCTAGGCCTCCCAAATGCTGG + Intergenic
908333101 1:63090901-63090923 TACCTTGGCCTCCCAAAGCATGG + Intergenic
908726588 1:67183284-67183306 CACCTTGGCCTCCCAAAGTGTGG - Intronic
908728914 1:67206260-67206282 CACCTCGGCCTCCCAAATGCTGG + Intronic
908732389 1:67239375-67239397 TACCTTGGCCTCCCAAGTAGCGG + Intronic
908993484 1:70124274-70124296 CACCTTGGCCTCCCAAAGTGTGG - Intronic
909005864 1:70275710-70275732 TGCCTCGGCCTCCCAAATGCTGG - Intronic
909202169 1:72704566-72704588 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
909862444 1:80625279-80625301 CACATTGGCCTCCCAAATACTGG + Intergenic
909956514 1:81785856-81785878 TGCCTCGGCCTCCAAATCACTGG - Intronic
910199370 1:84682748-84682770 CACCTTGGCCTCCAAAATGCTGG + Intronic
910223580 1:84914613-84914635 CGCCTCGGCCTCCCAAACTCTGG + Intergenic
910227711 1:84953301-84953323 CACCTTGGCCTCCTAAAGAGCGG - Intronic
910234156 1:85017862-85017884 TGCCTTGGCCTCCCAAAGTGAGG + Intronic
910594904 1:88969904-88969926 TACCTTGGCCTCTCAAAGTTTGG + Intronic
910651997 1:89579427-89579449 CACCTTGGCCTCTCAAATGCTGG - Intronic
910777990 1:90894808-90894830 TAATCTGGCCTTCCAAACACAGG - Intergenic
910877551 1:91891251-91891273 CACCTCGGCCTCCCAAGTACTGG - Intronic
911441219 1:97927906-97927928 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
911578097 1:99602114-99602136 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
911623457 1:100093510-100093532 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
911648794 1:100363904-100363926 CACCTTGGCCTCCCAAAGCGTGG - Intronic
911935892 1:103971511-103971533 TACCTCAGCCTCCCAAGCAGCGG + Intergenic
912028461 1:105207838-105207860 CACCTTGGCCTCCCAAAGTCCGG - Intergenic
912310830 1:108619636-108619658 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
912374992 1:109202687-109202709 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
912387069 1:109276426-109276448 CGCCTTGGCCTCCCAAACTGGGG + Intergenic
912399811 1:109380726-109380748 CGCCTTGGCCTCCCAAAGCCTGG - Intronic
912531395 1:110325884-110325906 TACCTTGGCCTCCCAGAATGCGG + Intergenic
912537052 1:110382208-110382230 CACCTTGGCCTCCCAAAGTATGG - Intronic
912805512 1:112753651-112753673 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
912916043 1:113815925-113815947 CACCTTGGCCTTCCAAAGTCTGG + Intronic
912916076 1:113816222-113816244 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
912917369 1:113828882-113828904 CGCCTTGGCCTCCCAAAGGCTGG + Intronic
913349853 1:117845443-117845465 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
913458034 1:119053794-119053816 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
914321127 1:146561381-146561403 TGCCTTGGCCTCCCAAAGAATGG - Intergenic
914321417 1:146565647-146565669 TGCCTTGGCCTCCCGATTACAGG - Intergenic
914358117 1:146905685-146905707 TGCCTTGGCCTCCCAAAGTGAGG + Intergenic
914414992 1:147471425-147471447 TGCCTTGGCCTCCCAAAGCTGGG - Intergenic
914765254 1:150631719-150631741 TGCCTCGGCCTCCCAAATGCTGG + Intergenic
914775712 1:150732856-150732878 TGCCTTGGCCTCCCAAGTACTGG + Exonic
914926477 1:151893120-151893142 CACCTTGGCCTCCCAAAGTGCGG - Intronic
915378160 1:155416365-155416387 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
915393951 1:155567784-155567806 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
915394632 1:155573448-155573470 TACCTTGGCCTCTCAACTGCTGG - Intergenic
915395574 1:155581211-155581233 TACCTCGGCCTCCCAAAGTGTGG + Intergenic
915423863 1:155807456-155807478 CACCTTGTCCTCCCAAAGTCTGG - Intronic
915562676 1:156696447-156696469 CACCTTGGCCTCCCAAGGTCTGG + Intergenic
915647150 1:157280940-157280962 AACCTCGGCCTCCCAAAGTCTGG + Intergenic
915657298 1:157371850-157371872 CACCTTGGCCTCCCAAAGTATGG + Intergenic
916018563 1:160773127-160773149 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
916085248 1:161264268-161264290 TACCTTGGCCTCCCAAATGCTGG - Intronic
916234373 1:162571376-162571398 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
916239154 1:162622181-162622203 CACCTTGGCCTCCCAAATGCTGG + Intergenic
916253678 1:162764576-162764598 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
916308996 1:163373311-163373333 TACTTTGGCCTCCCAAAGTGTGG + Intergenic
916636760 1:166678776-166678798 TACCTCAGCCTCCCAAATGCTGG - Intergenic
917082843 1:171273763-171273785 TGCCTTGGCCTCCCAAAGGGTGG + Intronic
917554409 1:176068936-176068958 TGCCTTGGCCTCCCAAAGTATGG - Intronic
917561821 1:176166373-176166395 TACCTTGGCCTCCCAAGTGCTGG + Intronic
917616429 1:176750354-176750376 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
917805260 1:178607370-178607392 TAGCTGGGCCTCTCAAGCACTGG + Intergenic
917811074 1:178658922-178658944 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
917979749 1:180261400-180261422 CACCTTGGCCCCCAAAGCACTGG - Intronic
918015018 1:180624678-180624700 CACCTTGGCCTCCCAAAGCGTGG + Intergenic
918221903 1:182443123-182443145 TACCTCAGCCTCCCAAACTTGGG + Intergenic
918231595 1:182538277-182538299 CACCTTGGCCTCCAAAGTACTGG - Intronic
918291527 1:183112933-183112955 CACCTTGGCCTCCCAAGTGCTGG - Intronic
918440524 1:184561879-184561901 CACCTTGGCCTCCCAAAGTGGGG + Intronic
918586960 1:186199388-186199410 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
918641367 1:186844959-186844981 TGCCTTGGCCTCCCAAAGTTGGG - Intronic
918707112 1:187678136-187678158 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
918924897 1:190770587-190770609 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
919679931 1:200424399-200424421 TACCTTGGCTTCCCAAAGTCCGG + Intergenic
919680871 1:200433453-200433475 TACCTTGGCCTCCCAAGTGCTGG - Intergenic
919886269 1:201937195-201937217 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
919897815 1:202020169-202020191 TGCCTTGGCCTCCCAAATGTTGG + Intergenic
920105570 1:203550740-203550762 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
920146794 1:203868302-203868324 TGCCTCGGCCTCCCAAATGCTGG + Intronic
920867519 1:209765415-209765437 TGCCTTGGCCTCCCAAAGTCTGG - Intronic
921211408 1:212902644-212902666 TGCCTTGGCCTCCCAAATGTTGG + Intergenic
921266038 1:213421359-213421381 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
921646002 1:217618709-217618731 CACCTTGGCCTCCCAAGGGCTGG - Intronic
922230494 1:223681468-223681490 TGCCTTGGCCTCCCAAAGTACGG - Intergenic
922558033 1:226548268-226548290 CACCTTGGCCTCCCAAAGTGGGG + Intergenic
922683567 1:227621001-227621023 TGCCTCAGCCTCCCAAATACTGG - Intronic
922738288 1:228001473-228001495 TGCCTTGGCCTCCCAAACTGTGG - Intergenic
922816017 1:228449959-228449981 CGCCTTGGCCTCCCAATTACAGG - Intergenic
922863610 1:228840118-228840140 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
922942616 1:229480941-229480963 TGCCTTGGCCTCCAAAGTACTGG + Intronic
923141989 1:231168215-231168237 TACCTTGGCCTCCCAAAGCCTGG + Intronic
923190164 1:231612712-231612734 TGCCTTGGCCTCCCAAACTGCGG + Intronic
923392433 1:233526745-233526767 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
923616933 1:235545850-235545872 CACCTCTGCCTCCCAAGCACTGG - Intergenic
923768778 1:236918348-236918370 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
923959097 1:239056749-239056771 CACCTCGGCCTCCCAAGCAGCGG - Intergenic
924353996 1:243150397-243150419 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
924433492 1:244017966-244017988 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
924476539 1:244387052-244387074 CACCTTGGCCTCCCAAAGTGCGG - Intronic
924500636 1:244635091-244635113 CACCTCGGCCTCCCAAAGGCTGG + Intronic
924511452 1:244731699-244731721 CACCTTGGCCTCCCAAATTGCGG - Intergenic
924513849 1:244750285-244750307 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
924521159 1:244807473-244807495 CACCTCAGCCTCCAAAACACTGG + Intergenic
924673673 1:246153718-246153740 TGCCTTGGCCTCCCAAAGCCTGG + Intronic
924786665 1:247205752-247205774 TGCCTTGGCCTCCCAAATGCTGG - Intergenic
924900944 1:248398456-248398478 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1062825763 10:567436-567458 CACCTCAGCCTCCCAAAGACAGG + Intronic
1062851948 10:750796-750818 TGCCTCAGCCTCCCAAACAGTGG - Intergenic
1063055133 10:2496150-2496172 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1063094047 10:2893615-2893637 TACCTCGGCCTCCCAAGTGCTGG - Intergenic
1063113889 10:3059776-3059798 TGCCTTGGCCTCCAAAGCTCTGG + Intergenic
1063163821 10:3441932-3441954 TGCCTTGGCCTCTCAAAGACAGG + Intergenic
1063208573 10:3857735-3857757 TGCCTTGGCCTCCCAAAGCGCGG + Intergenic
1063249579 10:4259360-4259382 TACCTTGGCCTCCCAAAAGCTGG + Intergenic
1063405957 10:5795368-5795390 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1063634507 10:7768766-7768788 CACCTTGGACTCCCAAATGCTGG - Intronic
1063641712 10:7836976-7836998 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1063729427 10:8678781-8678803 CACCTTGGCCTCCCAAAGTCTGG + Intergenic
1063870079 10:10407904-10407926 CATCTTGGCCTCCTAAGCACTGG - Intergenic
1064262657 10:13798466-13798488 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1064269218 10:13849918-13849940 CACCTCGGCCTCCCAAATGCTGG - Intronic
1064374823 10:14785954-14785976 TGCCTTGGCCTCTCAAAGACTGG + Intergenic
1064731561 10:18336368-18336390 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1064822257 10:19350523-19350545 TACCTTGGCCTCCCAAAGTGAGG + Intronic
1064899034 10:20273766-20273788 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1064993486 10:21276575-21276597 CACCTCGGCCTCCCAAAGGCTGG - Intergenic
1065086066 10:22178242-22178264 CACCTCGGCCTCCCAAGTACTGG - Intergenic
1065093712 10:22261017-22261039 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1065212524 10:23417981-23418003 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1065353788 10:24819342-24819364 TACCTTGGCATCCCAAAGTGTGG + Intergenic
1065387584 10:25148651-25148673 CATCTTGGCTTCCAAAACACTGG - Intergenic
1065508939 10:26458137-26458159 GACCTTGGCCTCCCAAAGTGCGG - Intronic
1065536450 10:26719517-26719539 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1065566937 10:27020908-27020930 TACCTTGGCTTCCAAAATGCTGG + Intronic
1065602032 10:27378837-27378859 CACCTTGGCCTCCCAATTGCTGG + Intergenic
1065707249 10:28481733-28481755 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1065745799 10:28840570-28840592 TGCCTTGGCCTCCAAAGAACTGG + Intergenic
1065928779 10:30460089-30460111 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1065998966 10:31086476-31086498 CACCTCGGCCTCCCAAACATTGG - Intergenic
1066005471 10:31142847-31142869 TGCCTTGGCCTCCAAAGCATTGG - Intergenic
1066109670 10:32184717-32184739 CACCTTGGCCTCCCAAAGTTGGG - Intergenic
1066186567 10:33015094-33015116 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1066376710 10:34863761-34863783 TGCCTTAGCCTCCCAAAGGCAGG - Intergenic
1066436352 10:35399591-35399613 TACCTTGGCCTCCCAAGTGTTGG - Intronic
1066564488 10:36707108-36707130 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1067391684 10:45868973-45868995 TGCCTTGGCCTCCCAAGTATTGG - Intergenic
1067402998 10:45994689-45994711 TGCCTTGGCCTCCCAAGTATTGG + Intronic
1067670899 10:48320161-48320183 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1067852752 10:49765001-49765023 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1067857908 10:49812941-49812963 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1067871606 10:49967169-49967191 TGCCTTGGCCTCCCAAGTATTGG + Intronic
1068263541 10:54617142-54617164 AGCCTTGGCCTCCCAAATGCTGG + Intronic
1068856140 10:61799151-61799173 TGTCTTGGCCTCCCAAACACTGG + Intergenic
1068893193 10:62169720-62169742 CACCTCGGCCTCCCAAATGCTGG + Intergenic
1068976281 10:63013521-63013543 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1068986860 10:63115554-63115576 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1069004845 10:63305970-63305992 CACCTTGGCCTCCTAAATACTGG + Intronic
1069036574 10:63651790-63651812 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1069469217 10:68671988-68672010 CACCTTGGCCTCCCAAGGGCTGG + Intronic
1069469897 10:68678499-68678521 TGCCTTGGCCTCCCAAAGTACGG - Intronic
1069496577 10:68909624-68909646 TACCTTGGCCTCCAAACTGCTGG - Intronic
1069510500 10:69038919-69038941 TGCCTCGGCCTCCCATGCACAGG + Intergenic
1069580497 10:69562879-69562901 GCTCTGGGCCTCCCAAACACTGG + Intergenic
1069602625 10:69717731-69717753 TGCCTTGGTCTCCCAGACACGGG - Intergenic
1069672055 10:70215336-70215358 CACCTTGGCCTCCCAAAGTATGG + Intronic
1070023478 10:72609389-72609411 CACCTTGGCCTCCCAAAGCGTGG - Intronic
1070067790 10:73054974-73054996 TTCCTTGGCCTCCCAAACACTGG - Intronic
1070113703 10:73508912-73508934 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1070120385 10:73570658-73570680 CACCTTGACCTCCCAAAGGCTGG + Intronic
1070136921 10:73702382-73702404 CACCTCGGCCTCCCAAAGTCTGG + Intergenic
1070499386 10:77056129-77056151 CGCCTTGGCTTCCCAAATACTGG - Intronic
1070616029 10:77969829-77969851 TACCTCGGCCTCCCAAGTGCTGG + Intronic
1070645661 10:78200555-78200577 TGCCTTAGCCTCCAAAGCACTGG + Intergenic
1070904374 10:80058919-80058941 CACATTGGCCTCCCAAACGCTGG + Intergenic
1070945986 10:80392075-80392097 TGCCTTGGCCTCCCAAAATGTGG - Intergenic
1071029794 10:81163601-81163623 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1071185577 10:83040258-83040280 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
1071318119 10:84422803-84422825 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1071538224 10:86454605-86454627 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1071556882 10:86611225-86611247 TACCTTGACCTCCCAAAGTGTGG + Intergenic
1071581963 10:86780017-86780039 CACCTTGGCCTCCCGAACGCTGG + Intronic
1071672246 10:87619366-87619388 TACCTTGCCCTCCCAAAGCGTGG - Intergenic
1071956059 10:90760629-90760651 TGCCTTGGCCTCCCAAATTGCGG - Intronic
1072040519 10:91601935-91601957 TACCTTGGAGTGCCAAGCACAGG - Intergenic
1072153798 10:92705403-92705425 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1072217840 10:93302908-93302930 CACCTCGGCCTCCCAAATGCTGG - Intergenic
1072255319 10:93615208-93615230 AGCCTTGGCCTCCCAGACTCAGG - Intronic
1072346624 10:94514124-94514146 CACCTTGGCCTCCCAAATGCTGG - Intronic
1072514417 10:96165354-96165376 TGCCTTGGCCTCCCAAAGTCTGG + Intronic
1072629100 10:97133301-97133323 CACCTTGGCCTCCCAAAGGCTGG - Intronic
1072687605 10:97547811-97547833 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1072701754 10:97647028-97647050 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1073357839 10:102870993-102871015 TGCCTTGGCCTCCCAAGTTCTGG - Intronic
1073450579 10:103606867-103606889 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1073586659 10:104717038-104717060 TGCCTTGGCCTTCCAAAGGCGGG - Intronic
1073925620 10:108511768-108511790 CACCTTGGCCTCCCAAGTGCCGG - Intergenic
1074014434 10:109519378-109519400 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1074144998 10:110709817-110709839 CACCTTGGCCTCCCAAAGTTGGG + Intronic
1074567974 10:114598336-114598358 TGCCTTGGCCTCCCAAAGCATGG - Intronic
1074587911 10:114786867-114786889 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
1074588478 10:114790039-114790061 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
1074996994 10:118766295-118766317 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1075062593 10:119267329-119267351 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1075328584 10:121555122-121555144 CACCTCGGCCTCCCAAAGGCTGG - Intronic
1075446531 10:122517324-122517346 CACCTCGGCCTCCCAAAGGCAGG + Intergenic
1075464123 10:122638691-122638713 TGCCTTGGCCTCCCAAATGCTGG + Intronic
1075617733 10:123903684-123903706 TCCCTTGGCCTCCCAGCCTCAGG - Intronic
1075637259 10:124037695-124037717 TACCCTGGCCTCACCCACACTGG + Intronic
1075662250 10:124206040-124206062 TGCCTTGGCCTCCAAAGCGCTGG - Intergenic
1075811946 10:125230888-125230910 CACCTCGGCCTCCCAAATACAGG + Intergenic
1075870243 10:125767388-125767410 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1075893014 10:125970453-125970475 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
1076461971 10:130653942-130653964 CACCTTGGCCTCCCAAAGTGGGG - Intergenic
1076513547 10:131029710-131029732 CACCTTGGCCTCCCAAATTGTGG - Intergenic
1076573484 10:131448614-131448636 TGCCTCGGCCTCCCAAATTCTGG - Intergenic
1077033454 11:481108-481130 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1077084543 11:742431-742453 CACCTTGGGCTCCAAAGCACTGG + Intergenic
1077291199 11:1795004-1795026 TACCTTGCCCTGCCAACCCCAGG + Intergenic
1077296135 11:1827066-1827088 TGCCTTGGCCACCCACCCACTGG - Intergenic
1077641458 11:3885433-3885455 TGCCTTGGCCTCCCAAAGTTTGG + Intronic
1077732226 11:4744047-4744069 TGCCTTGGCCTCCAAAATGCTGG + Intronic
1077894759 11:6445821-6445843 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1077925679 11:6680250-6680272 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
1078171902 11:8934358-8934380 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1078582563 11:12550136-12550158 CACCTCGGCCTCCCAAATGCTGG - Intergenic
1078779674 11:14425265-14425287 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1079042706 11:17073516-17073538 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1079196495 11:18332073-18332095 TGCCTTGGCCTCCCAAATTGCGG + Intronic
1079440477 11:20509380-20509402 TGCCTTGGCCTCCCAAATGCTGG - Intergenic
1079455669 11:20634116-20634138 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1079989532 11:27232214-27232236 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1080449145 11:32364370-32364392 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1080459863 11:32444945-32444967 CGCCTTGGCCTCCCAAAGTCTGG + Intergenic
1080521400 11:33070751-33070773 CACCTTGGCCTCCCAAATGCTGG - Intronic
1080544517 11:33302582-33302604 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1080692797 11:34572948-34572970 CACCTTGGCCTCCCAAAGCTGGG + Intergenic
1080916949 11:36669442-36669464 TACCTAGGCCTCCCAAGTGCTGG - Intergenic
1081593750 11:44445273-44445295 TGCCTCAGCCTCCCAAGCACTGG - Intergenic
1082016364 11:47491406-47491428 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1082025408 11:47567806-47567828 CACCTTGGCCTCTCAAAATCTGG + Intronic
1082039147 11:47670605-47670627 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1082039820 11:47675635-47675657 TGCCTTGGCCTCCCAAAGAGTGG + Intronic
1082048611 11:47751701-47751723 CACCTTGGCCTCCCAAATGCTGG - Intronic
1082162894 11:48902902-48902924 TGCCTAGGCCTCCCAAATGCTGG + Intergenic
1082776166 11:57245842-57245864 CGCCTTGGCCTCCCAAATGCTGG - Intergenic
1082900613 11:58246608-58246630 TGCCTTGGCCTCCCAAAATGTGG + Intergenic
1083108017 11:60377260-60377282 TGCCTTGGCCTCCCAAAGCTGGG - Intronic
1083496312 11:63057369-63057391 TGCCTTGGCCTCCCAAAATTTGG + Intergenic
1083538535 11:63493843-63493865 TGCCTTGGCCTCCCAAGTACTGG + Intergenic
1083835022 11:65261034-65261056 TGCCTCGGCCTCCCAAATGCTGG + Intergenic
1083984702 11:66205897-66205919 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1084292746 11:68185454-68185476 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1084388706 11:68861222-68861244 TGCCTTGGCCTCCCAAAATGCGG + Intergenic
1084541592 11:69790271-69790293 CACCTTGGCCTCCCAAAGCGTGG - Intergenic
1084601663 11:70149400-70149422 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1084610306 11:70198009-70198031 CGCCTTGGCCTCCCAAATGCTGG - Intergenic
1084879070 11:72156948-72156970 CACCTTGGCCTCCAAAGTACTGG + Intergenic
1084926789 11:72520194-72520216 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1085104379 11:73829616-73829638 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1085258800 11:75192474-75192496 CTCCTTCGCATCCCAAACACAGG - Intronic
1085264478 11:75229110-75229132 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1085337970 11:75711925-75711947 TACCAAGGCCTCCCTAAGACAGG + Intergenic
1085405947 11:76262307-76262329 TACCAAGGCCTCCCTAAGACAGG + Intergenic
1085555155 11:77412672-77412694 TCCCTTGGCCTCCCAAACTGTGG + Intronic
1085561476 11:77475920-77475942 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1085569091 11:77543568-77543590 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1085605879 11:77898063-77898085 TGCTTTGGCCTCCCAAAGTCTGG + Intronic
1085623442 11:78054467-78054489 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1085856168 11:80178651-80178673 TGCCTTGGCCTCCCAAGTCCTGG + Intergenic
1085858422 11:80203250-80203272 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
1085937098 11:81159883-81159905 TACCTAGGCCTCCCACAGGCGGG + Intergenic
1086080226 11:82896425-82896447 CACCTTGGCCTCCCAAAGTGAGG - Intronic
1086082988 11:82924563-82924585 CATCTTGGCCTCCCAAATGCTGG - Intronic
1086513488 11:87586271-87586293 TGCCTTGGCCTCCCAAATTTTGG + Intergenic
1086918597 11:92559623-92559645 TTCCTCTGCCTCCCAAGCACTGG + Intronic
1087134585 11:94703421-94703443 TACCTTGGCCTCCCAAAGTGTGG - Intergenic
1087222809 11:95564737-95564759 CTCCTTGGCTTCCCAAATACAGG - Intergenic
1087645798 11:100807094-100807116 TGCCTTGGCCTCTCAAAGTCTGG + Intronic
1087747919 11:101971221-101971243 TCCCTAGGCCTCCCAAGTACTGG + Intronic
1087869382 11:103273301-103273323 CACCTCAGCCTCCCAAATACTGG + Intronic
1087889893 11:103526218-103526240 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1088496753 11:110439152-110439174 CACCTTGGCCTCCCAAGTACTGG + Intronic
1088650332 11:111952443-111952465 CACCTTGGCCTCCCAAAGTCTGG - Intronic
1088672667 11:112158235-112158257 CGCCTTGGCCTCCCAAAGGCTGG + Intronic
1088694325 11:112353932-112353954 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1088768779 11:113012265-113012287 TGCCTTGGCCTCCCAAAGTTTGG + Intronic
1088826576 11:113500119-113500141 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1088869287 11:113877485-113877507 TGCCTTGGCCTCCCAAAATTTGG + Intergenic
1089062333 11:115635605-115635627 CACCTGGGCCTCCCAAAGTCTGG + Intergenic
1089379776 11:118020012-118020034 AACCTTGGCCTCCCAAATGCTGG - Intergenic
1089512168 11:119006482-119006504 TGCCTCGGCCTCCCAAAGTCTGG + Intronic
1090021524 11:123133015-123133037 TGCCTCGGCCTCCCAAAGGCTGG + Intronic
1090044349 11:123317625-123317647 CACCTTGGCCTCCAAAGAACCGG - Intergenic
1090668527 11:128930665-128930687 TACCCTGGCCTCCCTAACCCCGG - Intergenic
1090668566 11:128930755-128930777 AACCCTGGCCTCCCTAACCCCGG - Intergenic
1091461749 12:648324-648346 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1091479522 12:812990-813012 TACTTTGGCATCCCAAAGCCTGG - Intronic
1091906308 12:4192145-4192167 TGCCTTGGCCTCCCAAGTACTGG + Intergenic
1092146343 12:6217271-6217293 CACCTTGGCCTCCCAAAGCTTGG - Intronic
1092178549 12:6427992-6428014 TGCCTTGGCCTCCCAAAATGTGG - Intergenic
1092180962 12:6446522-6446544 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1092263894 12:6966995-6967017 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1092339585 12:7663968-7663990 TGCCTTGGCCTCCCAAGTAGCGG + Intronic
1092354241 12:7781598-7781620 CACCTTGGCCTCCCAAATGCTGG - Intergenic
1092382055 12:8004562-8004584 TGCCTCGGCCTCCCAAATGCTGG + Intergenic
1092470062 12:8770084-8770106 TATCTTGGCCTCCCACATGCAGG + Intronic
1092546457 12:9456197-9456219 TACCTTGTCCTCCCAAAGTACGG + Intergenic
1092608974 12:10152272-10152294 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1092802658 12:12186094-12186116 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1092826806 12:12407956-12407978 CACCTCGGCCTCCCAAATGCTGG + Intronic
1092833797 12:12469240-12469262 CACCTTGGCCTCCCAAGTAGCGG - Exonic
1093055363 12:14550628-14550650 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1093084884 12:14855960-14855982 TGCCTTGGCCTCCCAAGTCCTGG + Intronic
1093155151 12:15675349-15675371 TGCCTGGGCCTCCCAAGTACTGG - Intronic
1093417889 12:18941570-18941592 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1093549167 12:20386587-20386609 TGCCTTGGCCTCCCAAAATGTGG + Intronic
1094011652 12:25816208-25816230 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1094128567 12:27050277-27050299 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1094133182 12:27097022-27097044 TGCCTTGACCTCCCAGAAACTGG - Intergenic
1094147737 12:27248061-27248083 TGCCTTGGCCTCCCAAATGTTGG + Intronic
1094180397 12:27586447-27586469 CACCTTGGCCTCCCAAGGGCTGG - Intronic
1094183004 12:27612233-27612255 TACCTTGACCTCCCAGAAACTGG - Intronic
1094238757 12:28199160-28199182 TACCTTGGCCTTCCAAGTGCTGG + Intronic
1094338824 12:29387924-29387946 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1094506484 12:31065877-31065899 TACCTTGTCCTCCCAAAGTACGG - Intergenic
1094537437 12:31334615-31334637 TGCCTCGGCCTCCCAAATGCTGG + Intergenic
1095212092 12:39506284-39506306 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
1095272401 12:40235220-40235242 TGCCTTGGCCTCCCAAAGTCTGG - Intronic
1095273672 12:40253624-40253646 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1095402549 12:41831707-41831729 TGCCTTGGCCTCCCAATGTCTGG - Intergenic
1095898008 12:47300208-47300230 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1096026157 12:48363891-48363913 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1096039523 12:48501133-48501155 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1096061417 12:48703684-48703706 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1096310383 12:50515475-50515497 TGCCTTGGCCTCCAAAATGCTGG + Intronic
1096336167 12:50758257-50758279 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1096378493 12:51134858-51134880 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1096391826 12:51235585-51235607 TGCCTCGGCCTCCCAAACTTGGG - Intergenic
1096434968 12:51581808-51581830 TGCCTTGGCCTCCCAAGTCCTGG + Intergenic
1096655395 12:53087700-53087722 TGCCTCAGCCTCCCAAGCACAGG - Intergenic
1096858251 12:54501752-54501774 CACCTCGGCCTCCCAAAGGCTGG + Intronic
1097016052 12:55987896-55987918 TGCCTTGGCCTCCCAAATGCTGG - Intronic
1097018785 12:56005698-56005720 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1097093138 12:56523528-56523550 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1097188635 12:57209036-57209058 GAGCTTGGCCTCCCCAACCCAGG - Intronic
1097213741 12:57393350-57393372 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1097446911 12:59682819-59682841 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1097470846 12:59989091-59989113 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1097674398 12:62583081-62583103 TGCCTCGGCCTCCCAAATGCTGG - Intronic
1097832427 12:64239776-64239798 TCCCTCGGCCTCCCAAAGGCAGG - Intergenic
1097840546 12:64317509-64317531 CACCTCGGCCTCCCAAAGGCTGG - Intronic
1097871098 12:64602850-64602872 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1097926786 12:65137115-65137137 TGCCTTGGCCTCCCAAAGTACGG - Intergenic
1098033703 12:66280854-66280876 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1098321630 12:69250503-69250525 TGCCTCGGCCTCCCAAATATAGG - Intronic
1098395062 12:70008318-70008340 CAGCTTGGCCTCCCAAACTGTGG - Intergenic
1098563047 12:71899843-71899865 CACCTCAGCCTCCCAAATACTGG - Intronic
1098643655 12:72869761-72869783 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1098857407 12:75668459-75668481 CACCTTGGCCTCCCAAAGGGCGG + Intergenic
1098868551 12:75789243-75789265 TACTTTGGCCTCCCAAATGCTGG - Intergenic
1098877458 12:75881244-75881266 CATCTCAGCCTCCCAAACACTGG + Intergenic
1099229906 12:80011059-80011081 CACCTTGGCCTCCAAAGCTCTGG + Intergenic
1099750932 12:86771596-86771618 CACCTTGGCCTCCCAAAGTCTGG - Intronic
1099984170 12:89643871-89643893 TGCCTCGGCCTCCCAACCTCAGG - Intronic
1100075659 12:90779977-90779999 CACCTAGGCCTCCCAAATGCTGG - Intergenic
1100082524 12:90870260-90870282 AACCTTGGCTTCCCAAAGTCCGG - Intergenic
1100425194 12:94477994-94478016 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1100497596 12:95140370-95140392 CGCCTTGGCCTCCCAAAGAAAGG - Intronic
1100527905 12:95437296-95437318 CACCTCAGCCTCCCAAACACTGG + Intergenic
1100535840 12:95508028-95508050 TGCCTCGGCCTCCCAAAGTCTGG + Intronic
1100555160 12:95686138-95686160 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1100602468 12:96123566-96123588 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
1100633328 12:96409740-96409762 TGCCTTGGCCTCCCAAAGTCTGG + Intergenic
1100905952 12:99299307-99299329 TGCCTTAGCCTCCAAAGCACTGG + Intronic
1100922404 12:99503016-99503038 AGCCTTGACCTCCCAAACTCAGG + Intronic
1101096002 12:101341656-101341678 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
1101172816 12:102117203-102117225 TACCTCGGCCTCCCAAGTGCTGG - Intronic
1101538891 12:105646294-105646316 TGCCTTGGCCTCCCAAATTTTGG - Intergenic
1101771797 12:107759018-107759040 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1101905530 12:108822382-108822404 CACCTTGGCCTCCCAAATCCTGG + Intronic
1101978159 12:109380695-109380717 CACCTTGGCCTTCCAAATTCTGG - Intronic
1102093144 12:110211107-110211129 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1102119980 12:110432629-110432651 CACCTCAGCCTCCCAAACACTGG - Intergenic
1102123111 12:110458530-110458552 TGCCTCGGCCTCCCAAATGCTGG - Intronic
1102130649 12:110526083-110526105 TGCCTTGGCCTCCCAAAGTCTGG + Intronic
1102312715 12:111859511-111859533 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1102351640 12:112196907-112196929 TGCCTTGGCCTCCCAAGTAGCGG + Intronic
1102390733 12:112546820-112546842 TGCCTTGGCCTCCCAAAGTGAGG + Intergenic
1102523676 12:113495292-113495314 CACCTTAGCCTCCCAAATATTGG + Intergenic
1102555340 12:113723134-113723156 TACCTTGGGCTCCCAAAGCTTGG + Intergenic
1102569329 12:113817978-113818000 TACCTCGGCCTCCCAAAGTGTGG - Exonic
1102596291 12:113995037-113995059 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1103063419 12:117877086-117877108 TGCCTTGGCCTCCCAATAATCGG - Intronic
1103064636 12:117887348-117887370 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1103078251 12:118002844-118002866 TGCATTGGCCTCCCAAAATCTGG + Intergenic
1103094574 12:118122540-118122562 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1103134580 12:118496795-118496817 TGCCCTGGCCTCCCAAAGGCTGG - Intergenic
1103253460 12:119520788-119520810 TCCCTTGGCCTTCTAAATACTGG + Intronic
1103466107 12:121143129-121143151 CACCTGGGCCTCCCAAATGCTGG - Intronic
1103538643 12:121651207-121651229 TACCTTGGCCTCCCAAGTTCTGG + Exonic
1103542845 12:121678299-121678321 TGCCTTGGCCTCCCAATAGCAGG + Intergenic
1103550981 12:121737254-121737276 CACCTCGGCCTCCCAAAGTCTGG - Intronic
1103664831 12:122555301-122555323 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1103756077 12:123208288-123208310 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1103798996 12:123524881-123524903 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1104004051 12:124879844-124879866 CACCATGCCCTGCCAAACACAGG + Intronic
1104025456 12:125022773-125022795 CACCTTGGCCTCCCAAATGCTGG + Intronic
1104326777 12:127806158-127806180 CACCTTGACCTCCTAAACACGGG - Intergenic
1104398884 12:128459401-128459423 TTCCTTGGTCTCTCAAACCCAGG - Intronic
1104603390 12:130169067-130169089 TCCCTTGGGCTCCCCCACACTGG - Intergenic
1105060718 12:133147889-133147911 TGCCTTGGCCTCCCAAAGTCTGG + Intronic
1105313099 13:19230680-19230702 TGCCTCGGCCTCCCAAAGTCAGG - Intergenic
1105328447 13:19391561-19391583 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1105345346 13:19566300-19566322 CACCTCGGCCTCCCAAATGCTGG - Intergenic
1105397105 13:20046743-20046765 TACCTTTGCTTCCCAAAAAAAGG - Intronic
1105485572 13:20827987-20828009 TGCCTTGGCCTCCCAAAATGTGG - Intronic
1105548370 13:21368622-21368644 TACCTTGGCCTTCCAAAGTGTGG - Intergenic
1105863423 13:24438004-24438026 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1106099403 13:26681401-26681423 TATCTTGGCCTCTAAAATACCGG - Intronic
1106186026 13:27410798-27410820 CACCTTGGCCTCCCAAAGCACGG + Intergenic
1106320456 13:28632744-28632766 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1106354720 13:28970026-28970048 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1106453435 13:29905903-29905925 TAACTTGGCCTTCCCCACACAGG + Intergenic
1106467815 13:30028452-30028474 CACCTTGGCCTTCCACAAACTGG - Intergenic
1106530553 13:30586731-30586753 CACCTTGGCCTCCCAAAGGTTGG + Intronic
1106536611 13:30650104-30650126 TGCCTTGGCCTCCCAAAGTGAGG + Intronic
1106781874 13:33066969-33066991 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1106810849 13:33357680-33357702 CACCTCGGCCTCCCAAAGACTGG - Intergenic
1106959332 13:34979269-34979291 TGCCTTGGCCTCCCGAAGTCAGG - Intronic
1107273322 13:38646654-38646676 TACCTTGGCCTCCCAAGTTCTGG - Intergenic
1107454486 13:40541663-40541685 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1107502794 13:40997639-40997661 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1107767773 13:43756176-43756198 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1107907736 13:45076932-45076954 TGTCTTGGCCTCCCAAACTGTGG - Intergenic
1107910160 13:45098329-45098351 TGCCTTGCCCTCCCAAAGCCTGG - Intergenic
1108012125 13:46027352-46027374 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1108371592 13:49774903-49774925 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1108571241 13:51753834-51753856 TGCCTTGGCCTCCCAACAGCTGG - Intronic
1108662787 13:52601429-52601451 TGCCTCGGCCTCCCAAATGCTGG + Intergenic
1108698313 13:52922457-52922479 CACCTCGGCCTCCCAAATGCTGG + Intergenic
1108870829 13:54983515-54983537 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1109007987 13:56902487-56902509 CGCCTTGGCCTCCCAAACTGGGG + Intergenic
1109078452 13:57866927-57866949 TGCCTTGGCCTCCCAAATACTGG + Intergenic
1109299816 13:60579549-60579571 CACCTCGGCCTCCAAAGCACCGG - Intergenic
1109885334 13:68534790-68534812 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1110053714 13:70938059-70938081 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1110188341 13:72701153-72701175 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1110416963 13:75263522-75263544 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1110708771 13:78626816-78626838 TGCCTTGGCCTCCCAAAGTCTGG - Intronic
1110844817 13:80182139-80182161 GACCTTGACCTCACTAACACAGG + Intergenic
1111061772 13:83029578-83029600 TACCCTGGCCTCCCAAAGGCTGG - Intergenic
1111314495 13:86535217-86535239 CGCCTTGGCCTCCCAAGTACTGG + Intergenic
1111357849 13:87133038-87133060 CACCTTGGCCTCCAAAGTACTGG + Intergenic
1111484572 13:88879829-88879851 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1111964737 13:94849018-94849040 TACCTCGGCCTCCCAAAGTGCGG + Intergenic
1112047251 13:95610554-95610576 TGCCTTGGCCTCCCAAAATGCGG + Intronic
1112200324 13:97268348-97268370 TGCCTCGGCCTCCCAAACGCTGG + Intronic
1112262295 13:97887934-97887956 CACCTTGGCCTCCAAAGTACTGG - Intergenic
1112308510 13:98296931-98296953 TACCTTGGCCTCCCAAAGCTGGG + Intronic
1112390682 13:98981303-98981325 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1112438329 13:99407605-99407627 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1112461929 13:99610149-99610171 TGCCTTGGCCTCCAAAGCAGTGG + Intronic
1112472693 13:99703204-99703226 TGCTTTGGCCTCCCAAACTGCGG - Intronic
1112532186 13:100215886-100215908 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1113389190 13:109879613-109879635 CACCTTGGCCTCCCAAAATTCGG - Intergenic
1114239286 14:20851320-20851342 CACCTCGGCCTCCCAAACTGTGG + Intergenic
1114291344 14:21290885-21290907 TGCCTCAGCCTCCCAAATACTGG - Intronic
1114420495 14:22578314-22578336 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1114438442 14:22727200-22727222 TGCCTCGGCCTCCCAAAGTCCGG + Intergenic
1114440859 14:22746403-22746425 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1114540742 14:23456410-23456432 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1114561253 14:23592425-23592447 TGCCTAGGCCTCCCAAATACTGG + Intergenic
1114864988 14:26579302-26579324 TGCCTCGGCCTCCCAAATGCTGG + Intronic
1115231056 14:31161327-31161349 TGCCTTGACCTCCCAAACTGCGG - Intronic
1115581216 14:34760598-34760620 TGCCTTGGCCTCCCAAATGTTGG - Intronic
1115652410 14:35412312-35412334 CACCTTGGCCTCCCAAAATCTGG + Intergenic
1115684075 14:35776131-35776153 CACCTTGGCCTCCCAAAGTTGGG - Intronic
1115981022 14:39051712-39051734 TGCCTTGGCCTCCCGAGTACTGG - Intronic
1116553634 14:46274891-46274913 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1116613937 14:47109695-47109717 TGCCTTGGCCTCCCAAATTGTGG - Intronic
1117010291 14:51464056-51464078 TACCTTGGCCACCCAAAGTGTGG + Intergenic
1117042415 14:51779090-51779112 CAGCTTGGCCTCCCAAATGCTGG - Intergenic
1117295285 14:54373430-54373452 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1117348273 14:54855563-54855585 TGCCTTGGCCTCCCAAATGCTGG - Intronic
1117385095 14:55203957-55203979 CGCCTTGGCCTCCCAAACTGCGG - Intergenic
1117706196 14:58471098-58471120 TACCTCGGCCTCCCAAGTTCGGG + Intronic
1117829181 14:59733340-59733362 CACTTTGGCCTCCCAAATGCTGG + Intronic
1117883396 14:60334030-60334052 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1118229229 14:63932125-63932147 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1118230179 14:63940302-63940324 TACCTCGGCCTCCCAAGTGCTGG + Intronic
1118576869 14:67251282-67251304 TGCCTCGGCCTCCAAAATACTGG - Intronic
1118581697 14:67306615-67306637 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1118611742 14:67546750-67546772 TACCTTGGCCTCTAAGTCACTGG - Intronic
1118987353 14:70767913-70767935 TGCCTTGGCTTCCCAAACACTGG + Intronic
1119071806 14:71593458-71593480 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1119225399 14:72941212-72941234 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1119228860 14:72964490-72964512 TGCCTTGGCATCCCAAGCACTGG + Intergenic
1119336460 14:73837494-73837516 CTCCTTGGCCTCCCAAATATTGG + Intergenic
1119359313 14:74034839-74034861 TGCCTTGGCCTCCAAAATGCTGG - Intronic
1119411317 14:74432605-74432627 TGCCTTGGCCTCCCAAAGTGAGG - Intergenic
1119413700 14:74455666-74455688 TGCCTCGGCCTCCCAAAGGCTGG + Intergenic
1119485371 14:74983278-74983300 AACCTTGACCTCCCAAGCTCAGG - Intergenic
1119591993 14:75898391-75898413 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
1119682329 14:76602249-76602271 TGCCTTGGCCTCCCAAATTCTGG + Intergenic
1119722120 14:76898492-76898514 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1119724809 14:76915500-76915522 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1119801847 14:77452529-77452551 TGCCTTGGCCTCCCAAATGCTGG - Intronic
1119809165 14:77501680-77501702 CACCTCGGCCTCCCAAAGCCTGG + Intergenic
1119823608 14:77639535-77639557 CACCTTGGCCTCCCAAATGGTGG - Intergenic
1119825044 14:77650611-77650633 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1120141819 14:80938144-80938166 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1120610497 14:86635699-86635721 CACCTTGGCCTCCCAAAGCTCGG - Intergenic
1121105551 14:91277261-91277283 CACCTTGGCCTCCCAAAGGCTGG + Intronic
1121173219 14:91871606-91871628 CACCTCGGCCTCCCAAATGCTGG - Intronic
1121204173 14:92147971-92147993 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1121365052 14:93301437-93301459 TGCCTTGGCCTCCCAAATGCTGG + Intronic
1121669673 14:95698742-95698764 TGCCTTGGCCTCCCAAAGGCTGG - Intergenic
1121830842 14:97050814-97050836 AACCATGGCCTCCAAGACACAGG - Intergenic
1121913560 14:97815267-97815289 TGGCTTGGCCTCCCAAAGTCTGG + Intergenic
1121964289 14:98289836-98289858 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1122159040 14:99769450-99769472 AACCTTGGCCTCCCCCACAGTGG + Intronic
1122225055 14:100270995-100271017 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
1122497315 14:102167467-102167489 TGCCTTGGCCTCCAGAGCACTGG + Intronic
1122510909 14:102266828-102266850 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1122533968 14:102449136-102449158 CACCTCAGCCTCCCAAATACAGG - Intronic
1122619972 14:103050509-103050531 TACCTTGGCCTCCCAAATGTTGG - Intronic
1122669912 14:103363148-103363170 TGCCTTGGCCTCCCAAAGTATGG - Intergenic
1122731199 14:103799795-103799817 CACCTTGGCCTCCCAAATCTGGG - Intronic
1123462324 15:20484573-20484595 TGCCTTGGCCTGCCAAATGCTGG - Intergenic
1123655735 15:22515821-22515843 TGCCTTGGCCTGCCAAATGCTGG + Intergenic
1123898591 15:24852851-24852873 AACCTTGACCTCCCAAGCTCAGG - Intronic
1124273013 15:28300571-28300593 TGCCTTGGCCTGCCAAATGCTGG - Intronic
1124273957 15:28310195-28310217 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1124308851 15:28602820-28602842 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1124309645 15:28610998-28611020 TGCCTTGGCCTGCCAAATGCTGG + Intergenic
1124330097 15:28804424-28804446 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1124792672 15:32744323-32744345 TGCCTCGGCCTCCCAAAGTCTGG - Exonic
1124809599 15:32921919-32921941 TGCCTTGGCCTCCCGAAGTCAGG + Intronic
1124924177 15:34055247-34055269 CACCTCGGCCTCCCAAATGCTGG - Intronic
1124933710 15:34149671-34149693 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1125004440 15:34801210-34801232 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1125178772 15:36857057-36857079 TGCCTTGGCCTCCTAAATACTGG + Intergenic
1125347881 15:38737842-38737864 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1125446804 15:39767096-39767118 TGCCTGGGCCTCCCAAATGCTGG + Intronic
1125570033 15:40709620-40709642 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1125653346 15:41336009-41336031 TGCCTTGGCCTCCCAAATGCTGG - Intronic
1125656064 15:41358486-41358508 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
1125662507 15:41405240-41405262 TTCCTTGGCCTCCCAGACAGTGG + Intergenic
1125915171 15:43480197-43480219 TACCTTGGCCTCCCAAATGCCGG - Intronic
1126409288 15:48355528-48355550 TACTTTGGCCTAGAAAACACAGG - Intergenic
1126641163 15:50828463-50828485 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1126813258 15:52429851-52429873 TGCATTGGCCTCCCAAATGCTGG + Intronic
1127048044 15:55048680-55048702 TGCTTTAGCCTCCCAAGCACTGG - Intergenic
1127090550 15:55462437-55462459 TGCCTTGGCCTCTCAAAGGCTGG + Intronic
1127094078 15:55495486-55495508 CACTTTGGCCTCCCAAATGCTGG - Intronic
1127098547 15:55537561-55537583 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1127146801 15:56033219-56033241 TGCCTTGGCCTCCCAAATGATGG + Intergenic
1127380725 15:58428576-58428598 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1127411492 15:58712302-58712324 TCCCTTGGCCTCCCAAAGCTGGG - Intronic
1127573047 15:60262820-60262842 TACCTTGACCTCCCAGACTCAGG + Intergenic
1127881822 15:63164817-63164839 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1127899215 15:63328947-63328969 TGCCTCGGCCTCCCAAACTATGG + Intronic
1127985614 15:64068036-64068058 CACCTTGGCCTCCCAAATGTTGG + Intronic
1128039069 15:64554390-64554412 TGCCTTGGCCTCCCAAGTACTGG - Intronic
1128766227 15:70252789-70252811 TCCCTTGGCATCTCAAACAAGGG - Intergenic
1128809403 15:70559870-70559892 TACCTTGAGCTCCCTGACACTGG - Intergenic
1128894709 15:71362026-71362048 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1128988666 15:72240414-72240436 TGCCTTGACCTCCCAAGCTCAGG - Intergenic
1129146605 15:73653613-73653635 CACCTCGGCCTCCCAACTACAGG + Intergenic
1129281108 15:74485689-74485711 CACCTCAGCCTCCCAAGCACTGG + Intergenic
1129284660 15:74514806-74514828 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1129353597 15:74972480-74972502 CACTTTGGCCTCCCAAATGCTGG - Intronic
1129505368 15:76077212-76077234 CACCTTGGCCTCCCAAAGTTCGG + Intronic
1129776675 15:78241404-78241426 CACCTTGGCCTTCCAAAGTCGGG - Intronic
1129987428 15:79930478-79930500 CACCTTGGCCTCCCAAAGTCTGG + Intergenic
1129995153 15:79998110-79998132 CACCTAGGCCTCCAAAACAATGG - Intergenic
1130009250 15:80135684-80135706 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1130266501 15:82409743-82409765 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1130289754 15:82588194-82588216 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1130320208 15:82835370-82835392 CACCTTGGCCTCCCAAATGCTGG + Exonic
1130361246 15:83188496-83188518 TACCTTGGCCTCCCAAAACCTGG + Intronic
1130449974 15:84041695-84041717 TACCTCAGCCTCCCAATTACAGG + Intergenic
1130767371 15:86884561-86884583 TGCCTCGGCCTCCCAAAGGCTGG - Intronic
1130901234 15:88208167-88208189 CCCCAAGGCCTCCCAAACACTGG + Intronic
1131082502 15:89548473-89548495 CGCCTTGGCCTCCCAAAGGCTGG + Intergenic
1131204119 15:90427016-90427038 CACCTTGGCCTTCCAAGTACTGG - Intronic
1131325443 15:91439088-91439110 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1131484068 15:92806061-92806083 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1131519313 15:93101361-93101383 CACCTCGGCCTCCCAAAGGCTGG + Intergenic
1131857113 15:96609321-96609343 TACCTTGACCTCCCAAAATATGG - Intergenic
1131879997 15:96852249-96852271 TGCCCTGGCCTCCCAAAGGCTGG + Intergenic
1132018983 15:98344213-98344235 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1132116570 15:99140616-99140638 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1132486594 16:195670-195692 TGCCTTGGCCTCCTAAAGACTGG + Intronic
1132545502 16:531310-531332 TGCCTCAGCCTCCCAAATACTGG + Intronic
1132730709 16:1360373-1360395 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1132754676 16:1477169-1477191 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1132786242 16:1658401-1658423 TCCCTGGGGCACCCAAACACAGG - Intronic
1132916374 16:2348083-2348105 TGCGTTGGCCTCCCAAATGCTGG + Intergenic
1132935592 16:2479139-2479161 CACTTTGGCCTCCCAAAGGCTGG + Intronic
1132938593 16:2495529-2495551 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1132979730 16:2730876-2730898 TGCCTTGGCCTCCCAAAGCTGGG + Intergenic
1133012401 16:2921446-2921468 CACCTCAGCCTCCCAAGCACCGG - Intronic
1133107927 16:3525813-3525835 TGCCTTGGCCTCCCAAAGCGTGG + Intronic
1133115972 16:3578215-3578237 TGCCTTGGCCTCCCAAAACACGG + Intergenic
1133210577 16:4261391-4261413 TGCCTCAGCCTCCCAAACAGCGG + Intronic
1133215710 16:4291090-4291112 TGCCTCGGCCTCCCAAATGCTGG - Intergenic
1133246666 16:4453678-4453700 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1133518943 16:6538239-6538261 TGCCTTGGCCTCCCAAGTACTGG - Intronic
1133759770 16:8789194-8789216 CACCTTGGCCTCCCAAAGGGTGG - Intronic
1134002488 16:10793644-10793666 CACCTTGGCCTCCCAAATGCTGG - Intronic
1134080375 16:11320703-11320725 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1134141761 16:11726125-11726147 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1134147974 16:11782861-11782883 TACCTCGGCCTCCCAAAGTGTGG + Intronic
1134175832 16:12005486-12005508 TACCTTTGCATCCCAGACCCTGG - Intronic
1134223038 16:12370309-12370331 CGCCTTGGCCTCCCAAATGCTGG - Intronic
1134319221 16:13147708-13147730 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1134360875 16:13530048-13530070 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1134643055 16:15844605-15844627 TGCCTTGGCCTCCCAAAATATGG - Intronic
1135063619 16:19291089-19291111 TGCCTTTGCCTCCCAAAGTCTGG + Intronic
1135564094 16:23498477-23498499 TACCTTGGCCTCCAAAGTGCTGG - Intronic
1135606330 16:23828299-23828321 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1135736758 16:24938111-24938133 TGCCTTGGCCTCCCAAAGGCTGG - Intronic
1135931229 16:26738629-26738651 CACCTCGGCCTCCCAAATGCTGG + Intergenic
1135993287 16:27230332-27230354 ATCCTTGGCCTCTCAGACACAGG - Intronic
1136178637 16:28535957-28535979 CTCCTTGGCCTCCCAAAGGCTGG + Intronic
1136360301 16:29775101-29775123 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1136423142 16:30149889-30149911 CACTTTGGCCTCCCAAATGCTGG - Intergenic
1136500574 16:30667969-30667991 TTCCTTGTCCACCCAAACCCAGG - Intronic
1136503140 16:30684534-30684556 TACCTCGGCCTCCCAAATGCTGG + Intergenic
1136584337 16:31174278-31174300 TGCCTTGGCCTCCCAAGCGCTGG - Intergenic
1136750775 16:32633846-32633868 TATCTTGGCCTCCCAAAGTGTGG - Intergenic
1137286601 16:47021362-47021384 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1137439885 16:48489297-48489319 CACCTTGGCCTCCCAAATACTGG + Intergenic
1137633003 16:49960668-49960690 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1137777001 16:51064080-51064102 CACCTTGGCCTTCCAAACTGTGG - Intergenic
1137995365 16:53205088-53205110 CACCTTGGCCTCCCCAAGGCTGG + Intronic
1138031462 16:53562642-53562664 TACCTTGGTCTCCCAAAGTGCGG + Intergenic
1138110249 16:54318080-54318102 CACCTCTGCCTCTCAAACACAGG + Intergenic
1138365896 16:56476879-56476901 TGCCTTGGCCTCCCAAGTGCTGG - Exonic
1138791269 16:59906806-59906828 TTCCTTGACCTCCCAAAAGCTGG + Intergenic
1139174151 16:64667187-64667209 TGCCTTGGCCTCCCAAACACTGG - Intergenic
1139326009 16:66152926-66152948 TCCCAGGGCCCCCCAAACACAGG + Intergenic
1139477798 16:67211362-67211384 TACTTTGCCCTCCCACACCCTGG - Intronic
1139523871 16:67501169-67501191 TACCTCGGCCTCCCAAAGTGTGG + Intergenic
1139647618 16:68342954-68342976 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1139712428 16:68786418-68786440 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1139746807 16:69081587-69081609 TACCTTGGCCTCCCAAGTGCTGG + Intronic
1139747079 16:69083307-69083329 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1139823800 16:69741125-69741147 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1139833471 16:69819654-69819676 TGCCTTGGCCTCCCAAATGCTGG + Intronic
1139961107 16:70717900-70717922 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1139976068 16:70811607-70811629 TGCCTTGGCCTCCCAAAGTGAGG - Intronic
1140012210 16:71145499-71145521 TGCCTTGGCCTCCCGATTACAGG + Intronic
1140108837 16:71985813-71985835 CACCTTGGCCTCCCAAATGCTGG + Intronic
1140109188 16:71988441-71988463 CACCTTGGCCTCCCAAAGTATGG + Intronic
1140331120 16:74057814-74057836 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1140430197 16:74896378-74896400 TGCCTTGGCCTCCCAAAGAGTGG - Intronic
1140451074 16:75071346-75071368 CACCTTGGCCTCCCAATTACGGG + Intronic
1140451322 16:75073038-75073060 CACCTTGGCCTCCCAAAGTATGG - Intronic
1140461905 16:75146688-75146710 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1140664948 16:77218827-77218849 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1140830086 16:78742904-78742926 TTCCTGGGCCTCCCAAAAAGAGG + Intronic
1141113522 16:81289391-81289413 TACCTTGACCTCCCAAGTGCTGG - Intronic
1141356296 16:83349847-83349869 CACCTTGGCCTCCCAAATGCTGG + Intronic
1141466568 16:84209748-84209770 TGCCTTGGCCTCCCAAAGCTGGG + Intergenic
1141902126 16:86997782-86997804 TACCTCAGCCTCCCAAAGTCTGG - Intergenic
1142348394 16:89568705-89568727 CACCATGGCCTCCCAAAGGCTGG - Intergenic
1142634568 17:1248846-1248868 CGCCTTGGCCTCCCAAAGCCGGG - Intergenic
1142718070 17:1758232-1758254 TGCCTTGGCCTCCCAAATGTTGG + Intergenic
1142736234 17:1901670-1901692 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1142875668 17:2850810-2850832 TGCCTTGGCCTCCCAAGTTCTGG - Intronic
1142912296 17:3104616-3104638 TGCCTCGGCCTCCCAAATGCTGG - Intergenic
1143074231 17:4326911-4326933 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1143127765 17:4655245-4655267 TGCCTTGGCCTCCCAAGGGCTGG - Intergenic
1143505356 17:7361600-7361622 CACCCTGGCCTCCCAAAGTCTGG - Intergenic
1143556367 17:7663865-7663887 TGCCTTGGCCTCCCAAGCGCTGG + Intronic
1143560346 17:7690195-7690217 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1143561384 17:7697407-7697429 TACCTCGGCCTCCCAAAGTGGGG - Intronic
1143714826 17:8759377-8759399 TGCCTTGGCCTCCCAAAGGAGGG - Intergenic
1143726959 17:8854942-8854964 CACCTTGGCCTCCCAAATGTTGG - Intronic
1143778491 17:9216204-9216226 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1143896804 17:10142920-10142942 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1144193568 17:12868902-12868924 CACCTTGGCCTCCCAAAGGCTGG + Intronic
1144389180 17:14777829-14777851 CGCCTAGGCCTCCCAAACACTGG - Intergenic
1144536144 17:16094019-16094041 CACCTCAGCCTCCCAACCACAGG + Intronic
1144558347 17:16301509-16301531 TGCCTCGGCCTCCCAAGTACTGG + Intronic
1144618356 17:16797640-16797662 TACCTCGGCCTCCCAAAGTGTGG + Intronic
1144762155 17:17713256-17713278 TGCCTTGGCCTCCCAAGCAGTGG - Intronic
1144839426 17:18176648-18176670 TGCCTCAGCCTCCCAAATACCGG + Intronic
1144962860 17:19055793-19055815 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1144972301 17:19118728-19118750 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1145021061 17:19431271-19431293 TGCCTTGGCCTCCCAAATGCTGG + Intergenic
1145031873 17:19510564-19510586 TTCCTAGGCCCCCCAAACAACGG - Intronic
1145084695 17:19927548-19927570 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1145089365 17:19973952-19973974 TGCCTCGGCCTCCCAAAGGCTGG - Intronic
1145740666 17:27271595-27271617 CACCTTGGTCTCCCAAATGCTGG + Intergenic
1145947821 17:28791156-28791178 CACCTCGGCCTCCCAAAAGCTGG + Intronic
1145949242 17:28803254-28803276 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1145949500 17:28805107-28805129 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1146008157 17:29175202-29175224 CACCTTGGCCTCCAAAGTACTGG + Intronic
1146023755 17:29301629-29301651 TGCCTTGGCCTCCCAAAGGGAGG - Intergenic
1146068551 17:29657822-29657844 CACCTTGGCCTCCCAAAATTTGG + Intronic
1146079766 17:29768518-29768540 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1146152705 17:30489267-30489289 TGCCTTGGCCTCCCTAGTACTGG - Intronic
1146357557 17:32146990-32147012 CACCTCGGCCTCCCAAATACTGG + Intronic
1146357647 17:32147572-32147594 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1146421625 17:32691653-32691675 CACCTTGGTCTCCCAAAGTCTGG + Intronic
1146540479 17:33689317-33689339 CACCTCGGCCTCCCAAGTACTGG + Intronic
1146737766 17:35253621-35253643 CACCTTGGCCTCCCAAAATGGGG + Intronic
1146823437 17:36002797-36002819 TGCCTCGGCCTCCCAAACAAAGG + Intergenic
1147126705 17:38375006-38375028 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1147138215 17:38447035-38447057 ACTCCTGGCCTCCCAAACACTGG + Intronic
1147274955 17:39308224-39308246 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1147377333 17:40030540-40030562 CGCCTTGGCCTCCCAAATGCTGG + Intronic
1147404159 17:40199007-40199029 CACCTCGGCCTCCCAAATGCTGG - Intergenic
1147410374 17:40246861-40246883 CACCTCGGCCTCCCAAAGTCTGG - Intronic
1147600325 17:41741148-41741170 TACCTCAGCCTTCCACACACTGG + Intergenic
1147718975 17:42526661-42526683 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1147731011 17:42602065-42602087 TGCCTCGGCCTCCCAAAGGCTGG - Intronic
1147734979 17:42630882-42630904 TGCCTTGGCCTCACAAATATTGG + Intergenic
1147783711 17:42962780-42962802 CACCTTGGCCTCCCAAAGGCTGG - Intronic
1148006913 17:44440029-44440051 CACCTCGGCCTCCCAAATGCTGG + Intronic
1148483903 17:47978317-47978339 TGCCTCGGCCTCCCAAATGCTGG + Intronic
1148515631 17:48214520-48214542 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1148654352 17:49272149-49272171 TACCTCTGCCTCCCAAAGGCTGG - Intergenic
1148802683 17:50241542-50241564 CACCTTGGCCTCCCAAAGTCTGG + Intergenic
1148811494 17:50295485-50295507 TACCTTAGCCTCCCAAAGTGTGG - Intergenic
1148825409 17:50389845-50389867 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1148890443 17:50803258-50803280 CACCTTGGCATCCCAAATGCTGG + Intergenic
1148902065 17:50885734-50885756 CATATTGGCCTCCCAAATACTGG + Intergenic
1148924898 17:51075573-51075595 CACCTTGGCCCCCCAAATGCTGG - Intronic
1148956674 17:51359965-51359987 TCACTTGGCCTTCCAAATACGGG - Intergenic
1149074118 17:52577056-52577078 TACCTTGCTCTCTCAAATACTGG + Intergenic
1149331032 17:55582055-55582077 TGCCTCAGCCTCCCAAAGACTGG + Intergenic
1149483820 17:57025447-57025469 TGCCTTGGCCTCCCAAAATGTGG + Intergenic
1149519478 17:57307671-57307693 TGCCTTGGCCTCCCATCCACTGG + Intronic
1149625208 17:58074836-58074858 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1149645444 17:58237938-58237960 CACCTTGGCCTCCCAGATTCTGG + Intronic
1149770770 17:59319243-59319265 GCCCTTGGCCTCCCAAAGTCTGG - Intergenic
1149984847 17:61339515-61339537 CACCTTGGCCTCCCAACTGCTGG - Intronic
1150050197 17:61954526-61954548 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1150053038 17:61983974-61983996 TGCCTTGGCCTCCCAAAGTATGG + Intronic
1150115275 17:62542353-62542375 TACCTTGGCCTCTCAAAGTGTGG + Intronic
1150222227 17:63502318-63502340 CGCCTTGGCCTCCCAAGTACTGG - Intronic
1150269813 17:63856636-63856658 CACCTTGGCCTCCCAAAGTGGGG + Intergenic
1150341218 17:64369181-64369203 CACCTTGGCCTCCCAAGTCCTGG + Intronic
1150446805 17:65232606-65232628 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1150673367 17:67222088-67222110 CAACTTGGCCTCCCAAATGCTGG + Intronic
1150745602 17:67814151-67814173 TGCCTCGGCCTCCCAAATGCTGG - Intergenic
1150866440 17:68855640-68855662 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1151095498 17:71492839-71492861 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1151162709 17:72178920-72178942 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1151304287 17:73253109-73253131 CACCTTGGCCTCCCAAATGCTGG - Intronic
1151361363 17:73591166-73591188 TGCCTTGGCCTCCCAAAGTTTGG + Intronic
1151387284 17:73762783-73762805 TGCCTTGGCCTCCCCAAGGCTGG - Intergenic
1151506269 17:74529540-74529562 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1151706011 17:75767979-75768001 TACCTCGGTCTCCCAAAGTCTGG - Intergenic
1151818274 17:76482409-76482431 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1151965485 17:77429106-77429128 GAGCTTGGCCTCACACACACCGG - Intronic
1152076078 17:78160829-78160851 CACCTGGACCTCCCAAACACTGG + Intronic
1152127673 17:78457015-78457037 GCCCTGGGGCTCCCAAACACTGG + Intronic
1152189624 17:78880436-78880458 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1152405236 17:80094462-80094484 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1152860770 17:82696116-82696138 CGCCTTGGCCTCCCAAAGCCGGG + Intronic
1152916801 17:83042116-83042138 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1153059976 18:985109-985131 TACATTTCCCTCCAAAACACAGG - Intergenic
1153257622 18:3188089-3188111 TGCCTTGGCCTCCCAAAACTGGG + Intronic
1153268577 18:3296361-3296383 TGCCTTGGCCTCCCAAATGCTGG + Intergenic
1153853721 18:9123738-9123760 TACCTTGGCCTCCCAAGTGCTGG + Intronic
1154060256 18:11053779-11053801 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1154268784 18:12901413-12901435 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1155000939 18:21686090-21686112 TGCCTTGGCCTCCCAAATGCTGG + Intronic
1155039087 18:22050008-22050030 CACCTTGGCCTCCCAAAGTCTGG - Intergenic
1155049539 18:22134574-22134596 TAACTTGGCCTCCCAAGTTCTGG + Intergenic
1155158025 18:23173847-23173869 CACCTTGGCCTCCCAATAGCTGG - Intronic
1155191454 18:23434535-23434557 TGCCTTGGCCTCCCAAATGCTGG - Intronic
1155443769 18:25889037-25889059 TGCCTCGGCCTCCCAAATCCTGG + Intergenic
1155508612 18:26554423-26554445 TCACTTGGCCACCTAAACACTGG + Intronic
1155974876 18:32118283-32118305 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1155983872 18:32209236-32209258 CACCTTGGCCTCCCAAAGGCCGG - Intronic
1156444958 18:37229624-37229646 TGCCTCGGCCTCCCAAAGCCTGG - Intronic
1156970044 18:43143191-43143213 TGCCTTGGTCTACCAAACACTGG - Intergenic
1157340758 18:46776194-46776216 CACCTCGGCCTCCCAAATGCTGG - Intergenic
1157455804 18:47827852-47827874 TGCCTTGGCCTCCCAAAGTGCGG + Exonic
1157512353 18:48285967-48285989 GCCATTGGCTTCCCAAACACAGG + Intronic
1157872576 18:51244224-51244246 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1158142759 18:54272718-54272740 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1158429584 18:57373087-57373109 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1158481802 18:57828488-57828510 TGCCTTGGCCTCCCAAAATGAGG - Intergenic
1158919073 18:62169102-62169124 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1158977719 18:62727358-62727380 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1158986219 18:62819895-62819917 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1159316558 18:66782161-66782183 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1159362020 18:67417627-67417649 TGCCTCGGCCTCCCAAAAGCTGG + Intergenic
1159674868 18:71269953-71269975 TGCCTCGGCCTCCCAACCAATGG + Intergenic
1159709582 18:71739748-71739770 TCCCTTGGCCTCCCAAAATCTGG + Intronic
1159905369 18:74085343-74085365 TACCTTGGCCTCCAAAGTGCTGG - Intronic
1159980100 18:74767912-74767934 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1160098844 18:75901864-75901886 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1160206363 18:76836823-76836845 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1160207986 18:76852549-76852571 TATCTCAGCTTCCCAAACACTGG - Intronic
1160270805 18:77381949-77381971 CACCTTGGCCTCCAAAACAGGGG - Intergenic
1160287494 18:77558442-77558464 CACCTCTGCCTCCCAAGCACTGG + Intergenic
1160403200 18:78626542-78626564 CACCTTGGCCACCCAAAGTCTGG - Intergenic
1160475422 18:79181057-79181079 CACCTTGGCCTCCCAAAGTGGGG + Intronic
1160572052 18:79824245-79824267 GACCTTGGCCTCCCAAAGTGTGG + Intergenic
1160736828 19:666789-666811 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1160933795 19:1583607-1583629 CACCTTGGCCTCCAAAACTGTGG - Intronic
1160945684 19:1642719-1642741 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1161087500 19:2341847-2341869 TGCCTTGGCCTACCAAATGCTGG - Intronic
1161092983 19:2372103-2372125 TGCCTTGACCTCCCAAAGTCTGG + Intergenic
1161215362 19:3092497-3092519 TGCCTTGGCCTCCCAAGTACTGG + Intergenic
1161224910 19:3139192-3139214 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1161373301 19:3925756-3925778 TGCCTCGGCCTCCCAAAGTCTGG - Exonic
1161488193 19:4547217-4547239 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1161537463 19:4828947-4828969 TGCCTTGGCCTCCAAAATTCTGG + Intronic
1161692844 19:5747091-5747113 TGCCTTGGCCTCCCGAAGTCTGG + Intronic
1161700438 19:5791643-5791665 CACTTTGGCCTCCCAAGCATTGG + Intergenic
1161850394 19:6735138-6735160 TGCCTCGGCCTCCCAAATACTGG + Intronic
1162045909 19:8000168-8000190 TACCTCAGCCTCCCAAGCACTGG + Intronic
1162049654 19:8025247-8025269 TGCCTTGGCCTCCCAAATGCTGG + Intronic
1162062389 19:8104221-8104243 TGCCTTGGCCTCCCAAAGCAGGG - Intronic
1162085331 19:8245495-8245517 TGCCTCAGCCTCCTAAACACTGG + Intronic
1162114571 19:8421046-8421068 TACCTTGGCTTTCAAAGCACCGG + Intronic
1162187263 19:8915338-8915360 CGCCTTGGCCTCCCAAATGCTGG + Intronic
1162206765 19:9062032-9062054 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
1162307299 19:9882948-9882970 CACCTTGGCCTCCCAAAGTGGGG - Intronic
1162338271 19:10075090-10075112 TGCCTTGGCCTCCCAAATGCTGG - Intergenic
1162342762 19:10101855-10101877 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1162424047 19:10583384-10583406 TGCCTTGGCCTCCCAAAGCATGG - Intronic
1162468214 19:10855774-10855796 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1162472516 19:10880912-10880934 TGCCTCGGCCTCCCAAAACCTGG - Intronic
1162510483 19:11115063-11115085 TGCCTCAGCCTCCCAAACAGCGG + Intronic
1162535259 19:11259829-11259851 TGCCTCGGCCTCCCAAAGTCTGG + Intronic
1162535338 19:11260329-11260351 TGCCTCGGCCTCCCAAATGCTGG - Intronic
1162558377 19:11401793-11401815 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1162564807 19:11439865-11439887 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1162615001 19:11792454-11792476 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1162618808 19:11823712-11823734 CACCTCGGCCTCCCAAATATTGG - Intronic
1162629945 19:11919507-11919529 TGCCTCGGCCTCCCAAATACTGG - Intergenic
1162759452 19:12880155-12880177 TACCTCAGCCTCCCAAGTACTGG - Intronic
1162767160 19:12926797-12926819 TCCCTTGCCCTCCCAAACAGTGG + Intronic
1162873428 19:13602839-13602861 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1162899144 19:13784175-13784197 TACCTTGGCTTCCCAAAGTGTGG + Intergenic
1163013917 19:14442154-14442176 TGCTTTGGCCTCCCAAATGCTGG + Intronic
1163058800 19:14743185-14743207 TGCCTAGGCCTCCCAAATGCTGG + Intronic
1163086634 19:14985712-14985734 CTCCTTGGCCTCCCAAAGGCTGG - Intronic
1163198536 19:15744217-15744239 TGCCTCGGCCTCCCAAACTGCGG - Intergenic
1163240485 19:16059922-16059944 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1163256710 19:16160492-16160514 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1163267291 19:16228725-16228747 CACCTTGGCCTCCATAACCCCGG + Intronic
1163515087 19:17757965-17757987 TGCCTCGGCCTCCCAAATGCTGG - Intronic
1163599251 19:18238484-18238506 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1164050474 19:21582317-21582339 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1164060229 19:21666456-21666478 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1164095606 19:22007395-22007417 TGCCTTAGCCTCCCAAATAGTGG - Intronic
1164134267 19:22398601-22398623 TGCCTTGGCCTCCCAAAATCCGG + Intronic
1164147802 19:22523023-22523045 CAACTTGGCCTCCCAAAGTCTGG - Intronic
1164164544 19:22658174-22658196 TGCCTTGGCCTCCCAAAATCCGG - Intronic
1164166436 19:22680596-22680618 TGCCTTGGCCTCCCAAAATCTGG - Intergenic
1164401743 19:27906828-27906850 TGCCCTGGCCTCCCAAATTCTGG + Intergenic
1164631197 19:29762541-29762563 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1164825999 19:31285229-31285251 CACCTCGGCCTCCCAAATGCTGG - Intronic
1164850308 19:31477811-31477833 CACCTTGGCCTCCCAAAGGGCGG + Intergenic
1164874725 19:31675809-31675831 TTCCGTGGCTTCCCAAACCCTGG - Intergenic
1164903905 19:31951309-31951331 CACCTTGGCCTCCAAAACGCTGG - Intergenic
1164949064 19:32321118-32321140 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1165015733 19:32878717-32878739 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1165151078 19:33760566-33760588 CATCTTGGCCTCCAAAGCACTGG + Intronic
1165306923 19:35008570-35008592 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1165535412 19:36440167-36440189 TGCCTTGGCCTCCCAAAAGCTGG - Intergenic
1165538350 19:36469287-36469309 TGCCTTGGCCTCCCAAATTCTGG - Intronic
1165598552 19:37032554-37032576 AGCCTTGGCCTCCCAAACTGTGG - Intronic
1166174232 19:41054491-41054513 TGCCTTGGCCTCCAAAATGCTGG - Intergenic
1166213339 19:41321025-41321047 TGCCTTGTGGTCCCAAACACTGG + Intronic
1166258676 19:41623264-41623286 TGCCTCGGCCTCCCAAATGCTGG + Intronic
1166570269 19:43791369-43791391 TACCTTGGCCTCCCAAAGTGCGG + Intergenic
1166740015 19:45108887-45108909 CGCCTTGGCCTCCCAAAGTCTGG + Intronic
1166760821 19:45223589-45223611 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1166761293 19:45225869-45225891 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1166805309 19:45483400-45483422 TTCCTTGGCCTCCCAAAGGCTGG + Intergenic
1166848607 19:45746213-45746235 CACCTTGGCCTCCCAAAGTTCGG + Intronic
1166859748 19:45802919-45802941 TACCTCAGCCTCCCAAGCAGTGG + Intronic
1166867794 19:45851325-45851347 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1166929435 19:46293022-46293044 TGCCTTGGCCTCCCAAACCTGGG + Intergenic
1167442069 19:49514191-49514213 GACCTGGGGCGCCCAAACACAGG - Exonic
1167604114 19:50471211-50471233 CACCTTGGCCTCCCAAATGCTGG + Intronic
1167694138 19:51004089-51004111 GGCCTCGGCCTCCAAAACACTGG - Intronic
1167821160 19:51928610-51928632 CACTTTGGCCTCCCAAATGCTGG - Intronic
1167843562 19:52141212-52141234 TACCTTGGCCTCCCAAAGTGTGG - Intergenic
1167858793 19:52266287-52266309 TGCCTTGGCCTCCCAAAGTATGG + Intergenic
1168011192 19:53534533-53534555 CACCTCGGCCTCCCAAATGCTGG + Intronic
1168020473 19:53605575-53605597 TGCCTTGGCCTCCCAAAGTACGG + Intergenic
1168619610 19:57867627-57867649 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1168680211 19:58309855-58309877 TACCTTGGATTCCCAACAACAGG + Intronic
1202654271 1_KI270708v1_random:4666-4688 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
925254790 2:2474219-2474241 TGCCTTGGCCTCCCAAGGGCTGG + Intergenic
925282201 2:2692521-2692543 TAACTTTCCTTCCCAAACACAGG + Intergenic
925426041 2:3749657-3749679 CACCTTGGCCGCCCACACGCTGG - Intronic
925756640 2:7139275-7139297 CATCTTGGCCTCCCAAAGCCAGG + Intergenic
926096840 2:10086827-10086849 TTCCTTGGCCTCCCAAAGTCAGG + Intergenic
926198876 2:10779356-10779378 CACCTTGGCCTCCCAAATGTTGG + Intronic
926201077 2:10798318-10798340 TGCCTTGGCCTCCCAAAGTCAGG - Intronic
926287955 2:11505591-11505613 TGCCTTGGCCTCCCAAAGCATGG - Intergenic
927066741 2:19479428-19479450 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
927298028 2:21477412-21477434 TGCCTTGGCCTCCCAAATGCTGG - Intergenic
927784061 2:25960153-25960175 TGCCTCAGCCTCCCAAACAATGG - Intronic
927796249 2:26051497-26051519 CACCTTGGCCTCCCAAAGTGTGG - Intronic
927796725 2:26055771-26055793 TGCCTTGGCCTCCCAAATGCTGG + Intronic
927797334 2:26061637-26061659 TGCCTTGGCCTCCCAAAGGGCGG + Intronic
927833642 2:26373135-26373157 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
927970116 2:27300419-27300441 CACCTTGGCCTCCCAAATGCTGG + Intronic
927998643 2:27504875-27504897 CGCCTTGGCCTCCCAAATGCTGG - Intronic
928036465 2:27829004-27829026 TGCCTCAGCCTCCCAAATACTGG + Intronic
928212416 2:29333362-29333384 CACCTTGGCCTCCCAAATACAGG + Intronic
928311002 2:30209863-30209885 TGCCTTGGCCTCCAAAGTACTGG + Intergenic
928372819 2:30753360-30753382 TGCCTTGCCCTCCCAGCCACTGG - Intronic
928510052 2:31994697-31994719 TGCCTTGGCCTCCCAAAGGCTGG - Intronic
928559324 2:32462705-32462727 AGCCTTGGCCTCCCAAAGGCTGG - Intronic
928581522 2:32712669-32712691 TGCCTTAGCCTCCCAACTACAGG + Intronic
928894513 2:36244995-36245017 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
928972910 2:37050789-37050811 CGCCTTGGCCTCCCAAAGTCGGG - Intronic
929111438 2:38408364-38408386 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
929143213 2:38684555-38684577 CACCTTGGCCTCCCAAGTGCTGG - Intronic
929208324 2:39324158-39324180 TGCCTCGGCCTCCCAAATGCTGG - Intronic
929285353 2:40129482-40129504 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
929519640 2:42636289-42636311 CACCTTGGCCTCCCAAAGGCTGG - Intronic
929608125 2:43249334-43249356 CACCTTGGCCTCCCAAAATGTGG + Intronic
929690612 2:44069518-44069540 TGCCTTGGCCTCCCAAAGTTTGG + Intergenic
929710051 2:44257543-44257565 TGCCTTGGCCTCCCCATTACAGG - Intergenic
929741041 2:44600515-44600537 GACCTCAGCCTCCCAAGCACTGG + Intronic
930070763 2:47364268-47364290 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
930116991 2:47726513-47726535 CACCTTGGCCTCCCAAAGTGTGG + Intronic
930169691 2:48238372-48238394 CGCCTTGGCCTCCCAAAGACTGG + Intergenic
930208928 2:48615096-48615118 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
930710603 2:54547893-54547915 CGCCTTGGCCTCCCAAATGCTGG - Intronic
930750935 2:54933483-54933505 CACCTTGGCTTCCCAAATTCTGG - Intronic
930765543 2:55081612-55081634 TGCCTTGGCCTCCAAAATGCTGG - Intronic
930806878 2:55499415-55499437 CACCTTGGCCTCCCAAATGCTGG + Intergenic
930853170 2:55983618-55983640 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
930994550 2:57700494-57700516 CACCTTGGCCTCCCCAAAACTGG - Intergenic
931111419 2:59115423-59115445 AGCCTTGGCCTCCCAGGCACAGG + Intergenic
931303830 2:61008136-61008158 TGCCTTGGCCTCCAAAGTACTGG - Intronic
931355297 2:61532587-61532609 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
931378826 2:61733199-61733221 TGCCTTGGCCTCCCAAAATGTGG - Intergenic
931426770 2:62178616-62178638 CTCCTTGTCATCCCAAACACAGG - Intergenic
931444181 2:62313168-62313190 AGCCTTGGCCTCCCAAATGCTGG - Intergenic
931454023 2:62392952-62392974 CACCTTGGCCTCCCAAATGCTGG + Intergenic
932165444 2:69501719-69501741 CACCTCGGCCTCCCAAATGCTGG - Intronic
932203009 2:69849412-69849434 CACCTTGGCCTCCCAAGTGCTGG + Intronic
932237334 2:70131161-70131183 GACCTTGGCCTCCCAAAGCGTGG + Intergenic
932240612 2:70153605-70153627 CGCCTTGGCCTCCCAAAGTCTGG + Intronic
932251748 2:70250643-70250665 TGCCTCGGTCTCCCAAAGACTGG - Intergenic
932828682 2:74966651-74966673 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
933076922 2:77940516-77940538 TTCCTTGGCCTCTCAAAGATGGG - Intergenic
933247672 2:79994164-79994186 CACCTTGGCCTCCCAAATGCTGG + Intronic
933764348 2:85696785-85696807 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
933840348 2:86281379-86281401 TGCCTCGGCCTCCCAAAAAGCGG - Intronic
933894882 2:86801594-86801616 CACCTTGGCCTCCAAAATGCTGG + Exonic
933910449 2:86936252-86936274 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
933916110 2:86995397-86995419 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
934006883 2:87774505-87774527 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
934022278 2:87967157-87967179 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
934070533 2:88379995-88380017 CACCTTGGCCTCCCAAGTCCTGG - Intergenic
934105196 2:88689007-88689029 TGCCTTGGCCTCCCAAAGTGAGG + Intergenic
934669129 2:96197154-96197176 CACCTCGGCCTCCCAAAGTCTGG - Intronic
934781936 2:96975860-96975882 TGCCTTGGCCTCCCAAAGTTTGG + Intronic
934991472 2:98924794-98924816 TACCTTAGCCCCCCAAAAAGGGG + Intronic
935042495 2:99446739-99446761 CACCTTGGCCTCCCAAAGTGGGG + Intronic
935083890 2:99826261-99826283 TGCCTCGGCCTCCCAAATGCTGG + Intronic
935266032 2:101395039-101395061 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
935387193 2:102512662-102512684 CACCATGGCCTCCCCAACAATGG - Intronic
935394933 2:102597469-102597491 TACCTTGGCCTCCCAAGTGCTGG - Intergenic
935752045 2:106244292-106244314 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
935912455 2:107911839-107911861 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
936019982 2:108987595-108987617 TACTTTTTCCTCCCAAAGACTGG + Intronic
936131338 2:109845636-109845658 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
936213359 2:110525849-110525871 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
936366643 2:111863258-111863280 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
936408268 2:112228251-112228273 CACCTTGGCCTCCCAAATTCTGG - Intronic
936558812 2:113518859-113518881 CACCTTGGCCTCCCAAAATGCGG - Intergenic
936625644 2:114145432-114145454 CACCTCGGCCTCCCAAATGCTGG - Intergenic
936711014 2:115131264-115131286 TGCCTTGGCCTCCCAAAGTTCGG - Intronic
937161424 2:119766065-119766087 TATCTTGCTCTCCGAAACACTGG - Intronic
937172657 2:119891571-119891593 CACCTTGGCCTCCCAAAATGTGG + Intronic
937174691 2:119917614-119917636 TGCCTTAGCCTCCCAAGCAACGG - Intronic
937485555 2:122311304-122311326 CACCTTGGCCCCCCAAAGGCTGG + Intergenic
937485830 2:122314019-122314041 CACCTTGGCCCCCCAAAGGCTGG - Intergenic
937846816 2:126587599-126587621 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
938793271 2:134695800-134695822 TGCCTTGGCTTCCCAATTACAGG - Intronic
940042727 2:149377529-149377551 CACCTTGGCCTCCCAAATACTGG - Intronic
940228891 2:151429427-151429449 CTCCTTGGCCTCCCAAATGCTGG + Intronic
940238428 2:151536154-151536176 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
940348989 2:152660159-152660181 CACCTCGGCCTCCCAAATGCTGG + Intronic
940482009 2:154244870-154244892 TGCCTTGGCCTCCCAAATGCTGG - Intronic
940755476 2:157676972-157676994 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
940846546 2:158648748-158648770 TTCCTTGGCCTCCCAAAGTGTGG - Intronic
940859687 2:158759029-158759051 CACCCTGGCCTCCCAAATGCTGG + Intergenic
941330232 2:164170566-164170588 CACCTCGGCCTCCCAAATGCTGG - Intergenic
941448344 2:165628815-165628837 CGCCTTGGCCTCCCAAAAGCTGG - Intronic
941713180 2:168736438-168736460 TGCCTCAGCCTCCCAAGCACGGG + Intronic
941809127 2:169738353-169738375 TACCTTGGCCTCCCAAAGTGCGG + Intronic
941928889 2:170921866-170921888 TGCCTTGGCCTCCCAAAGTACGG - Intergenic
941985823 2:171510776-171510798 TGCCTTGGCCTCCCAAAGTTGGG - Intergenic
942026942 2:171920251-171920273 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
942032065 2:171972511-171972533 TGCCTTGGCCTCCCAAAGCAAGG + Intronic
942692064 2:178596237-178596259 TGCCTTGGCCTCCCAAAGTCAGG + Intronic
943060892 2:183040452-183040474 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
943216768 2:185046809-185046831 CACCTTGCCCTCCCAAATTCTGG + Intergenic
943220101 2:185093078-185093100 CACCTTGGCCTCCCAAATGCTGG - Intergenic
943564346 2:189499590-189499612 TGCCTTGGCCTCCCAAATGCTGG + Intergenic
943666954 2:190619128-190619150 CACCTTGGCCTCCCGAGTACTGG - Intergenic
944122812 2:196259220-196259242 TGCCTTGGCCTCTCAAATGCTGG + Intronic
944136258 2:196403053-196403075 CACCTTGGCCTCCCAAGTGCTGG + Intronic
944236886 2:197449056-197449078 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
944546491 2:200804093-200804115 TGCCTTGGCCTCCCAACCTCTGG + Intergenic
944575993 2:201091682-201091704 TGCCTCGGCCTCCCAAATGCTGG + Intergenic
944597613 2:201275822-201275844 TGCCTTGGCCTCCCAAAGTCTGG + Intronic
944744949 2:202645852-202645874 CGCCTTGGCCTCCCAAATGCTGG + Intronic
944784782 2:203058278-203058300 CGCCTTAGCCTCCCAAATACTGG + Intronic
944829274 2:203516498-203516520 CGCCTTGGCCTCCCAAAATCTGG - Intronic
945087313 2:206145372-206145394 CACCTTGGCCTCCTAAAAGCTGG + Intronic
945090864 2:206174368-206174390 TATCTTGGCCTCCCAAAGTGCGG + Intergenic
945334990 2:208581649-208581671 TACCCTGGCCTCCAAAACACGGG - Intronic
945625428 2:212198830-212198852 CACCTCGGCCTCCCAAAGGCTGG + Intronic
946243773 2:218373481-218373503 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
946276408 2:218634988-218635010 TGCCTTGGCCTCCAAAGCGCTGG - Intronic
946720697 2:222603966-222603988 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
946839555 2:223807015-223807037 CACCTTGGCCTCCCAAAGGGTGG - Intronic
946943257 2:224792530-224792552 CACCTTGGCCTCCCAAGTGCTGG + Intronic
947187556 2:227468722-227468744 TGCCTTGGCCTCCCAAGTAACGG - Intergenic
947290046 2:228562903-228562925 CACCTCGGCCTCCCAATGACTGG - Intergenic
947417819 2:229916439-229916461 TGCCTCAGCCTCCCAAATACTGG - Intronic
947514943 2:230795025-230795047 CGCCTTGGCCTCCCAAATGCTGG - Intronic
947566474 2:231197373-231197395 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
947620164 2:231584904-231584926 CACCTTGGCCTCCCACATGCTGG + Intergenic
947726369 2:232403411-232403433 TGACTTGGACTCCCAAAGACTGG + Intergenic
947730912 2:232431179-232431201 CACCTTGGCCTCCCAAAGGCGGG - Intergenic
947811371 2:233006063-233006085 CACCTTGGCCTCCCAAAATCTGG + Intronic
947834732 2:233167120-233167142 CACCTTGGCCTCCCAAAGTGTGG - Intronic
948021033 2:234733403-234733425 TGCCTTGGCCTCCCAAATGCTGG + Intergenic
948452637 2:238086460-238086482 TGCCTTGGCCTCCCAAAGCAGGG - Intronic
948471579 2:238184434-238184456 TGCCTCGGCCTCCCAAATGCTGG + Intronic
948651752 2:239450001-239450023 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1168940472 20:1707105-1707127 CACCTCGGCCTCCCAAATGCTGG - Intergenic
1169128188 20:3146090-3146112 TGCCTTGGCCTCCCAAATGCTGG - Intronic
1169280594 20:4263734-4263756 CACCTTGGCCTCCCAAAGTATGG + Intergenic
1169304114 20:4473561-4473583 TGCCTTGGCCTCCCAAGCTGGGG - Intergenic
1169332904 20:4730558-4730580 TGCCTCGGCCTCCCAAAGGCTGG + Intergenic
1169377776 20:5080788-5080810 CACCTTGGCCTCCCAAAGCTGGG + Intronic
1169913701 20:10667443-10667465 TACTCTGGCCACCCAGACACAGG - Intronic
1170192756 20:13660284-13660306 CACCTCGGCCTCCCAAATGCCGG + Intergenic
1170734001 20:18998095-18998117 TGTCTTGGCCTCCCAAATGCTGG - Intergenic
1170743319 20:19076837-19076859 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1170857373 20:20069525-20069547 CACCTTGGCCTCCCAAAATGTGG + Intronic
1171018244 20:21561203-21561225 TACCTCGGCCTCCCAAAGGCTGG - Intergenic
1171023895 20:21611159-21611181 CTCCTTGGCCTCCAAAGCACTGG - Intergenic
1171200802 20:23240493-23240515 TGCCTTGGCCTCCCAAAGGTTGG + Intergenic
1171425176 20:25044376-25044398 CACCTTGGCCTCCCAAGTACTGG - Intronic
1172017873 20:31889667-31889689 TGCCTTGGCCTCCCAAATGCTGG + Intronic
1172078449 20:32318051-32318073 TGCCTCGGCCTCCCAAATGCTGG - Intronic
1172078769 20:32321178-32321200 CACCTCGGCCTCCCAAATGCTGG - Intronic
1172265557 20:33610031-33610053 TGCCTTGGCCTCCCAAAGGCTGG - Intronic
1172462454 20:35130179-35130201 CACCTTGGCCTCCCAAGTAGTGG + Intronic
1172492282 20:35349746-35349768 TGCCTTGGCCTCCCAAATGCTGG - Intronic
1172732660 20:37100917-37100939 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1172762182 20:37330617-37330639 CGCCTTGGCCTCCCAAATGCTGG - Intergenic
1173113040 20:40213348-40213370 CACCTTGGCCTCCCAAAGCGTGG - Intergenic
1173135625 20:40436440-40436462 CACCTCGGCCTCCCAAACGCTGG - Intergenic
1173144132 20:40510427-40510449 AGCCTTGGCCTCCCAAGCTCAGG + Intergenic
1173157873 20:40630428-40630450 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1173515131 20:43659886-43659908 TGCCTTGGCCTCCCAAAGGCTGG - Intergenic
1173521950 20:43706616-43706638 CACCTTGGCCTCCCAAGCGCTGG - Intronic
1173651137 20:44665142-44665164 CACCTTGGCCTCCCAAAATACGG - Intergenic
1173784955 20:45786139-45786161 TGCCTTGGCCTCCCAAGGGCTGG - Intronic
1173909053 20:46650814-46650836 CACCTTGGTCTCCCATATACTGG - Intronic
1174015269 20:47482886-47482908 CACCTCAGCCTCCCAAATACTGG + Intergenic
1174113135 20:48209987-48210009 TACCTCTGCCTCCCAAGTACTGG - Intergenic
1174237391 20:49105044-49105066 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1174244145 20:49163672-49163694 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1174253752 20:49238714-49238736 TGCCTTGGCCTCCCAAAGCGTGG + Intronic
1174254544 20:49244770-49244792 TGCCTCAGCCTCCCAAATACCGG + Intronic
1174281384 20:49442003-49442025 CACTTTGGCCTCCCAAATGCTGG + Intronic
1174307992 20:49628314-49628336 TGCCTTGGCCTCCAAAGTACTGG + Intergenic
1174320830 20:49740259-49740281 TTCCTTGGCCTCCCAAAGTGTGG + Intergenic
1174525004 20:51163581-51163603 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1174585558 20:51605367-51605389 CACCTTGGCCTCCCAAATTGTGG - Intronic
1174612465 20:51809496-51809518 CACCTCGGCCTCCCAAATATTGG - Intergenic
1174647407 20:52097818-52097840 CACCTTGGTCTCCCAAGCTCGGG - Intronic
1174649090 20:52109528-52109550 TGCCTTGGCCTCCCAAATTCTGG - Intronic
1174650802 20:52123710-52123732 TACCTGGGCCTCATAAACATTGG + Intronic
1174800513 20:53559633-53559655 CACCTTGACCTCCCAAATGCTGG - Intergenic
1175113006 20:56662163-56662185 TGCCTCGGCCTCCCAAATGCTGG + Intergenic
1175148693 20:56916012-56916034 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1175198050 20:57259366-57259388 AACATTGGCATTCCAAACACAGG + Intronic
1175346486 20:58281094-58281116 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1175510577 20:59521846-59521868 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1176225472 20:63995903-63995925 TGCCTTGGCCTCCCAAAATGCGG + Intronic
1176516761 21:7790086-7790108 CACCTTAGCCTCCCAAGCCCTGG + Intergenic
1176962456 21:15174905-15174927 TGCCTTGGCCTCCCAAAGCCAGG - Intergenic
1177069734 21:16489248-16489270 TACCTCAGCCTCCCAAGTACTGG + Intergenic
1177141018 21:17358251-17358273 TGCCTTGGCCTCCTAAATGCTGG - Intergenic
1177487319 21:21776817-21776839 TTCATTGGCCTCCCAAATGCTGG + Intergenic
1177773740 21:25545335-25545357 CACCTTAGCCTCCCAAATGCTGG + Intergenic
1177859530 21:26436673-26436695 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1178113998 21:29398413-29398435 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1178148012 21:29761994-29762016 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1178403705 21:32308122-32308144 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1178551192 21:33541393-33541415 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1178625172 21:34210283-34210305 CACCTTGGCTTCCCAAAGGCTGG + Intergenic
1178650789 21:34420098-34420120 CACCTTAGCCTCCCAAGCCCTGG + Intronic
1178795570 21:35741262-35741284 GACCTTGACCTCACAATCACAGG + Intronic
1178831112 21:36057394-36057416 CGCCTTGGCCTCCCAAATGCTGG - Intronic
1178855163 21:36244672-36244694 TGCCTTGGCCTCCCAATTGCTGG + Intronic
1178891985 21:36527715-36527737 TCCCTTTTCCTGCCAAACACTGG - Intronic
1178908816 21:36657864-36657886 CGCCTTGGCCTCCCAAATGCTGG - Intergenic
1179020336 21:37635003-37635025 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1179143814 21:38750524-38750546 TGCCTTGGCCTCCCAAAGTACGG - Intergenic
1179318198 21:40264938-40264960 TGCCTTGGCCTCCCAAAGTCAGG - Intronic
1179370508 21:40802167-40802189 CACCTTAGCCTCCGAGACACTGG - Intronic
1179597343 21:42451727-42451749 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1180218339 21:46341129-46341151 CACCTTGGCCTCCCAAAGTGAGG + Intronic
1180218901 21:46345464-46345486 TGCCTCGGCCTCCCAAATTCTGG + Intronic
1180518328 22:16169973-16169995 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1180687056 22:17677481-17677503 CACCTTGGCCTCCCTCACGCTGG - Intronic
1180970396 22:19812022-19812044 TGCCCAGGCCTCCAAAACACCGG + Intronic
1181076885 22:20384789-20384811 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
1181078674 22:20399700-20399722 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1181267560 22:21639643-21639665 TACGTTGGCTTCCCCAACTCTGG + Intergenic
1181290359 22:21787737-21787759 CACCTTGGCCTCCCAAAACTGGG - Intronic
1181503181 22:23331570-23331592 TCCCTCGGCCTCCCAAATGCTGG + Intergenic
1181544924 22:23597241-23597263 TGCCTTGGCCTCCCAAATTCTGG - Intergenic
1181653916 22:24279475-24279497 TGCCTCGGCCTCCCAAATACTGG + Intronic
1181708172 22:24661763-24661785 TGCCTCGGCCTCCCAAATGCTGG + Intergenic
1181722129 22:24783669-24783691 CACCTCGGCCTCCCAAATGCTGG + Intergenic
1181732051 22:24854561-24854583 CACCTTGGCCTCCAAAGCACTGG - Intronic
1181815389 22:25432637-25432659 TGCCTTGGCCTCCCAAATTCTGG + Intergenic
1181848872 22:25735574-25735596 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1182448031 22:30401015-30401037 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1182476272 22:30578312-30578334 TAGCATGACCTCCCAAACACGGG + Intronic
1182513005 22:30832537-30832559 TGCCTTGGCCTTCCAAATGCTGG + Intronic
1182513328 22:30835965-30835987 TGCCTTGGCCTTCCAAATGCTGG + Intronic
1182553761 22:31117411-31117433 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1182579257 22:31294605-31294627 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1182687277 22:32130935-32130957 TGCCTTGGCCTCCCAAGTACTGG - Intergenic
1182725068 22:32438638-32438660 CACCTTGGCCTCCCAAAGTACGG + Intronic
1182751100 22:32642804-32642826 CACCTTGGCCTCTCAAATACTGG + Intronic
1182807747 22:33089743-33089765 TGCCTTGGTCTCCCAAATGCTGG + Intergenic
1183048923 22:35245118-35245140 CACCTTGGCCTCCCAAAATGCGG + Intergenic
1183084676 22:35479337-35479359 TTCCTTGGCCTCCCAAAGTATGG + Intergenic
1183357535 22:37367621-37367643 TGCCCTGGCCTCCCACACCCGGG - Intergenic
1183612839 22:38922188-38922210 TGCCTTGGCCTCCCAAAGTCTGG - Intergenic
1183701119 22:39451604-39451626 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1183714526 22:39525945-39525967 TGCCTTGGCCTCCCAAAGCCAGG - Intergenic
1183807398 22:40222825-40222847 TACCTTTGCCTCCCAGGCTCAGG + Intronic
1183857201 22:40642909-40642931 CACCTCAGCCTCCCAAACACTGG + Intergenic
1183957285 22:41388468-41388490 TACGTTGGCCTCCCAAAGTGGGG + Intronic
1183963167 22:41424994-41425016 CACCTTGGCCTCCCAAAGTACGG + Intergenic
1184017510 22:41797235-41797257 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1184107432 22:42376289-42376311 CACCTTGGCCTCCCAAATGCTGG - Intergenic
1184221699 22:43104865-43104887 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1184547410 22:45180710-45180732 TAACGGGGTCTCCCAAACACGGG - Intronic
1184578880 22:45398579-45398601 TGCCTTGGCCTCCCAAAGTACGG - Intronic
949297855 3:2547512-2547534 TACCTCGGCCTTCCAAATACTGG + Intronic
949321155 3:2811912-2811934 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
949551247 3:5114277-5114299 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
949572970 3:5311324-5311346 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
949778286 3:7656238-7656260 TGCCTTGGCCTCCCAAATGCTGG - Intronic
950449557 3:13058022-13058044 TGCCTTGGCCTCCCAAAGTATGG - Intronic
950604156 3:14063615-14063637 CACCTTGGCCTCCCAAAGTGTGG + Intronic
950668309 3:14510511-14510533 CACCTTGGCCTCCCAAAGTGAGG + Intronic
950735354 3:15003197-15003219 CACCTTGGCCTCCCGAATGCTGG + Intronic
950813312 3:15671831-15671853 TGCCTCGGCCTCCCAAATGCTGG + Intronic
950894430 3:16435318-16435340 TACCTTGGCCTCCCAAAGTGCGG - Intronic
951451063 3:22838872-22838894 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
951888043 3:27543184-27543206 CACCTTGGCCTCCCAAATGGTGG + Intergenic
952064218 3:29548175-29548197 TGCTTTGGCCTCCCAAGCTCTGG - Intronic
952625567 3:35398706-35398728 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
952731319 3:36639468-36639490 TCCCTTGGCCTCCCCAAAATGGG + Intergenic
953175628 3:40549248-40549270 CACCTTGGCCTCCAAAGCACTGG + Intronic
953311776 3:41887569-41887591 TGCCTCGGCCTCCCAAATGCTGG - Intronic
953678219 3:45019836-45019858 CACCTCGGCCTCCCAAAGGCTGG - Intronic
953714914 3:45308962-45308984 CACCTTGGCCTCCCAAACTGCGG + Intergenic
953809520 3:46100093-46100115 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
953962844 3:47280455-47280477 CACATTGGCCTCCCAAAGGCTGG - Intronic
953983846 3:47426683-47426705 TGCCTCGGCCTCCCAAAGTCTGG + Intronic
954063975 3:48091167-48091189 CACCTTGGCCTCCAAAATGCTGG - Intergenic
954086181 3:48245696-48245718 TGCCTCGGCCTCCCAAATGCTGG - Intronic
954153742 3:48673318-48673340 TGCCTTGGCCTCCCAAAGTACGG - Intergenic
954203906 3:49043245-49043267 CACCTCGGCCTCCCAAATGCTGG - Intronic
954234476 3:49245848-49245870 AACCTGGGCATCCCACACACAGG + Intronic
954264842 3:49464026-49464048 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
954338733 3:49936650-49936672 TGCCTCGGCCTCCCAAAGTCTGG + Intergenic
954344813 3:49987885-49987907 CACCTTGGCCTCCCAAGCGTGGG + Intronic
954557228 3:51527564-51527586 TGCCTTGGCCTCCCAAAATCAGG + Intergenic
954786327 3:53095461-53095483 TGCCTTAGCCTCCCAAATGCTGG - Intronic
954893370 3:53953536-53953558 CACCTCGGCCTCCCAAAGGCTGG + Intergenic
955088848 3:55729587-55729609 CACCTTGGCCTCCCAAATTGTGG - Intronic
955155694 3:56414472-56414494 TACCTCGGCCTCCCAAAGTGCGG - Intronic
955229030 3:57082927-57082949 CACCTTGGCCTCCCAAAGCGGGG + Intergenic
955329849 3:58038275-58038297 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
955341256 3:58127072-58127094 TGCCTTGGCCTCCCAAAGTTTGG - Intronic
955612671 3:60774547-60774569 CACCTTGACCTCCCAAAGAGTGG + Intronic
955675834 3:61448189-61448211 CGCCTTGGCCTCCCAAAGGCTGG + Intergenic
955833052 3:63025360-63025382 TGCCATGGCCTCCCAAACACTGG + Intergenic
956191388 3:66611580-66611602 CGCCTTGGCCTCTCAAACGCTGG - Intergenic
956264190 3:67379193-67379215 TGCCTCGGCCTCCCAAAGTCTGG + Intronic
956416559 3:69037244-69037266 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
956451508 3:69379525-69379547 CGCCTTGGCCTCCCAAATGCTGG + Intronic
956578107 3:70778482-70778504 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
956672908 3:71708120-71708142 CACCTTGGCCTCCCAAAGTGCGG + Intronic
956822569 3:72967015-72967037 CACCTTGGCCTCCCAAACTCTGG + Intronic
956849275 3:73213515-73213537 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
957138510 3:76321266-76321288 CACCTCGGCCTCCCAAAGTCTGG - Intronic
957330578 3:78758268-78758290 TGCCTCGGCCTCCCAAATGCAGG - Intronic
957330800 3:78760415-78760437 TGCCTCGGCCTCCCAAATGCAGG - Intronic
957968089 3:87346725-87346747 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
957969650 3:87366536-87366558 CACCTTGGCCTCCCAAAGGCTGG - Intergenic
958212579 3:90507243-90507265 CGCCTCGGCCTCCCAAATACTGG - Intergenic
958500075 3:94894192-94894214 CTCCTTGGCCTCCCAAAGGCTGG + Intergenic
958800844 3:98753713-98753735 TGCCTTGGCCTCCCAAATGCTGG - Intronic
959075267 3:101742993-101743015 CACCTTGGCCTCCCAAGTAATGG - Intronic
959077454 3:101764215-101764237 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
959364764 3:105443072-105443094 TATCTTGGCCTCCCAAAGCCTGG + Intronic
959542686 3:107558236-107558258 TGCCTTGGCCTCCCAAAGTGGGG - Intronic
959545542 3:107591734-107591756 CACCTTGGCCTCCCAAGTGCTGG + Intronic
959817355 3:110690403-110690425 CACCTTGGCCTCCCAAATGCTGG - Intergenic
959818350 3:110702903-110702925 TACCTTGGCCTCTCAAAGTGTGG + Intergenic
960323356 3:116264853-116264875 CACCTTGGCCTCCCAAGTGCTGG + Intronic
960341859 3:116484985-116485007 CACCTTGGCCTCCCAAAATGTGG - Intronic
960748962 3:120924956-120924978 CACCTCGGCCTCCCAAATGCTGG + Intronic
960884001 3:122375913-122375935 CACCTTGGCCTCCCAAAGTCAGG - Intronic
960981186 3:123228314-123228336 CGCCTTGGCCTCCCAAATGCTGG - Intronic
961250766 3:125503153-125503175 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
961550226 3:127666656-127666678 TCCCTTGGCCTCCCAAATGTTGG + Intronic
961684644 3:128621260-128621282 TGCCTTGGCCTCCAAAGTACTGG - Intronic
961763211 3:129187064-129187086 TACCTCGGCCTCCCAAGTGCTGG - Intergenic
962216698 3:133528739-133528761 TGCCCTGGCCTCCCAAAGTCTGG - Intergenic
962769523 3:138599683-138599705 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
963017213 3:140836868-140836890 TGCCTTGGCCTTCCAAATGCTGG - Intergenic
963122163 3:141785513-141785535 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
963146013 3:141995633-141995655 CACCTCGGCCTCCCAAATGCTGG - Intronic
963165933 3:142203524-142203546 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
963595368 3:147318510-147318532 TGCCTTGGCCTCCCAACTGCTGG + Intergenic
963743693 3:149104887-149104909 TGCCTTAGCCTCCCAAGTACTGG + Intergenic
963841487 3:150111743-150111765 TGCCTCGGCCTCCCAAATGCTGG - Intergenic
963917676 3:150874262-150874284 TGCCTTGGCCTCCCAACTATTGG + Intronic
964048302 3:152358856-152358878 CACCTTGGCCTCCCAAAGTGCGG + Intronic
964094438 3:152915070-152915092 TGCCTCGGCCTCCCAAAGGCTGG + Intergenic
964381455 3:156102200-156102222 CACCTTGGCCTCCCAAAGTACGG + Intronic
964446846 3:156768151-156768173 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
965048062 3:163604546-163604568 TGCCTCAGCCTCCCAAATACAGG - Intergenic
965255903 3:166410499-166410521 TACCTCAGCCTCCCAAATGCTGG + Intergenic
965768782 3:172159030-172159052 CACCTTGGTCTCCCAAATGCTGG - Intronic
965825979 3:172730175-172730197 TGCCTTGGCCTCCCAAAGTCTGG - Intergenic
965867940 3:173228429-173228451 TACCTTGGCCTCCAAAGTATTGG - Intergenic
965959218 3:174408573-174408595 CACCTCGGCCTCCCAAAGAGTGG - Intergenic
966011229 3:175080211-175080233 CACCTCGGCCTCCCAAATGCTGG + Intronic
966155853 3:176915605-176915627 TTCCTTGGCCTCCCAAGTACTGG - Intergenic
966617300 3:181926293-181926315 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
967206845 3:187131300-187131322 TGCCTCGGCCTCCCAAAATCAGG - Intronic
967625336 3:191677076-191677098 TGCCTTGGCCTCCCAAAGTTGGG + Intergenic
968112073 3:196056648-196056670 CGCCTTGGCCTCCCAAATGCTGG + Intronic
968112638 3:196061736-196061758 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
968241333 3:197089276-197089298 CACCTTGGCCTCCCAAGTGCTGG - Intronic
968254227 3:197251134-197251156 CACCTCGGCCTCCCAAATGCTGG - Intronic
968270856 3:197402628-197402650 CACCTTGGCCTCCCAAAGTCTGG + Intergenic
968320947 3:197767700-197767722 TCCCTTGGCCTCCCAAGTGCCGG + Intronic
968819213 4:2837275-2837297 CACCTTGGCCTCCCAAGTGCTGG + Exonic
969122752 4:4921940-4921962 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
969176812 4:5405112-5405134 CACCTTGGCCTCCCAAAGTGGGG + Intronic
969217330 4:5732759-5732781 CACCTTGGCCTCCCAAATGTTGG - Intronic
969320204 4:6407647-6407669 TACCTCGGCCTCCCAAAGGCTGG + Intronic
969434161 4:7175047-7175069 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
969969064 4:11027424-11027446 TGCCTTGGCCTCCCAAACTGCGG + Intergenic
970388101 4:15577105-15577127 TACCTCAGCCTCCCAAGTACTGG + Intronic
970423518 4:15926429-15926451 CACCTTGGCCTCCCAAAGCTGGG + Intergenic
970525574 4:16928681-16928703 CACCTCGGCCTCCCAAGCTCTGG - Intergenic
970567366 4:17345877-17345899 TGCCTCGGCCTCCCAAAGAAGGG - Intergenic
970664197 4:18318465-18318487 CACCTCGGCCTCCCAAATATTGG + Intergenic
970960068 4:21861401-21861423 TGCCTTGGCCTCCCAAAGTTGGG - Intronic
971316040 4:25569010-25569032 TACCTTGGCCTCCAAAGTGCTGG + Intergenic
971316182 4:25570106-25570128 TGCCTTGGCCTCCCAAATGCTGG - Intergenic
971318469 4:25586379-25586401 TACCTTGGCCTCCCAAAGTGTGG - Intergenic
971518320 4:27516507-27516529 CACCTCGGCCTCCCAAATGCTGG - Intergenic
971540081 4:27804817-27804839 CACCTTGGCCTCCCAAAATGTGG + Intergenic
971731931 4:30395430-30395452 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
971816199 4:31493185-31493207 CACCTTGGCCTCCCAAAGTTTGG - Intergenic
971818366 4:31519671-31519693 CACCTTGGCCTCCCAAAGGCTGG - Intergenic
971869052 4:32212120-32212142 CGCCTTGGCCTCCCAAATGCTGG - Intergenic
971910385 4:32788693-32788715 CACCTTGGCCTCCCAAAGCTTGG - Intergenic
972059057 4:34845141-34845163 TACCTTGGCCTCCCAAATGCTGG + Intergenic
972169451 4:36327213-36327235 TGCCTTGGCCTCCCAAAATGCGG + Intronic
972349781 4:38225936-38225958 CACCTTGGCCTCCCAAACTGGGG + Intergenic
972446308 4:39147471-39147493 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
972467701 4:39372893-39372915 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
972523570 4:39885349-39885371 CACCTTGGCCTCCAAAATGCTGG - Intronic
972537750 4:40013392-40013414 TACCTCGGCCTCCCAAGTGCTGG - Intergenic
973712164 4:53640974-53640996 TACCTTTTCATCCCAAACAACGG - Intronic
973744758 4:53952426-53952448 CGCCTTGGCTTCCCAAATACTGG + Intronic
973815098 4:54612230-54612252 CACCTTGACCTCCCAAATGCAGG + Intergenic
973855674 4:55008161-55008183 CACCTTGGCCTCCCAAAAGCTGG + Intergenic
973955173 4:56056518-56056540 GGCCTTGGCCTCCCAAAGGCTGG - Intergenic
974042438 4:56869082-56869104 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
974042460 4:56869227-56869249 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
974419520 4:61654648-61654670 CACCTTGGCCTCCCAAAGTGCGG - Intronic
974769646 4:66395502-66395524 CACCTTGGCCTCCCAAAGTGAGG - Intergenic
975091154 4:70405813-70405835 TGCCTTGGCCTCCCAAAATGCGG - Intronic
975103429 4:70540806-70540828 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
975141810 4:70926231-70926253 CACCTTGGCCTCCCAAGTGCTGG + Intronic
975146885 4:70977935-70977957 CACCTTGTCCTCCCAAGCATTGG + Intronic
975209851 4:71687794-71687816 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
975346319 4:73296262-73296284 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
975530977 4:75399115-75399137 CACCTTGGCCTCCCAAATGCTGG - Intergenic
975633365 4:76423110-76423132 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
975866703 4:78731285-78731307 CACCTTAGCCTCCCAAATGCTGG - Intergenic
976187070 4:82452698-82452720 TACCTCAGCCTCCCAAACAGCGG + Intronic
976230288 4:82835545-82835567 CACCTCAGCCTCCCAAATACTGG - Intronic
976290321 4:83411076-83411098 AACCTTAGCCTCCCAAGCTCAGG - Intronic
976553994 4:86429552-86429574 TACCTTGGCCTCCCAAATGTTGG - Intronic
976621507 4:87132940-87132962 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
976644119 4:87369681-87369703 TGCCTTGGCCTCCCAAAGCCTGG + Intronic
976644798 4:87376254-87376276 TGCCTTGGCCTCCCAAATGCTGG - Intronic
976721375 4:88172044-88172066 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
976882600 4:89947031-89947053 TGCCTTGGCCTCCCAAAATGTGG - Intronic
976919686 4:90423470-90423492 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
976986342 4:91303711-91303733 AACCTTGACCTCCCAGACTCAGG - Intronic
977098946 4:92783632-92783654 TGCCTGGGCCTCCAAAACTCTGG - Intronic
977223286 4:94363822-94363844 TACCTCAGTCTCCCAAGCACTGG + Intergenic
977234023 4:94485583-94485605 TGCCTTGGCCTCCCAAATGCTGG - Intronic
977341357 4:95762712-95762734 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
977611097 4:99032478-99032500 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
978080066 4:104581272-104581294 CTCCTTGGCCTCCCAAAGTCTGG - Intergenic
978423403 4:108557833-108557855 TGCCTCGGCCTCCCAAAAAGTGG + Intergenic
978423984 4:108563027-108563049 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
978558454 4:110006090-110006112 TGCCTTGGCCTCCCAAAGCATGG - Intronic
978582660 4:110247868-110247890 TGCCTTGGCCTCCCAAAGCATGG + Intergenic
978706192 4:111714877-111714899 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
978738926 4:112115593-112115615 TACCTTGGCCTCCCAAAGGCTGG + Intergenic
978810892 4:112848408-112848430 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
979232935 4:118366918-118366940 CACCTTGGCCTCCCAAATGTTGG + Intergenic
979247805 4:118529234-118529256 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
979526189 4:121719650-121719672 CACCTTGGCCTCCAAAATGCGGG + Intergenic
980125533 4:128770546-128770568 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
980381124 4:132018920-132018942 TGCCTCGGCCTCCCAAATGCTGG - Intergenic
980584622 4:134795771-134795793 TACCTTGTCCTCCCAAAGTGCGG - Intergenic
980947812 4:139340071-139340093 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
981063811 4:140459979-140460001 TGCCTTGGCCTCCCAACTCCTGG + Intronic
981958633 4:150508535-150508557 CACCTTGGCCTCCCAAAGTGTGG + Intronic
982042079 4:151407231-151407253 TCCTTTGGCCTCCCAAACTGCGG + Intergenic
982269453 4:153571639-153571661 AACCTTGGCCTCCCGAGCTCAGG + Intronic
982735836 4:159006011-159006033 TGCCTTGGCCTCCCAAAGGCTGG + Intronic
983198146 4:164831036-164831058 TGCCTTGGCCTCCCAAAGTGGGG - Intergenic
983290064 4:165790673-165790695 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
983528233 4:168782658-168782680 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
983615758 4:169702691-169702713 TGCCTTGGCCTCCCAAAGCATGG - Intronic
983665183 4:170173440-170173462 TGCCTCGGCCTCCCAAATGCTGG + Intergenic
983768327 4:171516320-171516342 CACTTTGGCTTTCCAAACACTGG - Intergenic
983846657 4:172528591-172528613 CACCTTGGCATCCCAAAGTCTGG + Intronic
984015377 4:174419572-174419594 TGCCTTGGCCTCCCAAACGCTGG + Intergenic
984519858 4:180788502-180788524 TACCTCGGCCTCCCAAATGCTGG + Intergenic
984708611 4:182866152-182866174 CACCTCGGCCTCCCAAGCGCTGG + Intergenic
984777874 4:183499317-183499339 TACCTTGGCCACCCAGAGTCTGG + Intergenic
984836382 4:184025830-184025852 TGCCTTGGCCTCCAAAATGCTGG + Intergenic
984890050 4:184483810-184483832 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
984972379 4:185203084-185203106 TGTCTTGGCCTCCCAAAGTCCGG - Intronic
985060448 4:186072557-186072579 CACCTTGGCCTCCCAAGTGCTGG + Intronic
985080983 4:186263748-186263770 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
985101602 4:186463684-186463706 CGCCTTGGCCTCCCAAAGGCTGG - Intronic
985283722 4:188312816-188312838 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
986084561 5:4431287-4431309 CGCCTTGGCCTCCCAAATGCTGG + Intergenic
986188959 5:5475610-5475632 TAACTTGGCTTCTAAAACACAGG + Intronic
986340216 5:6782692-6782714 TACCTTGGCCTCCAAAGTACTGG + Intergenic
986396358 5:7334619-7334641 TACCTTAGCTTCTCACACACAGG + Intergenic
986473894 5:8104600-8104622 TGCCTTGGTCTCCCAAATGCTGG + Intergenic
986633853 5:9800941-9800963 TGCCTTGGCCTCCCAAAGTACGG - Intergenic
986704594 5:10444648-10444670 AGCCTTGGCCTCCCAAACTCTGG - Intronic
987387430 5:17343266-17343288 CACCTTGGCCTCCCAAAGCATGG - Intergenic
987569618 5:19639248-19639270 TGCCTCGGCCTCCCAAATACTGG + Intronic
987851315 5:23358985-23359007 TGCCTTGGCCTCCCAAAGTCTGG - Intergenic
988013900 5:25528545-25528567 TGCCTTGGCCTCCCAAAGTCTGG + Intergenic
988090151 5:26528993-26529015 TGCCTTGGCCTCCCAAATGTTGG - Intergenic
988522834 5:31961863-31961885 CACCTTGGCCTCCCAGATTCTGG + Intronic
988812712 5:34801491-34801513 CACCTTGGCCTCCCAAAGTGTGG - Intronic
988877387 5:35462080-35462102 TGCCTTGGCCTCCCAAAGTTTGG - Intergenic
989065025 5:37451745-37451767 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
989067285 5:37476794-37476816 TGCCTTGGCCTCCCAAACTGTGG + Intronic
989756891 5:44966158-44966180 CACCTTGGCCTCTCAAACCAAGG - Intergenic
990303544 5:54473022-54473044 CACCTCGGCCTCCCAAATGCTGG + Intergenic
990404414 5:55473916-55473938 TGACTTGGCCTCCCAAATGCTGG + Intronic
990707857 5:58549900-58549922 CACCTTGGCCTCCCAAGTGCTGG - Intronic
990809158 5:59702618-59702640 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
990878287 5:60511216-60511238 CACCTTGGCCTCCCAAAGTGAGG + Intronic
991059258 5:62355491-62355513 TGCTTTGCCCTCCCAAAGACAGG - Intronic
991301039 5:65129394-65129416 CACCTTGGCCTCCCAAAGTTTGG + Intergenic
991345959 5:65668492-65668514 TGCCTTGGCCTCCCAAATGCTGG - Exonic
991693036 5:69244078-69244100 TGCCTTGGCCTCCCAAAATGCGG + Intronic
991702979 5:69333110-69333132 CGCCTTGGCCTCCCAAAAGCTGG - Intergenic
991727333 5:69548708-69548730 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
991734664 5:69620813-69620835 CGCCTTGGCCTCCCAAATGCTGG + Intergenic
991780314 5:70125908-70125930 CGCCTTGGCCTCCCAAATGCTGG - Intergenic
991811098 5:70475954-70475976 CGCCTTGGCCTCCCAAATGCTGG + Intergenic
991859601 5:71001322-71001344 CGCCTTGGCCTCCCAAATGCTGG - Intronic
991872761 5:71126219-71126241 CGCCTTGGCCTCCCAAATGCTGG - Intergenic
992145048 5:73837986-73838008 CACCTTGGCCTCCCAAGTACTGG + Intronic
992399336 5:76397384-76397406 CACCTTGGCCTCCCAAAGTCTGG + Intergenic
992579692 5:78158944-78158966 CGCCTTGGCCTCCCAAATGCTGG + Intronic
992606514 5:78462570-78462592 TGCCTTGGCCTCCCAAAGTTCGG + Intronic
992797066 5:80262920-80262942 TGCCTTGGCCTCCCAAAATGCGG + Intergenic
992913061 5:81417111-81417133 CACCTTGGCCTCCCAAGTGCTGG + Exonic
993093618 5:83457487-83457509 TTCCTTTCCCTCCCCAACACTGG - Intergenic
993299193 5:86185198-86185220 AACCTCTGCCTCCCAGACACAGG - Intergenic
993412155 5:87587501-87587523 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
993652549 5:90539738-90539760 CTCCTTGGCCTCCCAAATGCTGG - Intronic
993717420 5:91289494-91289516 CATCTTGGCCTCCCAAGCGCTGG + Intergenic
993978454 5:94511737-94511759 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
994456373 5:100013185-100013207 CGCCTTGGCCTCCCAAATGCTGG - Intergenic
994995827 5:107061848-107061870 TGCCTTGGCCTCCCAAGTATTGG - Intergenic
995655308 5:114419739-114419761 CACCTTGGCCTCCCAATTGCTGG - Intronic
995698743 5:114908977-114908999 CACCTTGGCCTCCAAAGAACTGG - Intergenic
996077647 5:119215845-119215867 CACCTTGGCCTCCCAAATGCTGG - Intronic
996102969 5:119463917-119463939 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
996718343 5:126605644-126605666 TGCCTTGGCCTCCCAAATGCTGG + Intronic
997128014 5:131247887-131247909 TGCCTTGGCCTCCCAAAGTCTGG + Intronic
997317451 5:132949426-132949448 CACCTTGGCCTCCCAAAGTGCGG - Intronic
997480753 5:134182902-134182924 TACCTTGGCCTCCCAACGCTGGG + Intronic
997483850 5:134211723-134211745 CGCCTTGGCCTCCCAAAGGCTGG + Intronic
997502118 5:134383707-134383729 TGCCTTGGCCTCCCAAATGTTGG + Intronic
997535077 5:134614055-134614077 CACCTTGGCCTCCCAAAGTCTGG - Intronic
997542367 5:134673883-134673905 TGCCTTGGCCTCCCGAAGATAGG - Intronic
997951355 5:138245053-138245075 TACCTTGGCCTCCAAAGTGCTGG + Intergenic
998254977 5:140578285-140578307 TGCTTTGGCCTCCCAAAGGCTGG + Intronic
998533848 5:142910809-142910831 CACCTTGGCCTCCAAAGTACTGG + Intronic
998729960 5:145063548-145063570 TACCTGGAGCTCCCAAACAAAGG - Intergenic
998851761 5:146357754-146357776 CACGTTGGCCTCCCAAATGCTGG + Intergenic
998990025 5:147805515-147805537 TGCCTTGGCCTCCCAATGTCTGG + Intergenic
999183106 5:149684027-149684049 CACCTTGGCCTCACAAAGCCTGG + Intergenic
999225040 5:150014843-150014865 TACCTGGTCTTCCCAAACACTGG + Intronic
999562592 5:152820776-152820798 CAACTTGGCCTCCCAAATGCTGG - Intergenic
999612916 5:153390207-153390229 TACCTTGGCCTCCCAAGTGCTGG - Intergenic
999764050 5:154724913-154724935 CACCTTGGCCTCCCAAAGGCTGG + Intronic
999780184 5:154842919-154842941 TGCCTCAGCCTCCCAAGCACTGG + Intronic
1000284733 5:159817155-159817177 CACCTTGGCCTCCCAAAGGGGGG + Intergenic
1000385127 5:160667979-160668001 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1000405167 5:160879588-160879610 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1000549922 5:162648371-162648393 TGCCTCGGCCTCCAAAGCACTGG - Intergenic
1000776104 5:165422364-165422386 CACCTTGGCCTCCCAAATGCTGG - Intergenic
1000911854 5:167031811-167031833 CACCTTGGCCTCCCAAAATGTGG + Intergenic
1001053018 5:168427844-168427866 CACCTCCGCCTCCCAAATACTGG - Intronic
1001405078 5:171470522-171470544 TGCCTCGGCCTCCCAAACAACGG + Intergenic
1001498089 5:172204399-172204421 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
1001502978 5:172253698-172253720 TGCCCTGGCCTCCCAAACTGCGG + Intronic
1001582863 5:172811284-172811306 CGCCTTGGCCTCCCAAAGCCTGG - Intergenic
1001665652 5:173431701-173431723 TACCTTGGCCTCCCAAGTGCTGG - Intergenic
1001796528 5:174506725-174506747 CACCTTGGCCTCCCAAAGGCTGG - Intergenic
1001897719 5:175396019-175396041 TACCTTGGCCTCCCAAAGTATGG + Intergenic
1001973322 5:175975004-175975026 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1002028040 5:176408767-176408789 CACTTTGGCCTCCCAAAATCTGG + Intronic
1002063584 5:176641068-176641090 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1002209338 5:177587239-177587261 TACCTTGGCCTCCCAAAGTGTGG + Intergenic
1002244115 5:177868779-177868801 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1002287286 5:178172594-178172616 TACCTCGGCCTCCCAAATGCTGG + Intergenic
1002352643 5:178593890-178593912 TGCCTCGGCCTCCCAAATGCTGG + Intergenic
1002541409 5:179908528-179908550 TACATTGGCCTCCCAAGTCCTGG + Intergenic
1002635123 5:180603461-180603483 TGCCTAGGCCTCCCAAGTACTGG - Intronic
1002689586 5:181041054-181041076 TCTCTTGCTCTCCCAAACACAGG - Intronic
1002694621 5:181076629-181076651 TGCCTTGGCCTCCCAACTGCTGG + Intergenic
1003279621 6:4680000-4680022 TGCCATGGCCTCCCAAACCTGGG + Intergenic
1003345715 6:5264653-5264675 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1003364694 6:5461286-5461308 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1003605156 6:7553216-7553238 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1003751491 6:9063189-9063211 CACCTCGGCCTCTCAAACAGAGG + Intergenic
1003790055 6:9536113-9536135 CACTTTGGTCTCCCAAATACTGG + Intergenic
1003842477 6:10136451-10136473 TGCCTTGGCCTCCCAAAAAGTGG - Intronic
1004023890 6:11800046-11800068 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1004175750 6:13338657-13338679 TGCCTTGGCTTCCCAAATGCTGG - Intergenic
1004220148 6:13739960-13739982 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1004448924 6:15726940-15726962 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1004468411 6:15906806-15906828 TGCCTGGGCCTCCCACACGCTGG + Intergenic
1004500538 6:16206063-16206085 TGCTTTGGCCTCCCAAAGAGTGG + Intergenic
1004628945 6:17403349-17403371 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1004666483 6:17752721-17752743 TACCTCGGCCTCCCAAATGCTGG + Intergenic
1004691248 6:17993977-17993999 TGCCTCAGCCTCCCAAATACTGG - Intergenic
1004695446 6:18028811-18028833 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1004727290 6:18323526-18323548 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1004952058 6:20684191-20684213 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1005151955 6:22761781-22761803 TGCCTCGGCCTCCCAAAGGCTGG + Intergenic
1005318133 6:24624287-24624309 TACCTCGGCCTCCCAAAGTTTGG + Intronic
1005326207 6:24703123-24703145 TGCCTTGGCCCCCCAAGTACTGG + Exonic
1005394014 6:25362784-25362806 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1005561865 6:27048684-27048706 CACCTTGGCCTCTCAAAAGCTGG + Intergenic
1005596369 6:27382081-27382103 TGCCTTGGCCTCCCAAAGTCTGG - Intronic
1005755871 6:28924327-28924349 TGCCTTGGCCTCCCAAATGCTGG - Intergenic
1005865789 6:29935054-29935076 TGCCTCAGCCTCCCAAAGACTGG + Intergenic
1005929564 6:30473590-30473612 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1005950928 6:30630687-30630709 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1006023977 6:31135464-31135486 TACCTCAGCCTCCCAAATGCTGG + Intronic
1006079082 6:31554155-31554177 TACCTTGGCATCCCAAAGTGTGG - Intronic
1006498461 6:34441206-34441228 CACCTTGGCCTCCCAAAGTACGG - Intergenic
1006546301 6:34784781-34784803 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1006551322 6:34825553-34825575 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1006650472 6:35547032-35547054 CACCTTGGCCTCCCAAATGTTGG + Intergenic
1006685677 6:35831336-35831358 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1006834304 6:36987425-36987447 CACCTTGGCCTCCCTAACCCAGG + Intergenic
1007383845 6:41507444-41507466 CACCTCGGCCTCCCAAAGTCTGG + Intergenic
1007439770 6:41848608-41848630 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
1007474727 6:42111671-42111693 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1007480379 6:42145777-42145799 TGCCGTGACCTCCCACACACTGG - Intergenic
1007488486 6:42199219-42199241 TGCCTTGGCCTCCCAACTGCTGG + Intergenic
1007545079 6:42687108-42687130 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
1007599738 6:43074566-43074588 GACCTCGGCCTCCCAAAGACTGG - Intronic
1007620443 6:43210223-43210245 CACCTTGGCCTGCCAAAGTCTGG + Intronic
1007678430 6:43617375-43617397 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1007970838 6:46050597-46050619 TGCACTGGCCTTCCAAACACAGG + Intronic
1007989324 6:46238800-46238822 TGCCTTAGCCTCCCAAAGACTGG + Intronic
1008049435 6:46884951-46884973 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1008833864 6:55803035-55803057 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1008841706 6:55910609-55910631 TGCCTTGGCCTCCCAAAGCGCGG - Intergenic
1008914441 6:56771930-56771952 TACTTTGGCCTCTAAGACACAGG + Intronic
1008934685 6:56977706-56977728 TGCCTTGGCCTTCCAAATGCTGG - Intronic
1009418172 6:63438162-63438184 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1009666579 6:66689163-66689185 TTCCTCTGCCTCCCAAAGACAGG + Intergenic
1009772187 6:68158026-68158048 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1010170349 6:72967843-72967865 TACCTTGGCCTCCCAACGTGTGG + Intronic
1010690238 6:78902520-78902542 TACCTCGGCCTCCCAAGTGCTGG - Exonic
1011457346 6:87566061-87566083 TGCCTTGGCCTCCCAAATGTTGG - Intronic
1011457428 6:87567022-87567044 TACCTTGGCCTCCCAAGGTCAGG + Intronic
1011628853 6:89305428-89305450 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1011632401 6:89339758-89339780 TACCTTAGCCTCCCAAGTGCTGG - Intronic
1012204676 6:96445739-96445761 TACCTTGGCCTCCCAAACTGTGG + Intergenic
1012214488 6:96565004-96565026 GACCTTGGCCTCCCAAAGCTAGG - Intronic
1012377761 6:98583114-98583136 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1012462235 6:99476357-99476379 CCCCTTGGCCTCCCAAATGCTGG - Intronic
1012462974 6:99484548-99484570 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1012611255 6:101223505-101223527 CACCTTGGCCTCCCAAGTTCTGG + Intergenic
1012907777 6:105088183-105088205 TGGGTTGGCCTCCAAAACACTGG - Intergenic
1013044015 6:106465771-106465793 TACCCTGCCCTCTCAAATACAGG + Intergenic
1013045870 6:106484566-106484588 TGCCTTAGCCTCCCAAAGTCTGG + Intergenic
1013176436 6:107681302-107681324 CACCTTGGCCTCCCAAAGGCTGG + Intergenic
1013242090 6:108255598-108255620 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1013525871 6:110973270-110973292 TGCTTTGGCCTCCCAAAGTCTGG - Intergenic
1013545093 6:111148857-111148879 CACCTCGGCCTCCCAAAGGCTGG - Intronic
1013565098 6:111350835-111350857 CACCTTGGCCTCCCAAAGATGGG + Intronic
1013753744 6:113437094-113437116 TACCTTGGCCTCCCAAGTGCTGG + Intergenic
1013778080 6:113701108-113701130 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1014099775 6:117499151-117499173 CGCCTTGGCCTCCCAAATGCTGG - Intronic
1014138381 6:117913800-117913822 CACCTTGGCCTCCCAAATGCTGG - Intronic
1014231810 6:118912067-118912089 TGCCTTGGCCTCCCAAATGCTGG - Intronic
1014438383 6:121445854-121445876 TGCCTTAGCCTCCCAAGCAATGG - Intronic
1014461168 6:121697467-121697489 TGCCTTGGCCTCCTAAATGCTGG - Intergenic
1014461415 6:121700282-121700304 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1014574872 6:123057590-123057612 TGCCTCGGCCTCCAAAATACTGG + Intronic
1014810434 6:125879746-125879768 TACCTTGGCCTCCAAAGTGCTGG - Intronic
1014846948 6:126289236-126289258 TACCTTGGCCTACAAGACCCTGG + Intergenic
1015194984 6:130515859-130515881 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1015234238 6:130952564-130952586 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1015243093 6:131047890-131047912 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1015380248 6:132558967-132558989 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1015558759 6:134492118-134492140 TACCTTGGCCTCTCAAAGTGTGG - Intergenic
1015758074 6:136628359-136628381 TGCCTCGGCCTCCCAACCACTGG + Intronic
1015833286 6:137392236-137392258 CACCTTGGCCTCCCAAAGTATGG + Intergenic
1015879228 6:137854512-137854534 TGCCTCGGCCTCCCAAGTACTGG - Intergenic
1015915501 6:138212277-138212299 TGCCTTGGCCTCCCAAATTGCGG - Intronic
1016050577 6:139526112-139526134 CACCTCGGCCTCCCAAATGCTGG + Intergenic
1016081736 6:139865198-139865220 CACCTAGGCCTCCCAAATGCTGG + Intergenic
1016355874 6:143217755-143217777 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1016501752 6:144727839-144727861 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1016973231 6:149784710-149784732 CACCTCGGCCTCCCAAAGACTGG + Intronic
1017020642 6:150137269-150137291 TACCTCGGCCTCCCAAGTGCTGG - Intergenic
1017463664 6:154674635-154674657 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1017494458 6:154971242-154971264 CACCTTGGCCTCCCAAATGCTGG + Intronic
1017673938 6:156794827-156794849 CACCTTGGTCTCCCAAAGTCTGG + Intronic
1017760605 6:157565163-157565185 AACCTTGACCTCCCAGACGCAGG - Intronic
1017813326 6:157999714-157999736 TTCCTTGCCCTCCCAAACCCTGG - Intronic
1017930179 6:158945793-158945815 AACCTTGACCTCCCAGGCACAGG + Intergenic
1018231321 6:161678813-161678835 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1018288959 6:162271112-162271134 TGCCTTGGACTCCCAAACACTGG + Intronic
1018326797 6:162679022-162679044 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1019542261 7:1556755-1556777 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1019775298 7:2909072-2909094 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1019970514 7:4536848-4536870 TGTCTGGGCCTCCCAAACGCTGG - Intergenic
1020036282 7:4965045-4965067 TGCCTTGGCCTCCCAAATGCTGG - Intergenic
1020068939 7:5212764-5212786 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1020164609 7:5798039-5798061 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1020197094 7:6049293-6049315 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1020235238 7:6349887-6349909 TGCCTTGGCCTCCCAAATGCTGG - Intergenic
1020326126 7:6975762-6975784 TGCCTTGGCCTCCCAAAGAGCGG - Intergenic
1020394636 7:7700474-7700496 CACATTGGCCTCCCACAAACTGG - Intronic
1020504493 7:8966668-8966690 TACCTTGGCCTCCCAAAGTGCGG + Intergenic
1020964901 7:14853606-14853628 CACCTCGGCCTCCCAATTACAGG - Intronic
1021030937 7:15734977-15734999 TGCCTTGGCCTCCCAAGTAGTGG - Intergenic
1021301268 7:18975897-18975919 TGCCCTGGCCTCCCTAACAGTGG + Exonic
1021378247 7:19935252-19935274 CGCCTTGGCCTCCCAAATGCTGG - Intergenic
1021563639 7:21994055-21994077 CACCTTGGCCTCCAAAGTACTGG + Intergenic
1021643836 7:22768184-22768206 TGCCTTGGCCTCCCAAAGGCAGG - Intergenic
1022366127 7:29719428-29719450 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1022686486 7:32602110-32602132 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1023024904 7:36041534-36041556 AACTTTGGCCTCCCAAAGGCTGG - Intergenic
1023039832 7:36162393-36162415 CACCTTGGCCTCCCAAAGTTGGG - Intronic
1023063367 7:36351145-36351167 CACCTTGGCCTCCCAAATGCTGG - Intronic
1023429236 7:40072373-40072395 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1023441614 7:40190495-40190517 TACCTTGGCCTCCAAAGTGCTGG + Intronic
1023444582 7:40218097-40218119 TGCCTCAGCCTCCCAAAAACTGG - Intronic
1023809236 7:43898885-43898907 TGCCTTGGCCTCCCAAGAGCTGG - Intronic
1023915587 7:44586449-44586471 TGCCTCGGCCTCCCAAATGCTGG - Intergenic
1024043408 7:45572283-45572305 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1024289426 7:47790982-47791004 TGCCTTGGCCTCCCAGATGCTGG + Intronic
1024420943 7:49165845-49165867 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1024523198 7:50325523-50325545 TGCCTTGGCCTCCCAAGCGCTGG - Intronic
1024551116 7:50562916-50562938 CACCTTGGCCTCCCAAAGGCTGG - Intronic
1024874902 7:54010573-54010595 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1025057293 7:55775328-55775350 CATCTTGGCCTCCCAAATGCTGG - Intergenic
1025857014 7:65290014-65290036 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1025863169 7:65352906-65352928 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1026007935 7:66614441-66614463 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1026025728 7:66741886-66741908 TGCCTTGGCCTTCCAAATGCTGG - Intronic
1026283955 7:68946800-68946822 TGCCTCAGCCTCCAAAACACTGG - Intergenic
1026545458 7:71318152-71318174 CACCTTGGCCTCCCAAGTACTGG + Intronic
1026718017 7:72806899-72806921 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1026763231 7:73142461-73142483 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1026855979 7:73755210-73755232 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1027039696 7:74952245-74952267 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1027083946 7:75250141-75250163 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1027151480 7:75737172-75737194 CACCTTGGCCTCCCAAAGTACGG + Intronic
1027180676 7:75937204-75937226 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1027206658 7:76105711-76105733 TGCCTTAGCCTCCCAAGCAGGGG - Intergenic
1027348771 7:77289052-77289074 CAACTTGGCCTCCCAAACTAAGG + Intronic
1027395689 7:77751386-77751408 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1027464197 7:78494204-78494226 TGCCTTGGCCTCCAAATTACTGG + Intronic
1027719903 7:81727289-81727311 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1027751968 7:82160720-82160742 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1027962308 7:84961605-84961627 TGCATTGGCCTCCCAAATGCTGG + Intergenic
1028353714 7:89881225-89881247 CACCTCGGCCTCCCAAAGTCTGG - Intergenic
1028842871 7:95447317-95447339 TACCTTGGCCTCCCATGCACTGG - Intergenic
1028911641 7:96214476-96214498 TGCCTGGGCCTCCCAAATGCTGG - Intronic
1028997919 7:97122103-97122125 CACCTGGGCCTCCCAAATGCTGG + Intronic
1029130413 7:98326038-98326060 TGCCTTGGCCTCCCAAAACTGGG - Intronic
1029175288 7:98660279-98660301 TACCTTAGCCTCCCAAGGAATGG - Intergenic
1029183931 7:98725138-98725160 CACCTCGGCCTCCCAAATGCTGG + Intergenic
1029268153 7:99358786-99358808 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1029312853 7:99683725-99683747 TTGCTTGGACTCCCACACACAGG + Intergenic
1029404418 7:100366200-100366222 CACCTTGGCCTCCCAATCCTGGG + Intronic
1029442243 7:100593380-100593402 CGCCTTGGCCTCCCAAAAACTGG - Intronic
1029467185 7:100733428-100733450 CGCCTTGGCCTCCCAAATGCTGG + Intergenic
1029491396 7:100872415-100872437 TGCCTTGGCCTCCCAAAGTCGGG + Intronic
1029498141 7:100909335-100909357 CACCTCGGCCTCCCAAATGCTGG - Intergenic
1029530994 7:101125215-101125237 TGCCTCGGCCTCCCAAATGCTGG - Intergenic
1029542632 7:101193201-101193223 CACCTTGGCTTCTCAAACTCTGG + Intergenic
1029567178 7:101346778-101346800 CAGCTCGGCCTCCCAAATACTGG - Intergenic
1029589325 7:101496635-101496657 CGCCTTGGCCTCCCAATTACAGG - Intronic
1029635368 7:101780011-101780033 CGCCTTGGCCTCCCAAACGCTGG - Intergenic
1029643246 7:101834420-101834442 TGCCTTGGCCTCCCAAATGCTGG + Intronic
1029998480 7:105032751-105032773 TGCCTTGGCCTCCCAAAATGTGG + Intronic
1030027103 7:105334918-105334940 CGCCTTGGCCTCCCAAAGTCTGG - Intronic
1030060847 7:105619804-105619826 TGCTTTGGCCTCCCAAGCGCTGG + Intronic
1030284949 7:107816478-107816500 CGCCTTGGCCTCCCAAATGCTGG - Intergenic
1030300075 7:107965850-107965872 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1030302405 7:107987748-107987770 TGCCTTGGCCTCCCAAAGTGAGG + Intronic
1030485784 7:110165536-110165558 TACCTTGGCCTCCAAAGAGCTGG - Intergenic
1030694656 7:112571600-112571622 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1030835658 7:114281348-114281370 CTCCTTGGCCTCCCAAAGTCTGG + Intronic
1031089896 7:117341537-117341559 TGCCTTTGCCTCCCAAACATTGG + Intergenic
1031409013 7:121420272-121420294 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1031549596 7:123091908-123091930 CATCTTGGCCTCCCAAATCCTGG - Intergenic
1031623943 7:123970504-123970526 TGTCTTGTCCTCCCAAACTCTGG - Intronic
1031782711 7:125989980-125990002 TGCCTCAGCCTCCCAAACTCTGG + Intergenic
1031842345 7:126759144-126759166 CACCTCGGCCTCCCAAATTCTGG + Intronic
1032238794 7:130145411-130145433 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1032412918 7:131712321-131712343 CACCTTAGCCTCCCAAAGTCTGG + Intergenic
1032617268 7:133487458-133487480 CACCTTGGCCTCCCAAAGAGAGG - Intronic
1032835348 7:135667459-135667481 AACCTTGGCCTCCCAAACTGTGG + Intronic
1032840432 7:135709177-135709199 TACCTCGGCCTCCCAAATTGCGG + Intronic
1032858282 7:135854953-135854975 TCCCTTGGCCTCCAAAATGCTGG + Intergenic
1032925616 7:136601342-136601364 TGCCTCGGCCTCCCAAATTCTGG + Intergenic
1033039215 7:137903059-137903081 CACCTTGGCCTCCCAAAGCACGG + Intronic
1033119252 7:138652433-138652455 CACCTTGGCCTCCAAAGCACTGG + Intronic
1033199726 7:139358927-139358949 TCCCTTGGCCTCCCAAAGTGCGG + Intronic
1033248219 7:139736440-139736462 CACCTTGGCCACCCTGACACTGG - Intronic
1033395533 7:140970558-140970580 TGCCTTGGCCTCTCAAAGGCTGG - Intergenic
1033666807 7:143448765-143448787 CACCTTGGCCTCCCAAACTGCGG - Intergenic
1033805334 7:144947614-144947636 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1034132771 7:148735922-148735944 TGCCCTGGCCTCCCAAATTCCGG - Intronic
1034158463 7:148974752-148974774 CACCTTGGCCTCCCAAACTTTGG - Intergenic
1034209978 7:149355204-149355226 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1034365130 7:150539794-150539816 TACCTCGGCCTCCCAAATGCTGG + Intergenic
1034389020 7:150768368-150768390 TGCCTTGGCCTCCCAAAATGTGG - Intergenic
1034723647 7:153315785-153315807 TGCCTTGGCCTCCCAAAGAGCGG - Intergenic
1034916619 7:155045280-155045302 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1034954404 7:155325636-155325658 TGCCTCTACCTCCCAAACACTGG - Intergenic
1035163823 7:156971584-156971606 TACCTTGGCCTCCCAAACACCGG + Exonic
1035201505 7:157270268-157270290 TACCTAGACTTCCCAAACACGGG + Intergenic
1035445342 7:158937673-158937695 TGCCTTGGCCTCCCAAATGCTGG - Intronic
1036427436 8:8658087-8658109 TGCCTCGGCCTCCCAAAATCTGG + Intergenic
1036429248 8:8674688-8674710 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1036456348 8:8912010-8912032 TGCCTTGGCTTCCCAAAGAGTGG - Intergenic
1036547865 8:9789557-9789579 TGCCTTGGCCTCCCAAAGCCTGG - Intergenic
1036678422 8:10853171-10853193 TTCCCTGCCCTCCCACACACAGG - Intergenic
1036823869 8:11961235-11961257 CACCCTGGCCTCCCAAATGCTGG + Intergenic
1036974465 8:13395367-13395389 CGCCTTGGCCTCCCAAAAGCTGG + Intronic
1037018667 8:13940921-13940943 TGCCTCAGCCTCCCAAATACTGG - Intergenic
1037258804 8:16984342-16984364 TGCCTTGGCCTCCCAAAGCATGG - Intergenic
1037270141 8:17117856-17117878 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1037626859 8:20615705-20615727 CAGCTTGGCCTCCCAAAGCCTGG + Intergenic
1037693466 8:21203808-21203830 CTCCTTGGCCTCCCAAACGCTGG - Intergenic
1037809579 8:22079519-22079541 TGCCTTTGCCTCCCAAGTACTGG - Intronic
1037842892 8:22257987-22258009 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1037907077 8:22721808-22721830 TGCTCTGGCCTCCCAAGCACTGG + Intronic
1037956057 8:23059758-23059780 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1037996654 8:23357316-23357338 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1038034765 8:23677830-23677852 CACCTTGGTCTCCCAAATGCTGG + Intergenic
1038570139 8:28654959-28654981 TTGCTTTGCCTCCCAAACAAAGG - Intronic
1038583839 8:28772108-28772130 TGCCTTGGCCTCCCAAGGGCTGG + Intronic
1038746030 8:30255782-30255804 TGCTTTGGCCTCCCAAATGCTGG - Intergenic
1039069473 8:33636454-33636476 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1039194537 8:35016148-35016170 CACCTTGGCCTTCCAAATGCTGG - Intergenic
1039402051 8:37278239-37278261 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1039446925 8:37640374-37640396 TATCTTGGCCTCCCAAGTGCTGG - Intergenic
1039466222 8:37787207-37787229 TGCCTCGGCCTCCCAAACACTGG - Intronic
1039531421 8:38266647-38266669 TGCCTTGGCCTCCCAATTGCTGG + Intronic
1039594957 8:38783667-38783689 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1039660103 8:39452149-39452171 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1039690711 8:39861910-39861932 CGCCTTGGCCTCCCAAACTGCGG + Intergenic
1039723255 8:40187547-40187569 CACCTTGGCCTCCAAAATGCTGG - Intergenic
1039813741 8:41073437-41073459 TGCCTTGGCCTCCCAAAGTATGG - Intergenic
1039870098 8:41538945-41538967 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1039871153 8:41546564-41546586 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1039891067 8:41685861-41685883 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1039974024 8:42344584-42344606 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
1039987130 8:42457174-42457196 TTCCTCAGCCTCCCAAACAGCGG + Intronic
1040037614 8:42885972-42885994 CACCTCGGCCTCCCAAAATCGGG - Intronic
1040051018 8:43014596-43014618 TGCCTTGGCCTCCCAAATGCTGG + Intronic
1040841163 8:51786455-51786477 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1040874583 8:52137851-52137873 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1040908116 8:52489714-52489736 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1041175675 8:55193811-55193833 TACCCAGAGCTCCCAAACACTGG - Intronic
1041511134 8:58656248-58656270 TGCCTTGGCCTCCCAAAATTTGG + Intronic
1041518168 8:58725736-58725758 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1041747940 8:61229873-61229895 CACCTTGGCCTCCCAAAGAGTGG + Intronic
1042006281 8:64183363-64183385 CACCTTGGCCTCCCCAGCACAGG + Intergenic
1042261647 8:66866004-66866026 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1042276042 8:67006615-67006637 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1042499208 8:69490348-69490370 CGCCTTGGCCTCCAAAGCACTGG + Intronic
1042526287 8:69768149-69768171 AGCCTTGACCTCCCAAACTCAGG - Intronic
1042538698 8:69885703-69885725 TGCCTTGGCCTCCCAAGTGCTGG - Intergenic
1042568148 8:70133471-70133493 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1043161673 8:76854307-76854329 TCCCTCGGCCTCTCAAACACCGG + Exonic
1043435888 8:80236169-80236191 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1043690777 8:83148471-83148493 TGCATTGGCCTCCCAAATGCTGG + Intergenic
1043942407 8:86210602-86210624 AACCTTGGCCTCCCAGGCTCAGG - Intergenic
1044510080 8:93066403-93066425 TGTCTTGGCCTCCCAAAGGCTGG - Intergenic
1044626501 8:94239551-94239573 TGCCTTGGCCTCCCAAAGCATGG - Intergenic
1044646656 8:94450629-94450651 CACCTTGGCCTCCCAAATTGTGG - Intronic
1044687346 8:94839780-94839802 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1044721798 8:95157976-95157998 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1045102347 8:98858131-98858153 CACCTCGGCCTCCCAAGGACTGG - Intronic
1045154352 8:99450464-99450486 CACCTTGGCCTCCCAAATGCTGG - Intronic
1045206887 8:100052547-100052569 TGCCTCGGCCTCCCAAATGCTGG + Intronic
1045208727 8:100071946-100071968 TGCCTTGGCCTCCCAAAACCTGG - Intronic
1045289792 8:100823294-100823316 TGCCTTGGCTTCCCAAAATCTGG + Intergenic
1045375502 8:101569717-101569739 TGCCTTGGCCTCCCAAAGTGCGG + Intronic
1045478183 8:102570901-102570923 AACCTTGACCTCCCAAGCTCAGG - Intergenic
1045522026 8:102912081-102912103 TTCCTTGGCCTCCCAAAGTGTGG + Intronic
1045784111 8:105901444-105901466 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1045842467 8:106596195-106596217 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1045881101 8:107041711-107041733 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1047110646 8:121785508-121785530 CACCTTAGCCTCCCAAACACTGG + Intergenic
1047273952 8:123390781-123390803 TGCCTTGGCCTCCCAAAGTCTGG - Intronic
1047419611 8:124696234-124696256 TGCCTCGGCCTCCCAAATGCTGG + Intronic
1047440348 8:124872127-124872149 CACCTTGGCCTCCCAAAATGTGG + Intergenic
1048104887 8:131397164-131397186 CACCTTGGCCTCCCAGATGCTGG - Intergenic
1048619350 8:136114669-136114691 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1048711012 8:137210655-137210677 TGCCTCGGCCTCCCAAATGCTGG + Intergenic
1048747424 8:137630531-137630553 TGCCTCGGCCTCCCAAATGCTGG - Intergenic
1048912078 8:139145085-139145107 TGCCTTGGCCTCCCAAAGTGCGG - Intergenic
1049100140 8:140573425-140573447 CGCCTTGGCCTCCCAAATGCTGG + Intronic
1049894036 9:97322-97344 CACCTTGGCCTCCCAAAATGCGG + Intergenic
1050112278 9:2229190-2229212 TGCCTTGGCCTCCCAAATGCTGG + Intergenic
1050227311 9:3474846-3474868 TTCCTTGGCCTCCCAAAGTGCGG - Intronic
1050371721 9:4928816-4928838 TATCTTGGCTTCCCAAACACTGG + Intergenic
1050548871 9:6732116-6732138 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1050848365 9:10253030-10253052 TGCCTTGGCCTCCCAAATGCTGG + Intronic
1051308561 9:15743418-15743440 TGCCTCAGCCTCCCAAACACTGG + Intronic
1051340927 9:16109620-16109642 TGCCTCAGCCTCCCAAATACTGG - Intergenic
1051730923 9:20141832-20141854 TGCCTTGGCCTCTCAAATGCTGG - Intergenic
1051768598 9:20551011-20551033 CACCTTAGCCTTCCAAAGACTGG + Intronic
1052568120 9:30184813-30184835 CGCCTTGGCCTCCCAAACTACGG + Intergenic
1052912235 9:33893878-33893900 TGCCTTGGCCTCCCAAATGCTGG + Intronic
1053163227 9:35828041-35828063 CGCCTTGGCCTCCCAAATTCTGG - Intronic
1053223782 9:36333708-36333730 CACCTTGGCCTCCAAAGTACTGG + Intergenic
1053233731 9:36433987-36434009 TGCCTTGGCCTCCCTAAGTCTGG - Intronic
1053336733 9:37280848-37280870 AGCCTTGGCCTCCCAGACTCAGG + Intronic
1053453972 9:38216836-38216858 TACCTTGGCCTCTCAAGTGCTGG + Intergenic
1053529830 9:38869583-38869605 CACCTCGGCCTCCCAAGTACTGG - Intergenic
1053735263 9:41097406-41097428 CACCTTGGCCTCCCAAAATGCGG + Intergenic
1054202055 9:62094010-62094032 CACCTCGGCCTCCCAAGTACTGG - Intergenic
1054636302 9:67494349-67494371 CACCTCGGCCTCCCAAGTACTGG + Intergenic
1054693116 9:68333991-68334013 CACCTTGGCCTCCCAAAATGCGG - Intronic
1054766121 9:69043969-69043991 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1054868914 9:70031131-70031153 TGCCTTGGCCTCCCAAATGCTGG + Intergenic
1055039326 9:71851884-71851906 CACCTTGGCCTCTCAAATGCTGG + Intergenic
1055190062 9:73508145-73508167 TATCTTGGCCTCCCAGTTACTGG - Intergenic
1055281397 9:74678784-74678806 CACCTCGGCCTCCCAAATGCTGG - Intronic
1055323411 9:75103977-75103999 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1055528031 9:77155029-77155051 TGCCTTGGCCTCCCAAAGCCTGG - Intergenic
1055575777 9:77659200-77659222 CACCTTGGCCTCCCAAAGCGAGG - Intergenic
1055593774 9:77844921-77844943 TGCCTCGGCCTCCCAAGTACTGG + Intronic
1055600881 9:77917252-77917274 TTCCTTGGCCACATAAACACAGG + Intronic
1055862873 9:80774393-80774415 TGCCTTGGCCTCCCAAGTAGTGG - Intergenic
1055925403 9:81505031-81505053 TGCCTTGGCCTCCCAACTGCTGG + Intergenic
1055940224 9:81642441-81642463 TTCCTCGGCCTCCCAAAGGCTGG - Intronic
1056105909 9:83346005-83346027 TGCCTCGGCCTCCCAAATGCTGG - Intronic
1056162339 9:83909359-83909381 TGCCTTAGCCTCCCAAAGTCTGG - Intronic
1056287160 9:85100873-85100895 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
1056414487 9:86362967-86362989 TACCTTGGGCTGCTAACCACCGG - Intergenic
1056754977 9:89376084-89376106 TGCCTTGGCCTCCCAAAGCAGGG + Intronic
1056963681 9:91148489-91148511 AACCTTGACTTCCCAAACTCAGG - Intergenic
1057007927 9:91576951-91576973 CACCTTGGCCTCCAAAATGCTGG + Intronic
1057098287 9:92332557-92332579 TGCCTTGGCCTCCCAAAAGCTGG - Intronic
1057173864 9:92980267-92980289 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1057220200 9:93253382-93253404 TACCATAGCCTCCCAAATTCTGG - Intronic
1057362126 9:94382939-94382961 TGCCTCGGCCTCCCAAAGTCTGG + Intronic
1057493435 9:95540872-95540894 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1057553654 9:96070660-96070682 TGCCTTGGCCTCCCAAAGCTGGG - Intergenic
1057661219 9:97005159-97005181 CACCTCGGCCTCCCAAAGTCTGG - Intronic
1057732674 9:97623608-97623630 CACCTTGGCCTCCCAAGTGCTGG - Intronic
1058399230 9:104594428-104594450 GACCTTGGCCTCTCAAGAACAGG + Intergenic
1058664460 9:107297585-107297607 TGCCTTGGCCTCCCAAAGTATGG + Intronic
1058680945 9:107439717-107439739 CACCTCGGCCTCCCAAAGGCTGG - Intergenic
1058721336 9:107767485-107767507 CTCCTTGGCCTCCCAAATGCTGG - Intergenic
1058907562 9:109494220-109494242 TGCCTTGGCCTCCCAAAGTGTGG - Intronic
1059038536 9:110787112-110787134 CACCTCGGCCTCCCAAACTGCGG - Intronic
1059207830 9:112483274-112483296 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1059303443 9:113334231-113334253 TGCCTTGGCCTCCCAAAGTGGGG + Intronic
1059530061 9:115027339-115027361 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1059627747 9:116085628-116085650 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1060535332 9:124382008-124382030 TACCTTGGCCTCCCAAAGGCTGG - Intronic
1060610583 9:124960866-124960888 CACCTTGGCCTCCCAAAGTGGGG - Intronic
1060648267 9:125301316-125301338 CACCTTGGCCTCCCAAAGTCTGG + Intronic
1060684843 9:125599881-125599903 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1060765167 9:126289989-126290011 CACCTTGGCCTCCCAAAAATGGG + Intergenic
1060935341 9:127511445-127511467 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1061126014 9:128676239-128676261 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1061171787 9:128961867-128961889 TGCCTTGGCCTCCAAAGCGCTGG + Intronic
1061321132 9:129830444-129830466 TGCCTTGGCCTCCCAAGTACTGG + Intronic
1061528019 9:131184277-131184299 CACCTTGGCCTCCCAAATGCTGG + Intronic
1061813124 9:133175104-133175126 CGCCTTGGCCTCCCAAATGCCGG + Intergenic
1061863674 9:133480659-133480681 TACCTTGGCCTCCTAAATGCTGG - Intergenic
1062228387 9:135466794-135466816 CACTTTGGCCTCCCAAAGCCTGG + Intergenic
1203448018 Un_GL000219v1:79097-79119 TGCCTTGGCCTCCCAAAGCTGGG - Intergenic
1185770935 X:2765097-2765119 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1186009169 X:5109473-5109495 CACCTTAGCCTCCCAAAGTCAGG - Intergenic
1186224847 X:7387743-7387765 CACCTCGGCCTCCCAAATGCTGG - Intergenic
1186485332 X:9930265-9930287 TGCCTTGGCCTCCCAAGTGCTGG - Intronic
1186502379 X:10061875-10061897 CACCTTGGCCTCCCAAGTGCTGG + Intronic
1186766105 X:12772052-12772074 TGCCTTGGCCTCCCAAAGTGTGG + Intergenic
1187007456 X:15246723-15246745 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1187486449 X:19708582-19708604 TACCATGGCTTCCCATACAATGG + Intronic
1188233724 X:27699776-27699798 TACTTTGGCCTCCCAAACAGTGG - Intronic
1188539262 X:31231628-31231650 TGCCTTGGCCTCCCAAAGGCTGG - Intronic
1188585016 X:31763313-31763335 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
1188937298 X:36192555-36192577 TACCCTTGCCTCCCTTACACAGG - Intergenic
1189749375 X:44203837-44203859 TACCTTGGCCTCCTAAAATATGG + Intronic
1190130529 X:47744454-47744476 TGCCTCGGCCTCCCAAGCACTGG + Intergenic
1190251717 X:48731932-48731954 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1190662286 X:52665912-52665934 TGCCTTGGCATCCCAAAGTCGGG + Intronic
1190860451 X:54339899-54339921 TGCCTTGGACTCCCAAACAGAGG - Intronic
1192396715 X:70789341-70789363 TGCCTTGGCCTCCCAAAGTTTGG - Intronic
1193132790 X:77935058-77935080 TGCGTTGGCCTCCCAAATGCGGG + Intronic
1193568424 X:83109864-83109886 TACCATGGCCTCCCAAACTCTGG + Intergenic
1193993469 X:88338046-88338068 TGCCATGGCCTCCCAAATGCTGG + Intergenic
1194360802 X:92948312-92948334 TGCCTTGGCCTCCCAAGTGCTGG + Intergenic
1194567429 X:95508984-95509006 TGCCTTGGCCTCCCAAAGTGTGG - Intergenic
1194714783 X:97275901-97275923 TGCCTTGGCCTCCCAAAGTGCGG - Intronic
1194726095 X:97398991-97399013 TGCCTCGGCCTCCCAAAGTCTGG + Intronic
1195024906 X:100866927-100866949 CACCTCGGCCTCCCAAAGGCCGG - Intronic
1195419698 X:104660686-104660708 CACCTTGGCCTCCCAAATGCTGG - Intronic
1195529373 X:105934921-105934943 CACCTTGGCCTCCCAAGAGCTGG + Intronic
1195610916 X:106864765-106864787 TGCCTTGGCCTCCCAAGTGCTGG + Intronic
1195686903 X:107595686-107595708 TGCCCTGGCCTCCCAAATGCAGG - Intronic
1195773517 X:108377679-108377701 TGCCTCGGCCTCCCAAATGCTGG - Intronic
1196123090 X:112071028-112071050 CACCCTGGCCTCCCAAAGAGTGG - Intronic
1196431649 X:115633417-115633439 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1197234435 X:124043397-124043419 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1197358307 X:125465318-125465340 TGCCTTGGCCTCCTAAGCACTGG + Intergenic
1197462287 X:126757270-126757292 CACCTCGGCCTCCCAAATGCTGG - Intergenic
1197738337 X:129869960-129869982 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1197835834 X:130692836-130692858 TGCCTTGGCCTCCCAAAGTGTGG + Intronic
1198367412 X:135955503-135955525 CACCTTGGCCTCCCAAGTGCTGG + Intergenic
1198535503 X:137582202-137582224 TGCCTTGGCCTCCCAAACGCTGG + Intergenic
1198703495 X:139421869-139421891 GACCTTGGCCTCCTCAGCACTGG + Intergenic
1198828095 X:140719839-140719861 TACCTCGGCCTCCCAAAGTGCGG - Intergenic
1200422418 Y:2985673-2985695 CACCTTGGCCTCCAAAATGCTGG + Intergenic
1200455460 Y:3385543-3385565 CACCTTGGCCTCCCAAGTGCTGG - Intergenic
1200527729 Y:4295370-4295392 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic
1200785473 Y:7256908-7256930 CACCTTGGCCTTCCAAATGCTGG - Intergenic
1201310055 Y:12588788-12588810 CACCTTGGACTCCCAAAGGCTGG + Intergenic
1201312474 Y:12609417-12609439 AACCTTGGCCTCCCAAAGCCTGG - Intergenic
1201316426 Y:12651550-12651572 TGTCTTGGCCTCCCAAACTGCGG - Intergenic
1201849994 Y:18469488-18469510 TGCCTTGGCCTCCAAAATGCTGG - Intergenic
1201883324 Y:18850887-18850909 TGCCTTGGCCTCCAAAATGCTGG + Intergenic
1202048001 Y:20753366-20753388 GTCCGTGGCCTCCCAAAAACTGG - Intergenic
1202084304 Y:21119555-21119577 CACCTTGGCCTCTCAAATGCCGG + Intergenic
1202102196 Y:21321702-21321724 TGCCTTGGCCTCCCAAAGTGCGG + Intergenic