ID: 1035166078

View in Genome Browser
Species Human (GRCh38)
Location 7:156990679-156990701
Sequence CAGGCGCTGTGACTTGGTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035166078_1035166086 29 Left 1035166078 7:156990679-156990701 CCGCGACCAAGTCACAGCGCCTG No data
Right 1035166086 7:156990731-156990753 ATATTTTCAACTTGGTTAGAGGG No data
1035166078_1035166082 21 Left 1035166078 7:156990679-156990701 CCGCGACCAAGTCACAGCGCCTG No data
Right 1035166082 7:156990723-156990745 TTTCTCCCATATTTTCAACTTGG No data
1035166078_1035166085 28 Left 1035166078 7:156990679-156990701 CCGCGACCAAGTCACAGCGCCTG No data
Right 1035166085 7:156990730-156990752 CATATTTTCAACTTGGTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035166078 Original CRISPR CAGGCGCTGTGACTTGGTCG CGG (reversed) Intergenic
No off target data available for this crispr