ID: 1035166064

View in Genome Browser
Species Human (GRCh38)
Location 7:156990596-156990618
Sequence CTGTGGACAAGTGCTGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035166062_1035166064 7 Left 1035166062 7:156990566-156990588 CCGGCTAGCTGTCGCGGGCTCTA No data
Right 1035166064 7:156990596-156990618 CTGTGGACAAGTGCTGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035166064 Original CRISPR CTGTGGACAAGTGCTGAGAT AGG Intergenic
No off target data available for this crispr