ID: 1035163837

View in Genome Browser
Species Human (GRCh38)
Location 7:156971635-156971657
Sequence TCGAGCTAAAATAAAATTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035163837_1035163839 -1 Left 1035163837 7:156971635-156971657 CCTCAAATTTTATTTTAGCTCGA 0: 1
1: 0
2: 0
3: 20
4: 269
Right 1035163839 7:156971657-156971679 ACCCTATGGCAGTTTGTGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035163837 Original CRISPR TCGAGCTAAAATAAAATTTG AGG (reversed) Exonic
901525672 1:9821461-9821483 TATAATTAAAATAAAATTTGAGG + Intronic
903955947 1:27025900-27025922 TAGAGATTAAATAAAATATGAGG - Intergenic
904194182 1:28772343-28772365 TACAGCTAAAATAAAATTGAGGG - Intergenic
904935062 1:34124309-34124331 TGGAACTCACATAAAATTTGGGG + Intronic
904980148 1:34493528-34493550 TCGGACAAATATAAAATTTGGGG + Intergenic
907171549 1:52470797-52470819 TCCAGGTAAGATAAAATTTCTGG - Intronic
910304565 1:85748106-85748128 TCAAGCAAAAATAAAAATTAGGG - Intronic
910436949 1:87215067-87215089 TAGACCTAAAATAAAATTACCGG - Intergenic
911442530 1:97945451-97945473 TAGGGCTAAAATAAGAATTGGGG - Intergenic
911612933 1:99976956-99976978 TCAATCTAAAATAAAAGTTGGGG + Intronic
912201942 1:107468299-107468321 TAAAGCTAAAATATAATTTGAGG - Intronic
912740811 1:112195267-112195289 TCTTCCAAAAATAAAATTTGAGG + Intergenic
915860332 1:159437578-159437600 TCAAGTTGAAATAACATTTGAGG - Intergenic
916151762 1:161799573-161799595 TGAACCTAAAATAAAAGTTGGGG + Intronic
916956238 1:169838788-169838810 TAAATCTAAAATAAAAGTTGAGG - Intronic
918838509 1:189502649-189502671 TCTCACTAAAATAAAAGTTGTGG - Intergenic
918852934 1:189715799-189715821 TAGAGAGAGAATAAAATTTGAGG + Intergenic
919023485 1:192138058-192138080 TCTGGATAAAATAAATTTTGAGG - Intergenic
919287256 1:195579464-195579486 CCTAGCTAAAATAAAAGTTCTGG - Intergenic
920773617 1:208914050-208914072 TGAATCTAAAATGAAATTTGGGG + Intergenic
921565874 1:216719089-216719111 TTGAGCTAAAACAAATGTTGAGG + Intronic
922341694 1:224661980-224662002 TCTAGCTAATATATAATTTTGGG - Intronic
923223483 1:231917293-231917315 TCGAGATGCAATCAAATTTGAGG + Intronic
923478002 1:234355428-234355450 TCGATTTAAAATAAACTTTGTGG + Intergenic
923866635 1:237946751-237946773 TATAGTTAAAATAAAATTTTTGG + Intergenic
923958037 1:239044503-239044525 AGGAGCTAAAAGAAAATATGTGG - Intergenic
924324845 1:242885356-242885378 TGAATCTAAAATAAAAGTTGAGG + Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063710336 10:8471078-8471100 TGAACCTAAAATAAAAGTTGGGG - Intergenic
1063876140 10:10480858-10480880 ACCAACTAAAATAAAATTTATGG - Intergenic
1063937202 10:11090166-11090188 TGAATCTAAAATGAAATTTGGGG + Intronic
1063956404 10:11271565-11271587 TCGAGTAAAAATAAAATCTCTGG - Intronic
1064302000 10:14131156-14131178 TCTAGCAAAAGTATAATTTGGGG - Intronic
1065665306 10:28053231-28053253 ACCAGCTAAAATAACATTTTGGG + Exonic
1066994248 10:42549395-42549417 TCTACCTAAAAAAAAAATTGTGG - Intergenic
1069135517 10:64759081-64759103 TCTAGCTAAAAGAGGATTTGAGG - Intergenic
1069143456 10:64858766-64858788 TTGAACTGAAATAAAATTTTAGG - Intergenic
1071128839 10:82368783-82368805 TCTGGCTAAAATAATATTTATGG - Intronic
1072039873 10:91596824-91596846 GGGAGCTAAACTAGAATTTGGGG + Intergenic
1072178312 10:92952466-92952488 TGAATCTAAAATAAAAGTTGAGG - Intronic
1072240502 10:93491183-93491205 TAGAGCTAAAATACTATTTTTGG + Intergenic
1073312429 10:102552929-102552951 TCAAAATAAAATAAAAGTTGTGG + Intronic
1073371086 10:102989801-102989823 TCAAAATAAAATACAATTTGGGG + Intronic
1073727732 10:106253709-106253731 TAGAGCTACAATAAATTGTGGGG - Intergenic
1073961844 10:108940532-108940554 TTGAGCTAAGATACACTTTGGGG - Intergenic
1076455973 10:130596003-130596025 TACAGTTAAAATAAAATTTTAGG - Intergenic
1077861271 11:6182645-6182667 TTGAGTTTAAAGAAAATTTGTGG - Intergenic
1077987163 11:7364810-7364832 TAGGACTAAAATAGAATTTGGGG + Intronic
1079620598 11:22549596-22549618 TTGAGCTAAAATAACATTCATGG - Intergenic
1079736838 11:24008087-24008109 GGCAACTAAAATAAAATTTGAGG + Intergenic
1079853531 11:25569862-25569884 TAGAGATAGAAGAAAATTTGTGG - Intergenic
1080329398 11:31118094-31118116 TCCTAGTAAAATAAAATTTGAGG - Intronic
1084074677 11:66763904-66763926 TGGAGCTAAAATAAAAATCTTGG - Intronic
1084241997 11:67827929-67827951 TGGTGCTAAAAAAAAAATTGGGG - Intergenic
1086894094 11:92292360-92292382 TGGAGGTACATTAAAATTTGAGG - Intergenic
1087564949 11:99843442-99843464 TTGAGCTAAAAAAAAATTCTGGG - Intronic
1088620623 11:111678898-111678920 CCCAGCAAAAACAAAATTTGGGG + Intronic
1088907400 11:114165105-114165127 CCAAGCTAAAAAAAACTTTGAGG - Intronic
1089380214 11:118024771-118024793 TGAATCTAAAATAAAAGTTGAGG - Intergenic
1090284405 11:125486986-125487008 TCGAGATAAGGTATAATTTGGGG - Intronic
1090708825 11:129366605-129366627 TTGAGCTATAGTAAAATTTCTGG + Intergenic
1090895156 11:130965248-130965270 TGAATCTAAAATAAAAGTTGAGG - Intergenic
1092734025 12:11562410-11562432 TCTATTTAAAATAAAATTTCAGG - Intergenic
1092889812 12:12958751-12958773 TGAGGCTAAAATAAAATTTAAGG - Intergenic
1094213500 12:27917375-27917397 TAGTGCTAAAATAAACATTGGGG - Intergenic
1094346769 12:29478747-29478769 AGGATCTAAAATAAAATTTCTGG - Intronic
1097522446 12:60686290-60686312 TCAAACAAAAATAAAATTTATGG + Intergenic
1098205411 12:68104141-68104163 TCAAGCTAAAATAATATGTATGG + Intergenic
1099302547 12:80916018-80916040 TGATTCTAAAATAAAATTTGAGG + Intronic
1099500962 12:83414028-83414050 TTGAGCTAAAATAATTTTTCAGG + Intergenic
1103114079 12:118309869-118309891 TTGAGCTACAATAATAATTGTGG - Intronic
1106058069 13:26257044-26257066 TCCTGGTAAAATAAAATTTGTGG + Intronic
1106900542 13:34350878-34350900 TCCAACTAAAATTAATTTTGTGG - Intergenic
1107232566 13:38128128-38128150 TGCACCTAAAATAAAAGTTGGGG - Intergenic
1107501263 13:40978879-40978901 TGAATCTAAAATAAAAGTTGCGG - Intronic
1108829392 13:54458629-54458651 TCATGGTAAAATAAAATTAGTGG - Intergenic
1109217018 13:59601199-59601221 TCGAGGTCAATTAAAATGTGTGG + Intergenic
1109704335 13:66070294-66070316 ACGAGAGAAAATAAAATGTGAGG + Intergenic
1109779021 13:67083023-67083045 TGAAGCTAAAATAAAATTAATGG + Intronic
1109828605 13:67755984-67756006 TTAAACTAATATAAAATTTGTGG + Intergenic
1110023094 13:70500600-70500622 TTTAGCTCAAATAAAATATGAGG + Intergenic
1110138161 13:72094205-72094227 TCGCTTTAAAAAAAAATTTGTGG + Intergenic
1111797945 13:92947000-92947022 TAATTCTAAAATAAAATTTGGGG + Intergenic
1111842008 13:93461158-93461180 TCTAATAAAAATAAAATTTGTGG - Intronic
1114065526 14:19056071-19056093 TTGAACTAAAATTAATTTTGTGG + Intergenic
1114096735 14:19343930-19343952 TTGAACTAAAATTAATTTTGTGG - Intergenic
1115098024 14:29662956-29662978 TCGAAACAAAATAAAAATTGTGG - Intronic
1117644439 14:57836588-57836610 TTGAGTTAAAATAAAATTTCAGG - Intronic
1118651647 14:67902484-67902506 TTCAGCTAAAATAAAAGTTTTGG + Intronic
1120116503 14:80624369-80624391 TAGAGCTGAAATAAACATTGGGG + Intronic
1120175145 14:81285845-81285867 TGAATCTAAAATAAAAGTTGAGG + Intronic
1125588713 15:40841019-40841041 TGAATCTAAAATAAAAGTTGAGG - Intergenic
1125693981 15:41620325-41620347 TCAAGCCAAAATATAGTTTGGGG - Intergenic
1127497392 15:59525909-59525931 TCCAGCCAAAAGAAAATATGTGG + Intergenic
1127956036 15:63854356-63854378 TGAATCTAAAATAAAAGTTGTGG + Intergenic
1131886715 15:96923452-96923474 TTGAGCTAAAATAGTATTTTAGG + Intergenic
1133423499 16:5667020-5667042 TCAACCTCAAATGAAATTTGAGG - Intergenic
1133548727 16:6833465-6833487 GGGAGCTAAAATAAAGCTTGAGG - Intronic
1135030618 16:19035413-19035435 TGAATCTAAAATAAAAGTTGGGG + Intronic
1135307014 16:21376078-21376100 TGAATCTAAAATAAAAATTGAGG - Intergenic
1136303758 16:29355218-29355240 TGAATCTAAAATAAAAATTGAGG - Intergenic
1138168739 16:54829359-54829381 AAGAGGGAAAATAAAATTTGGGG - Intergenic
1138866825 16:60831852-60831874 TAGAGCTAAAATTAAAATTCAGG - Intergenic
1139399224 16:66667022-66667044 TGTATCTAAAATAAAAGTTGGGG + Intronic
1146295526 17:31647125-31647147 TCAAGCTTAAATAAAGTCTGAGG + Intergenic
1147243804 17:39107877-39107899 TCGAGGTAAAATAAATGTTAGGG - Intronic
1147487565 17:40832201-40832223 TTTAGTTAAAATAAAATTTCTGG - Intronic
1150513285 17:65778787-65778809 TGGAGATAAAAGAGAATTTGGGG + Intronic
1151451783 17:74202641-74202663 TGGAGATAAAATAAAAATGGAGG + Intergenic
1154179772 18:12124410-12124432 TTAAGATGAAATAAAATTTGTGG - Intronic
1155753826 18:29464117-29464139 TCTATATGAAATAAAATTTGGGG - Intergenic
1156665743 18:39404279-39404301 TCAAGCAAAAATTAAAATTGTGG + Intergenic
1157532573 18:48433819-48433841 TTGGGCTAAAATAAATATTGGGG + Intergenic
1157945434 18:51974350-51974372 GAGAGCTAGAATAATATTTGTGG + Intergenic
925785359 2:7427093-7427115 TCAAGCCAACATAATATTTGGGG + Intergenic
928816714 2:35305058-35305080 TCGAGTTAAACTAAATTTTGAGG + Intergenic
929543042 2:42837005-42837027 TAGAGCAAAGATAAAATTTAGGG + Intergenic
929651250 2:43681798-43681820 TGAATCTAAAATAAAAATTGAGG - Intronic
931156040 2:59631444-59631466 TGAAACTAAAATAAAAGTTGGGG - Intergenic
932601689 2:73131551-73131573 TCAATTTAAAAAAAAATTTGTGG + Intronic
933030428 2:77321652-77321674 TCTATCTAATATAAAATATGAGG - Intronic
934012179 2:87833678-87833700 ACAAGATAAAATAAAATGTGGGG + Intergenic
934626232 2:95857189-95857211 TTAAGATGAAATAAAATTTGGGG + Intronic
934807332 2:97244127-97244149 TTAAGATGAAATAAAATTTGGGG - Intronic
934830178 2:97513060-97513082 TTAAGATGAAATAAAATTTGGGG + Intronic
937602211 2:123752108-123752130 TCCACCTCAAATTAAATTTGGGG - Intergenic
938482947 2:131676432-131676454 TTGAACTAAAATTAATTTTGTGG + Intergenic
939472504 2:142641713-142641735 TGAATCTAAAATAAAAGTTGAGG + Intergenic
939940373 2:148342774-148342796 TGAATCTAAAATAAAAGTTGAGG - Intronic
940211926 2:151263772-151263794 TGGAGATAAAATATAAATTGGGG - Intergenic
940211934 2:151263924-151263946 TGGAGATAAAATATAAATTGGGG - Intergenic
940266268 2:151842187-151842209 ATTAGCTAAAATCAAATTTGAGG + Intronic
941333445 2:164209639-164209661 TCCAGAGAAAATAAAATTAGAGG - Intergenic
941483614 2:166050382-166050404 TCGAAGTAAAATAATATCTGAGG - Intronic
942291217 2:174473203-174473225 TCAAAATAAAATAAAAATTGTGG - Exonic
943180476 2:184534522-184534544 TGTATCTAAAATAAAATTTAAGG + Intergenic
943413312 2:187566188-187566210 TAGAAATAAAATAAAATTTCAGG + Intergenic
943528579 2:189050151-189050173 TTGAGCTAAAGTAATATTTGAGG - Intronic
944544506 2:200785643-200785665 GAGAGATAAAATAGAATTTGTGG + Intergenic
944952362 2:204766700-204766722 AGGAACTAAAAAAAAATTTGAGG + Intronic
945337076 2:208605122-208605144 TAGATCTAAAATAAACTCTGTGG + Intronic
945633839 2:212321096-212321118 TCTACATTAAATAAAATTTGTGG + Intronic
945831342 2:214790108-214790130 ACTAGCTAGAATAAAATTTCTGG + Intronic
947844602 2:233233730-233233752 TCGAGGTATAATATAATTTTTGG + Intronic
948164673 2:235851756-235851778 TTGAGCTGAAATTAAATCTGGGG + Intronic
948425437 2:237884331-237884353 TGGAGCTACAATCTAATTTGAGG + Intronic
1169188587 20:3641949-3641971 TCCTGGTAAAATAATATTTGTGG + Intronic
1169651530 20:7873574-7873596 TTTAGCTAAAATAAGATTTCGGG + Intergenic
1170445472 20:16422850-16422872 TTGTGCTAAAATGTAATTTGAGG - Intronic
1170524546 20:17225647-17225669 TCAAGCTAAAATAAAAAGAGAGG + Intergenic
1176703838 21:10094079-10094101 CCAAGGTAAAAGAAAATTTGTGG + Intergenic
1177067046 21:16452099-16452121 TGGAGGGAAAAGAAAATTTGGGG + Intergenic
1180484008 22:15778664-15778686 TTGAACTAAAATTAATTTTGTGG + Intergenic
1180566874 22:16677081-16677103 TTAAGATGAAATAAAATTTGTGG + Intergenic
1180683731 22:17648395-17648417 TCAAGCTAAATTAGAAGTTGGGG + Intronic
1182253962 22:29024778-29024800 TCCAGAAAAAATAAAATTTCAGG + Intronic
1182259330 22:29061803-29061825 GCTAGCGAAAATAAAATTTAAGG - Exonic
1184323626 22:43764060-43764082 TTAATCTAAAATAAAACTTGAGG - Intronic
1184532572 22:45065711-45065733 TGAAACTAAAATAATATTTGTGG - Intergenic
949093029 3:51685-51707 TCGAGACAAAACAAAATGTGAGG + Intergenic
949817615 3:8076571-8076593 TCAAGATAAAAGAGAATTTGGGG + Intergenic
950354243 3:12391144-12391166 TAGTGCTAAATTAAAATTTGTGG - Intronic
951099620 3:18671933-18671955 TCTTGCAAAAAAAAAATTTGGGG - Intergenic
951402292 3:22248294-22248316 TCAAGCTTGAATAAAATTTAAGG - Intronic
956132225 3:66064991-66065013 TTCTGCTAAATTAAAATTTGTGG + Intergenic
956428165 3:69158057-69158079 TGCATCTAAAATAAAAGTTGAGG + Intergenic
957274275 3:78069787-78069809 TCTATTTAAAATAGAATTTGAGG - Intergenic
957582513 3:82092833-82092855 TGAATCTAAAATAAAAGTTGAGG - Intergenic
958072388 3:88630840-88630862 TGGACCTAAAATAAATTTTCAGG + Intergenic
958488508 3:94743067-94743089 TGAACCTAAAATAAAAGTTGAGG + Intergenic
958695603 3:97523985-97524007 TAAAGCTAAAATAAGATTTTTGG + Intronic
959745672 3:109774438-109774460 TAGAGAAAAAATAAAAGTTGAGG + Intergenic
963120529 3:141772830-141772852 TTAATCTAAAATAAAAGTTGAGG + Intergenic
964542508 3:157795252-157795274 TGGACCTTAATTAAAATTTGTGG + Intergenic
965140555 3:164828334-164828356 GCCAGCTAAATTCAAATTTGGGG - Intergenic
965710238 3:171549585-171549607 TTGTGCTTAAATAAAATTTGGGG - Intergenic
966110936 3:176400678-176400700 TTGAGGAAAAATAAAAGTTGGGG - Intergenic
966598299 3:181748013-181748035 TCAAATTAGAATAAAATTTGAGG + Intergenic
967244685 3:187473884-187473906 TAGACCTAAAATAAAATGTCTGG + Intergenic
971540385 4:27808846-27808868 TCTAGATGAAATAAGATTTGAGG + Intergenic
971820963 4:31554762-31554784 TAGAGCTAAAATAAAATATAAGG - Intergenic
972711443 4:41600049-41600071 ACTGGATAAAATAAAATTTGGGG + Intronic
973149740 4:46872543-46872565 CCAAGCTAAACTACAATTTGGGG + Intronic
974941458 4:68474153-68474175 TGGAGCTAAATGACAATTTGAGG + Intronic
975267335 4:72385841-72385863 TGAATCTAAAATAAAAGTTGGGG + Intronic
976651876 4:87444400-87444422 TGGAGGGAAGATAAAATTTGGGG - Intronic
977027451 4:91836961-91836983 TAAAGCTAAAGTAAAATTTGAGG - Intergenic
978243681 4:106547614-106547636 TTGATCAAGAATAAAATTTGTGG - Intergenic
979356846 4:119715062-119715084 TAGAGCTGAAATAAATTTAGAGG + Intergenic
980303852 4:131030786-131030808 TAGATTTAAAGTAAAATTTGTGG + Intergenic
980376054 4:131950431-131950453 CCAAGGTAAAAGAAAATTTGTGG + Intergenic
982037369 4:151359004-151359026 TTTAGCTAAAAAAAAATTTGGGG + Intergenic
982547497 4:156753198-156753220 TCAAGCAAAAATAAAATTATTGG + Intergenic
982566603 4:156995008-156995030 TGAAACAAAAATAAAATTTGAGG - Intergenic
984014547 4:174410374-174410396 TCCAGCAAAAAAAAAATCTGTGG + Intergenic
984306063 4:177992945-177992967 ATGAGCAAAAATAAAATTAGAGG - Intergenic
986528345 5:8705109-8705131 TCTAGCTAAAATAAGGTTTTAGG - Intergenic
987696202 5:21336340-21336362 CCAAACTAAAATAAAATGTGAGG - Intergenic
987931287 5:24402199-24402221 TGGAAATGAAATAAAATTTGAGG - Intergenic
988418855 5:30980617-30980639 TCCAGCTTAACTAAAATTTTTGG + Intergenic
988575647 5:32421419-32421441 TAGAATTAAATTAAAATTTGGGG + Intronic
988755938 5:34249895-34249917 CCAAACTAAAATAAAATGTGAGG + Intergenic
989021924 5:37017763-37017785 TATAGCTAAAAAAAAATTAGAGG - Intronic
989488377 5:42020058-42020080 TCCTGCCAAAATAAAAATTGTGG + Intergenic
990251163 5:53916497-53916519 TAAACCTAAAATAAAAGTTGGGG + Intronic
991744202 5:69715749-69715771 CCAAACTAAAATAAAATGTGAGG + Intergenic
991753504 5:69839488-69839510 CCAAACTAAAATAAAATGTGAGG - Intergenic
991795774 5:70295473-70295495 CCAAACTAAAATAAAATGTGAGG + Intergenic
991803121 5:70396215-70396237 CCAAACTAAAATAAAATGTGAGG - Intergenic
991823576 5:70591016-70591038 CCAAACTAAAATAAAATGTGAGG + Intergenic
991832823 5:70714612-70714634 CCAAACTAAAATAAAATGTGAGG - Intergenic
991888144 5:71294991-71295013 CCAAACTAAAATAAAATGTGAGG + Intergenic
992040946 5:72831426-72831448 CTGATATAAAATAAAATTTGGGG + Intronic
992092419 5:73329122-73329144 TTTAGCTAAAATAACATATGTGG + Intergenic
993639094 5:90380724-90380746 TCGAGCAAGAAGGAAATTTGAGG + Intergenic
993929953 5:93925820-93925842 TCAAGACAAAGTAAAATTTGAGG + Intronic
994362068 5:98863055-98863077 TCAAGCAACAATAAACTTTGTGG + Intronic
996962743 5:129270494-129270516 TGAAGCTAAAATAAAAGTAGAGG + Intergenic
998738454 5:145170695-145170717 ACTATCTAAAATAAAAGTTGTGG - Intergenic
998952006 5:147401941-147401963 TTGAGGCAAATTAAAATTTGAGG + Intronic
999463318 5:151775878-151775900 TTGAGATAAAGTAAGATTTGTGG + Intronic
999555160 5:152733518-152733540 TCCAGCTAAAATAAAGTTTTTGG + Intergenic
1000077051 5:157800655-157800677 TTAAGATAAAATAAAATTTAAGG + Intronic
1000280426 5:159777092-159777114 AGGAGCTCAAATAAAATTTGTGG - Intergenic
1000627775 5:163558942-163558964 TGAACCTAAAATAAAAGTTGGGG + Intergenic
1003129397 6:3382420-3382442 TTGAGGCAAAATAAAAGTTGAGG - Intronic
1005347995 6:24909382-24909404 AGCAGCTAAAATACAATTTGAGG + Intronic
1005554586 6:26961689-26961711 CCAAACTAAAATAAAATGTGAGG + Intergenic
1005799261 6:29403563-29403585 TAAAGCTAAAATAAGATTTCTGG + Intronic
1006343704 6:33462691-33462713 TCTATCTAAAATAAAAGTTGAGG + Intergenic
1007888725 6:45263622-45263644 TGAATCTAAAATAAAATTGGAGG + Intronic
1008075777 6:47144102-47144124 TAGAGAGAAAAGAAAATTTGAGG - Intergenic
1010062533 6:71640582-71640604 ACAAGCAAAAATAAAATTTTAGG + Intergenic
1010172382 6:72988609-72988631 TCTATCTAAAATAAAACTTGGGG + Intronic
1010243899 6:73644599-73644621 TGGAGCTGAAATAAAGATTGGGG + Exonic
1010283543 6:74048442-74048464 TAAAACTAAAATAAAATTTCAGG + Intergenic
1011050474 6:83142528-83142550 TAAAAATAAAATAAAATTTGAGG + Intronic
1011087321 6:83556567-83556589 TTTAGCCAAAGTAAAATTTGGGG + Intronic
1012628539 6:101434011-101434033 GCGGGCTACAGTAAAATTTGGGG - Intronic
1014451013 6:121581776-121581798 TGCAGCTAAAGCAAAATTTGGGG + Intergenic
1020667428 7:11065778-11065800 TAAAGTTAAGATAAAATTTGAGG - Intronic
1020717387 7:11692491-11692513 GAGAACTAAAATAAAATATGAGG + Intronic
1022759189 7:33328560-33328582 CTGAGGTAGAATAAAATTTGGGG + Intronic
1027484030 7:78737141-78737163 TAGAGCTAAATTATAATTTGGGG + Intronic
1027720235 7:81731842-81731864 ACATGCTAAAAGAAAATTTGGGG + Intronic
1028479580 7:91290114-91290136 TCTGGCTAAAATAAGGTTTGGGG - Intergenic
1030001985 7:105074076-105074098 TTAAGATAAAATAAAAATTGTGG - Intronic
1032861348 7:135882913-135882935 TGTATCTAAAATAAAAGTTGAGG + Intergenic
1034735956 7:153429833-153429855 CAGAGCAAAAATAAAATTTGAGG + Intergenic
1035163837 7:156971635-156971657 TCGAGCTAAAATAAAATTTGAGG - Exonic
1035836583 8:2760798-2760820 TTGAGTTTAAAGAAAATTTGAGG - Intergenic
1036982541 8:13486602-13486624 TTGAACTAAAATAAAATGTGTGG - Intronic
1037869602 8:22480777-22480799 TTGACCTAAAATTAACTTTGGGG - Intronic
1038832732 8:31080178-31080200 TTAAGTTAAAAGAAAATTTGGGG - Intronic
1039703519 8:39984864-39984886 ACTAGCTAGAATAAAATGTGGGG + Intronic
1039833863 8:41239844-41239866 GGGAGCAAATATAAAATTTGAGG - Intergenic
1041782591 8:61593880-61593902 TTTATCTAAAATAACATTTGAGG - Intronic
1042740861 8:72044308-72044330 TCAAGCTAAAATAAAAAATATGG + Intronic
1043411308 8:79999377-79999399 TATATCTAAAACAAAATTTGTGG - Intronic
1043630031 8:82319299-82319321 TCTAGTTAAAATGAAATATGTGG + Intergenic
1043630675 8:82327848-82327870 TGGAGCAAAATTGAAATTTGAGG + Intergenic
1045854652 8:106750058-106750080 ATCATCTAAAATAAAATTTGGGG - Intronic
1047204178 8:122790197-122790219 TCTAGCTGAAAAAAAATTTAGGG + Intronic
1047602991 8:126445845-126445867 TTGAGCTAAACTTAGATTTGGGG - Intergenic
1047702209 8:127460447-127460469 TGAATCTAAAATAAAATTTGAGG + Intergenic
1050375586 9:4969570-4969592 TCGGGCTAATCTAAACTTTGAGG - Intergenic
1051096045 9:13466245-13466267 TAGATGTAAAACAAAATTTGCGG + Intergenic
1051365989 9:16321814-16321836 TCCAGGTATAATAAAAATTGGGG + Intergenic
1051729114 9:20120688-20120710 TGAACCTAAAATAAAAGTTGGGG + Intergenic
1052892523 9:33716910-33716932 TGAACCTAAAATAAAAGTTGGGG + Intergenic
1053641101 9:40081100-40081122 CCAAGGTAAAAGAAAATTTGTGG + Intergenic
1053765037 9:41384369-41384391 CCAAGGTAAAAGAAAATTTGTGG - Intergenic
1054321843 9:63677395-63677417 CCAAGGTAAAAGAAAATTTGTGG + Intergenic
1054543652 9:66295531-66295553 CCAAGGTAAAAGAAAATTTGTGG - Intergenic
1055126766 9:72727716-72727738 TTGAGCAAAAATGAGATTTGGGG - Intronic
1055184057 9:73428814-73428836 TGAAGCTAAGATAAAATTTCAGG + Intergenic
1202788876 9_KI270719v1_random:64175-64197 CCAAGGTAAAAGAAAATTTGTGG + Intergenic
1203583209 Un_KI270746v1:34136-34158 TTAAGATGAAATAAAATTTGGGG - Intergenic
1186642279 X:11468510-11468532 TAGATTCAAAATAAAATTTGTGG - Intronic
1188736654 X:33726113-33726135 TTGAGTTAAAATAAATATTGTGG - Intergenic
1193050849 X:77097838-77097860 TCAAGCTAGAAAAAAACTTGAGG - Intergenic
1193052698 X:77117810-77117832 TTCATCTAAAATAAAATCTGAGG - Intergenic
1194162342 X:90469177-90469199 TCTAAATAAAATAAAATTTTTGG - Intergenic
1194802949 X:98294061-98294083 TAAACCAAAAATAAAATTTGAGG - Intergenic
1198508916 X:137329419-137329441 TTGCACTAAAATAAAATTTAAGG - Intergenic
1198937114 X:141910047-141910069 TGGAGCTTAAATAAAACTAGTGG + Intergenic
1199102724 X:143823321-143823343 GGGAGCAAAAATAAATTTTGAGG + Intergenic
1199132304 X:144204865-144204887 ACAAGATAAAATAAAATGTGGGG - Intergenic
1200508622 Y:4046914-4046936 TCTAAATAAAATAAAATTTTTGG - Intergenic
1201222377 Y:11784350-11784372 TGAATCTAAAATAAAAGTTGAGG + Intergenic