ID: 1035165486

View in Genome Browser
Species Human (GRCh38)
Location 7:156987091-156987113
Sequence ACTTCTGCACACTTGTACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035165486_1035165489 1 Left 1035165486 7:156987091-156987113 CCACAGTACAAGTGTGCAGAAGT No data
Right 1035165489 7:156987115-156987137 AAGCTCCTCCTGCTGGAGCAGGG No data
1035165486_1035165496 20 Left 1035165486 7:156987091-156987113 CCACAGTACAAGTGTGCAGAAGT No data
Right 1035165496 7:156987134-156987156 AGGGACAGGGCAATAGGGAAAGG No data
1035165486_1035165487 -6 Left 1035165486 7:156987091-156987113 CCACAGTACAAGTGTGCAGAAGT No data
Right 1035165487 7:156987108-156987130 AGAAGTCAAGCTCCTCCTGCTGG No data
1035165486_1035165491 6 Left 1035165486 7:156987091-156987113 CCACAGTACAAGTGTGCAGAAGT No data
Right 1035165491 7:156987120-156987142 CCTCCTGCTGGAGCAGGGACAGG No data
1035165486_1035165488 0 Left 1035165486 7:156987091-156987113 CCACAGTACAAGTGTGCAGAAGT No data
Right 1035165488 7:156987114-156987136 CAAGCTCCTCCTGCTGGAGCAGG No data
1035165486_1035165494 14 Left 1035165486 7:156987091-156987113 CCACAGTACAAGTGTGCAGAAGT No data
Right 1035165494 7:156987128-156987150 TGGAGCAGGGACAGGGCAATAGG No data
1035165486_1035165492 7 Left 1035165486 7:156987091-156987113 CCACAGTACAAGTGTGCAGAAGT No data
Right 1035165492 7:156987121-156987143 CTCCTGCTGGAGCAGGGACAGGG No data
1035165486_1035165495 15 Left 1035165486 7:156987091-156987113 CCACAGTACAAGTGTGCAGAAGT No data
Right 1035165495 7:156987129-156987151 GGAGCAGGGACAGGGCAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035165486 Original CRISPR ACTTCTGCACACTTGTACTG TGG (reversed) Intergenic
No off target data available for this crispr