ID: 1035167541

View in Genome Browser
Species Human (GRCh38)
Location 7:157000461-157000483
Sequence CGCGTGGGGCGCGGCGGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 385}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035167541_1035167555 16 Left 1035167541 7:157000461-157000483 CCTTCGCCGCCGCGCCCCACGCG 0: 1
1: 0
2: 6
3: 31
4: 385
Right 1035167555 7:157000500-157000522 CGCGCCGCACTCCCCTCCCCCGG No data
1035167541_1035167561 30 Left 1035167541 7:157000461-157000483 CCTTCGCCGCCGCGCCCCACGCG 0: 1
1: 0
2: 6
3: 31
4: 385
Right 1035167561 7:157000514-157000536 CTCCCCCGGACGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 64
1035167541_1035167557 20 Left 1035167541 7:157000461-157000483 CCTTCGCCGCCGCGCCCCACGCG 0: 1
1: 0
2: 6
3: 31
4: 385
Right 1035167557 7:157000504-157000526 CCGCACTCCCCTCCCCCGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035167541 Original CRISPR CGCGTGGGGCGCGGCGGCGA AGG (reversed) Intronic
900101103 1:962469-962491 CGGGTGAGGCGCGGCCGCGGGGG + Exonic
900113755 1:1020124-1020146 CGCGCGGGCCGCGCCGGGGACGG - Exonic
900139162 1:1132275-1132297 CGCAGGGCTCGCGGCGGCGATGG - Intergenic
901050821 1:6425134-6425156 GGCGCGGGCCGCGGCGGGGAGGG - Exonic
901845582 1:11980215-11980237 CGCTTGGGACGCGCCGGCGGAGG + Intronic
902067511 1:13700359-13700381 CCCGAGGAGCGCGGCGGCGACGG + Intronic
902214291 1:14924580-14924602 CGCGCGGGGCGGGGCGGGGCGGG + Intronic
902323686 1:15684649-15684671 CGTGGGGGGCGCGGCGAGGAAGG - Intronic
902600892 1:17539697-17539719 CGCGTCGCGCACGGCGGCGGCGG + Intergenic
903132733 1:21290240-21290262 GGGGCGGGGCGCGGCGGCGGCGG - Intronic
903375757 1:22864877-22864899 AGCCTGGGGCGCGGAGGGGATGG - Exonic
903446161 1:23424178-23424200 AGCCCGGGGAGCGGCGGCGATGG - Intronic
903643502 1:24876342-24876364 GGGGTGGGGCGGGGCGGGGAGGG + Intergenic
903750176 1:25616685-25616707 CGGCTGCGGCGCGGCGGCGGCGG + Intergenic
903907410 1:26696505-26696527 GGCGGGGGGCGAGGCGGCGGCGG + Exonic
904160408 1:28518554-28518576 CGTGAGAGGCGCGGCGGCGGAGG - Intronic
905369279 1:37474627-37474649 GGGGTGAGGCGCGGCGGGGAGGG + Exonic
906416321 1:45623253-45623275 CGCGAGGCGCGTGGCGGAGATGG - Exonic
906637084 1:47416869-47416891 CGCGTAGGGCGCGTAGGGGAAGG - Exonic
906720011 1:47997461-47997483 CGCGGGGGGCGGGGGGGCGAGGG + Intergenic
907278231 1:53328469-53328491 CGCGTGGGGCGGGGGAGGGAGGG + Intergenic
911035511 1:93541586-93541608 GGGGTGGGGCGGGGCGGGGAAGG + Intronic
911527541 1:99004752-99004774 CACCGGGGGCGCGGCGGCGGAGG + Exonic
915214105 1:154328768-154328790 GGCATGGGGGGCGGCGGCGGCGG + Intronic
921023737 1:211259313-211259335 CGCGGGGCGGGCGGCGGCGGAGG + Intronic
1064230863 10:13528724-13528746 GGCGCGGGGCCCGGCGGCGTGGG + Intronic
1065068988 10:22003177-22003199 CGCGCGGGGCCGGGCGGAGAGGG - Intronic
1066080713 10:31928544-31928566 TGCGGGAGGCGCGGCGGCGGCGG - Intronic
1067060701 10:43076770-43076792 CCCGAGGTGCGCGGCGGGGATGG - Intergenic
1067980032 10:51074295-51074317 CGCGGTGGGCGCCGCGGCGCGGG - Exonic
1068544936 10:58334923-58334945 GGGGCGGGGCGCGGCGGGGAGGG + Intergenic
1069837606 10:71319205-71319227 CGCGAGGGGCGGGGCGGGGCCGG + Intergenic
1071695381 10:87863912-87863934 CGGCTGAGGCGCGGCGGCGGCGG + Exonic
1073076795 10:100829404-100829426 CGCGCGGGGCACGCCCGCGAGGG - Exonic
1073085012 10:100882753-100882775 CGCGTGGGGCTCAGCGACGCTGG - Intergenic
1073139541 10:101238307-101238329 CCCCTGGGGCGAGGAGGCGAGGG + Intergenic
1073139688 10:101238949-101238971 CGCGGGGAGCGCGGCGGCCAGGG - Intergenic
1075999787 10:126905574-126905596 GGCGAGAGGCGCGGCGGCGGCGG - Intronic
1076019946 10:127064627-127064649 CGCCTGGGGAGCGGGGGTGACGG - Intronic
1076372494 10:129964387-129964409 CGCGGCGGCGGCGGCGGCGAGGG - Intergenic
1076673787 10:132137314-132137336 TGCGTGGGGAGCGGAGGCGTGGG - Intronic
1076878767 10:133230140-133230162 CGCGCGGGGCGGGGCGGGGATGG + Intergenic
1077048121 11:555136-555158 CGCGCGGGGCGGGGCGGGGACGG + Intronic
1077052945 11:575948-575970 GGCGTGAGGCGGGGCTGCGAGGG + Intergenic
1077065542 11:639571-639593 CGGGCGGGGCGCGGGGGCGCCGG - Intronic
1077361822 11:2144275-2144297 CGAGTGGGGCGCAGTGGCGAGGG - Intronic
1077382303 11:2249884-2249906 GGGGTGGGGCGCGGCGGGGTGGG - Intergenic
1077409124 11:2395342-2395364 CGCCTGGGGCGGGGCGGGGTGGG + Intronic
1077499852 11:2904383-2904405 CGCCTGAGGCACGGCGGGGAGGG - Intronic
1077575338 11:3378886-3378908 CGCGCGGGGCCCGGCCGCCATGG + Intronic
1077867427 11:6234666-6234688 CGTGTGGTGCGCGGGGGCGCGGG - Exonic
1078316054 11:10294111-10294133 CGGGTGGGCGGCGGCGGCGAGGG - Exonic
1078594624 11:12675104-12675126 CGCGGGGGGCGCGGCGCGGCCGG - Intronic
1083171091 11:60924493-60924515 CGCGGGGCGGGCGGCGGCGGCGG + Exonic
1083644748 11:64165787-64165809 GGCGTGGGGGGCGGCGGCGGTGG - Exonic
1083659754 11:64246634-64246656 CGCGGGGGGCGCGGCGTTGGCGG - Exonic
1083945034 11:65918979-65919001 GGGGTGGGGCGCGGTGGCGGTGG - Exonic
1084146156 11:67266438-67266460 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1084295912 11:68213390-68213412 CGCGGGGGGCGCGACGGCGGCGG - Exonic
1084319157 11:68363952-68363974 CGGCTGGGGCGCGGGGGCGAGGG + Intronic
1084393404 11:68892683-68892705 CGCGTGGAGCGTGGAGGAGAAGG + Intronic
1085197942 11:74683557-74683579 CGCCTGGGCCGCGGGGGCGGCGG - Intergenic
1085485666 11:76860950-76860972 CGCCTGGGCGGCGGCGGCGGCGG + Exonic
1089346944 11:117796889-117796911 CGGGTGGGGCGCAGCGGGGAGGG - Intronic
1090635008 11:128685617-128685639 CGCCTGGGCGGAGGCGGCGAAGG + Intergenic
1091616082 12:2052564-2052586 CGCGGGGGGCGCGACGCCGCCGG + Intronic
1091718418 12:2795544-2795566 CGCGCGCGGGGCGGCGGAGAGGG + Intronic
1091807353 12:3366001-3366023 CGCGTGGGGTGGGGCGCCGGGGG - Intergenic
1092081950 12:5723617-5723639 CGGGTGGGGGGCGGGGGCGCGGG + Intronic
1093465146 12:19440518-19440540 CGAGAGGGGCGCGGCGGCGACGG - Intronic
1095432022 12:42144671-42144693 CGGGGCGGGCGCGGCGGCGGCGG - Exonic
1096159869 12:49367447-49367469 GGGGAGGAGCGCGGCGGCGACGG + Exonic
1096622658 12:52874243-52874265 CCCGCGGGGCGCGGCGGGGCGGG + Intergenic
1096647593 12:53047190-53047212 GGCGCGGGGCGCGGCGGGGGCGG + Intronic
1097246898 12:57611820-57611842 CACGGGGGGCGGGGCGGGGACGG - Intronic
1099826640 12:87784414-87784436 CGAGGGGGCCGCGGCAGCGATGG - Intergenic
1100315553 12:93441708-93441730 GGGGTTGGCCGCGGCGGCGAGGG - Intronic
1100391449 12:94148927-94148949 GGCAGGGCGCGCGGCGGCGACGG - Exonic
1100490458 12:95073326-95073348 CGCGTCGGGGGCGGGGGCCAGGG - Intronic
1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG + Exonic
1103764668 12:123271660-123271682 CGCGAGGGCGGCGGCGGCGGCGG + Exonic
1103800349 12:123533715-123533737 CGAGTGGGCGGCGGCGGCGGCGG + Exonic
1106187859 13:27424822-27424844 AGCGCGGGGCGCGGCGGGGTCGG - Exonic
1107851497 13:44576825-44576847 CGGCCGGGGCGCGGCGGCGGCGG + Intronic
1108046262 13:46387289-46387311 GGCGGGGGGCGTGGCGGCGTCGG - Exonic
1108676104 13:52739229-52739251 CGCGTGGGGCCCGGGTGCGCTGG - Intronic
1111951678 13:94713141-94713163 CGAGAGGGGCGCCGCGGCGCAGG - Intergenic
1112170478 13:96967551-96967573 GGGGTGGGGCGTGGCGGCGGGGG - Intergenic
1113378817 13:109785571-109785593 CGCGGCGGGCGCGGCGGCGGGGG + Exonic
1113737582 13:112689769-112689791 GGCGCTGGGCGCGGCGGGGAAGG - Intergenic
1114088845 14:19267166-19267188 AGCGTGAAGCCCGGCGGCGAGGG - Intergenic
1114463034 14:22900337-22900359 CTAGTGGGGCGGGGCGGGGAGGG - Intergenic
1115610656 14:35046229-35046251 CGCGCGGGGCGGGGCGGGGCGGG - Intronic
1115851782 14:37595133-37595155 CGCGGCGTGCGCGGCGGCGGCGG + Intronic
1117157028 14:52951248-52951270 CGGGCGGGGCGGGGCGGCGTGGG + Intronic
1117157035 14:52951263-52951285 GGCGTGGGGCGGGGCGGCGCGGG + Intronic
1119622125 14:76138967-76138989 CGCGGGGGGCGGCGCGGCGCCGG + Intergenic
1120780152 14:88479541-88479563 CGCGTGGCGCGCGGCGGTGAGGG + Exonic
1122066034 14:99175080-99175102 CGCGGGGGGCGGCGCGGCCAAGG - Exonic
1122162371 14:99793581-99793603 CTGGTGGCGGGCGGCGGCGACGG + Intronic
1122221235 14:100240060-100240082 CGGCGGGGGCGCGGCGGCGGCGG + Intronic
1122582003 14:102777182-102777204 CGCGGGGCGCGCGGCGGGGACGG + Intergenic
1122779155 14:104136364-104136386 GGTGCGGGGCGCGGCGGCGGCGG + Intergenic
1122978569 14:105181101-105181123 CGCGGGGGACGCGGGGGCGCGGG + Intronic
1122978631 14:105181329-105181351 CGCGCGGGGCGGGGCGGCCGAGG + Intergenic
1122982157 14:105196780-105196802 CGCGCCGGGCGCCGCGGGGAGGG - Intergenic
1124340472 15:28886555-28886577 CGCGGGGGGCACCGCGGCAAGGG + Intronic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1124469190 15:29968499-29968521 CGCGCGGGGCGCAGCAGCCAAGG - Intronic
1126113287 15:45187758-45187780 CGCGGGGGGGGCGGCGGCGGAGG - Intronic
1126113384 15:45187987-45188009 CGGGTGGGGGGCGGGGGCGGGGG + Intronic
1126736618 15:51737534-51737556 CGCGAGCGCGGCGGCGGCGAGGG + Exonic
1126767001 15:52019434-52019456 CGCGGCGGGCCCGGCGGCGGCGG + Intronic
1126823677 15:52528940-52528962 CGCGCGGGGCGGGGCGGGGCGGG + Exonic
1127982718 15:64046373-64046395 CGCGGCGGGCGCGGCGGGAACGG + Intronic
1128067850 15:64775583-64775605 CGAGTGCGCCGCGGCGGCGGCGG + Exonic
1128635274 15:69298866-69298888 CGCGCGGGGCGGGGCGGCCCCGG - Intergenic
1129150532 15:73684942-73684964 CGGGAGGGGAGCGGCGGGGAGGG + Intronic
1130076691 15:80695620-80695642 CGGCTGGGCCGCGGCGGCGGCGG - Exonic
1132519898 16:382104-382126 CACGTGGGGCGCGCGGGGGACGG + Intronic
1132580085 16:680698-680720 CGCGGGGAGGGCGGCGGCGGTGG + Intronic
1132741333 16:1414759-1414781 CGCGGGGGGCGTGGCCGCGGGGG - Intergenic
1132885097 16:2179027-2179049 GGCGGGGGGCGCGGCGGCGGCGG + Exonic
1132968541 16:2673417-2673439 CGCGGGGGGCGGGGCGTCGCGGG - Intergenic
1133052367 16:3124408-3124430 GGCTTGGGGCGTGGCGGTGAGGG - Intergenic
1134149832 16:11797057-11797079 CGCGGGGGGGGCGGGGGCGCGGG + Intronic
1134419388 16:14071536-14071558 CGCGCGGGGCGGGGCGGCCGGGG + Intronic
1135787034 16:25359362-25359384 GGGGTGGGGGGCGGCGGGGAGGG + Intergenic
1136345714 16:29674431-29674453 TGCGTGGGGTGGGGCAGCGAGGG - Intronic
1136365435 16:29807108-29807130 GGCCGGGGGCGCGGCAGCGACGG - Exonic
1136365677 16:29808040-29808062 CGCGTGGGAGGAGGCGGCGGCGG + Intronic
1136382062 16:29900400-29900422 CACGTGGGGCGCAGGGGCCACGG - Intronic
1137787733 16:51151818-51151840 GGGGTGGGGCCGGGCGGCGAGGG + Intergenic
1138105880 16:54286942-54286964 CGCGCGGGGCGGGGCGGGGCAGG + Intergenic
1139364966 16:66427438-66427460 GGCGTGGGGCTGGGCGGCGCGGG + Intronic
1139548515 16:67660942-67660964 CGCCAGGGGCGGGGCGGCGCGGG + Exonic
1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG + Exonic
1139664511 16:68447087-68447109 GGCGGGGGGCGCGGCCGCGGAGG - Intronic
1140504813 16:75464572-75464594 CGCGAGGGGAGCGGCGGCAGCGG - Exonic
1140685956 16:77434531-77434553 CGTGAGGGGCGCGGCGGGGCTGG + Intronic
1141538556 16:84700264-84700286 CGCGGCGGGCGCGGAGGCGGCGG - Intronic
1141608644 16:85169438-85169460 CAAGTTGGGCGCGGCGGCGGCGG + Intergenic
1141840026 16:86568246-86568268 GGCGGGCGGCGCGGCGGCGTAGG - Exonic
1142395278 16:89828384-89828406 CGCGGGGGGCGGGGCGCGGAGGG - Intronic
1142509422 17:385033-385055 CGGGCGGGGCGGGGCGGGGACGG + Intronic
1142623754 17:1179987-1180009 CGCGGGGGGCGGGGCGGGGGTGG + Intronic
1144724961 17:17497063-17497085 CGGGTGGGGAGCGGCAGGGATGG + Intergenic
1144816500 17:18039184-18039206 CAGGAGGCGCGCGGCGGCGACGG - Intronic
1144953030 17:19004215-19004237 CGCGCGGGGAGGGGCGGCGGGGG + Intronic
1145031315 17:19507359-19507381 CGCGGGGGACGCGGGGGCGCGGG - Intronic
1145065708 17:19760015-19760037 GGCGTGGGGCGGGGCAGCCAAGG - Intergenic
1145077502 17:19867812-19867834 CGCTCGGGGCGCTGCTGCGACGG + Exonic
1145214708 17:21042855-21042877 CGCGCGGGGGGCGGCGGCGAGGG + Exonic
1145765630 17:27456655-27456677 AGCGCTGCGCGCGGCGGCGATGG + Intergenic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1147184268 17:38705229-38705251 CGGGTGGCGCGGGGCGGCGCGGG + Intergenic
1147250849 17:39151701-39151723 GGCGGGGGGCGCGGCGTCGTTGG + Intronic
1147989606 17:44324728-44324750 CTCGTGCGGCGCGGCGCCCAGGG + Exonic
1147994706 17:44354406-44354428 GGCGGCGGGGGCGGCGGCGAGGG - Exonic
1149685453 17:58532084-58532106 CGGGAGGGGCCCGGCGGCGGGGG + Intronic
1151452084 17:74203997-74204019 CTCGTGGGGCCCCGGGGCGAGGG + Intronic
1151657430 17:75502450-75502472 CGCTTGGGGGGCGGGGGCGGGGG + Exonic
1151703144 17:75753879-75753901 CCCGTGGGGCGCCTCGGCGTCGG - Exonic
1152625662 17:81386947-81386969 GGGGCGGGGCGCGGCGGCGAGGG + Intergenic
1153238924 18:3013381-3013403 CGCCTGGCGCTCGGCGGCGGGGG - Intergenic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1155392729 18:25352326-25352348 CGCGTGGGAGGCGGCGGCGGCGG - Intergenic
1156275828 18:35581838-35581860 CGCTAGGCGCGCGGCGGCGGCGG - Intronic
1156350431 18:36297659-36297681 CGCGGGGGGCGGGGCGGGGGCGG - Intergenic
1157353989 18:46917117-46917139 CGCGGGCGGCGCGGGGGCGGCGG - Intronic
1157706799 18:49813960-49813982 TGGGCGGGGCGCGGCGGCGGCGG + Exonic
1157752872 18:50194474-50194496 AGTGAGGGGCGCGGCGGGGAGGG + Intronic
1158457622 18:57621946-57621968 CGCGTGGGGCGGGGCGTCTCTGG - Exonic
1160453446 18:78980162-78980184 CGCGGGGCGCGGGGCGGCGGCGG - Intergenic
1160738808 19:676601-676623 GTCGGGGGGCGCGGCGGCGGCGG + Intronic
1160887053 19:1354975-1354997 CCCGCGGGGAGCGGCGGCGGCGG + Intronic
1160895820 19:1401401-1401423 CGCGTGGGGGGCGGCGCCCGCGG - Exonic
1161027207 19:2042215-2042237 CGGGTGGGGCGGGGCCGCGGCGG - Intronic
1161266414 19:3366691-3366713 TGCGGGGGGCGCGGGGGCGCCGG - Intronic
1161347368 19:3775026-3775048 GGCGTGAGGCGCGGCGGGGGGGG + Intergenic
1162027705 19:7903911-7903933 CGGGCGGTGCGCGGCGGCGGTGG + Exonic
1162079028 19:8208213-8208235 CGCGGGGGGCGGGGCGGTCAGGG - Intronic
1162128245 19:8510882-8510904 CGCGGGGGCCGCGGGGGCGCCGG + Exonic
1162562326 19:11423837-11423859 GGGGGGGGGCGCGGCGGAGAGGG + Intronic
1162751762 19:12833860-12833882 CGCGGGGACCGCGGCGGCGGCGG - Intronic
1162932169 19:13962670-13962692 CGGGTGGGGCGGGGAGGCCAAGG + Exonic
1163478306 19:17539742-17539764 CGCGTGTGGCGGGGCGGCTGAGG + Exonic
1163681167 19:18683525-18683547 GGCGCGCGGCGCGGGGGCGAAGG - Intergenic
1163729558 19:18941231-18941253 CGCGTCGGGACCGGCCGCGATGG - Intronic
1164250565 19:23471251-23471273 CGGGCGGGGGGCGTCGGCGACGG - Intergenic
1164594976 19:29526557-29526579 CGCGGGGGGCGCGGTGGCGGCGG - Exonic
1164639012 19:29811657-29811679 AGTCTGGCGCGCGGCGGCGAGGG - Intergenic
1164979534 19:32603457-32603479 TGCGTGGAGAGCGGCGGGGAAGG - Intronic
1165160209 19:33811572-33811594 CGCCGGGGGTGCGGCGGGGAGGG - Intronic
1165696917 19:37907466-37907488 GCCGTGGGGGGCGGCGGCGCCGG + Intronic
1166117219 19:40663345-40663367 CGCGAGGGGCGGGGCTGCAACGG + Intergenic
1166139587 19:40799077-40799099 CGCGCGGGGCGGGGCGGAGCGGG - Intronic
1166702732 19:44891503-44891525 AGCGTGAAGCCCGGCGGCGAGGG - Exonic
1166790716 19:45396883-45396905 AGCGGGGTGCGCGGCGACGACGG + Exonic
1166852761 19:45768371-45768393 GGCGTGGTGGGCGGCGGGGAAGG + Exonic
1166853411 19:45770925-45770947 AGCGCGGGGCGCGACGGCGGAGG + Intronic
1166888256 19:45973956-45973978 GGCGCGGGCGGCGGCGGCGACGG + Intergenic
1167258291 19:48443654-48443676 GTGGTGGGGCGCGGCGGCGGCGG - Exonic
1167437456 19:49487655-49487677 CGCGCGGGCCGGGGCGGCAAGGG + Intronic
1167454712 19:49592074-49592096 TGCCTGGGGCGCGGGGGGGAGGG - Intronic
1167643681 19:50695036-50695058 GGCTGGGGCCGCGGCGGCGATGG - Intronic
928511793 2:32010133-32010155 GGCGTGGGGCCAGGCGGCGACGG + Intronic
929218119 2:39437128-39437150 CGTGAGGGGAGCGGCGGCGGCGG - Exonic
930011422 2:46941035-46941057 CGCGGCGGGGGCGGCGGCGGGGG + Intronic
930632352 2:53767774-53767796 CGCGCGGGGCGCAGGCGCGATGG - Exonic
930700923 2:54456986-54457008 CGGGTGGGGAGCGGGGGCGGCGG + Intronic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
933684919 2:85134458-85134480 CCCGTCGGGCGCGCCGGGGAGGG + Intronic
934567042 2:95346837-95346859 CCCGTGGAGGGCGGCGGCGGCGG - Intronic
934746149 2:96760962-96760984 GGCGCGGGGAGCGGCGGCGGCGG + Exonic
935592498 2:104855411-104855433 GGCGGGGGGCGCGGCGGCGGCGG + Intergenic
935592700 2:104856109-104856131 CGGGAGGTGCGCGGCGGCGGCGG - Exonic
936126711 2:109794606-109794628 GGCGGGGGGGGCGGCGGCGGCGG + Intronic
937093913 2:119223792-119223814 CGGGTGGGGCGCGGGGGAGGAGG + Intergenic
938014750 2:127858097-127858119 CGCGCGGCGCGGCGCGGCGATGG - Exonic
938487346 2:131724170-131724192 AGCGTGAAGCCCGGCGGCGAGGG + Intronic
941905898 2:170716110-170716132 TGCGTGGGGTGCGGTGGCGGGGG + Intronic
942890487 2:180980997-180981019 CGCGTGGGGGGCGGCCGGGGCGG + Intronic
943624221 2:190180789-190180811 CGCGGCGGGCGCGGCGGCGACGG + Intronic
943669861 2:190649078-190649100 CGCGCGGGCGGCGGCGGCGGCGG - Intronic
943811607 2:192195114-192195136 CGAGTGGGGCTAGGCGGGGATGG + Exonic
944579062 2:201116578-201116600 GACGCGGGGCGCGGCGGCGCAGG - Intronic
948728244 2:239947600-239947622 GGCCTGGGGCTCGGCGGGGAGGG - Intronic
948874389 2:240819328-240819350 CAGGTGTGGCCCGGCGGCGAGGG - Intronic
948893096 2:240916476-240916498 CGCAGGGGGCGCGGGGGCGCGGG - Intergenic
948988710 2:241541250-241541272 CGTGTGGGGCGGGGCCGCGGCGG + Intergenic
1168804423 20:664150-664172 CGCGGGGCGCGCGGGGGCGCAGG - Exonic
1169132586 20:3173694-3173716 CGGGCGGGGCGCAGCGACGAAGG - Intergenic
1170999357 20:21397153-21397175 CGCGGCGGCCGCGGCGGCGGCGG - Exonic
1172109416 20:32536530-32536552 CGCGTGCGCCCCGGCGGGGAGGG + Intronic
1172277281 20:33686505-33686527 CGCGCCGGACCCGGCGGCGAGGG + Intergenic
1172474529 20:35226885-35226907 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1173672871 20:44810290-44810312 CGCCTCGGCCGCGGCGGCGGCGG + Intronic
1174607005 20:51768387-51768409 CGCGGGGGGCGCGGCGGCCAAGG - Exonic
1174607107 20:51768700-51768722 CGCGTGGGGGGCGCGGGCGCGGG - Intergenic
1175859718 20:62143687-62143709 CGCGGGGGGCGCCGCGTCGTGGG - Intergenic
1176549391 21:8214723-8214745 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1176557284 21:8258946-8258968 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1176568319 21:8397757-8397779 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1176576226 21:8441981-8442003 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1178544123 21:33479464-33479486 CGCGGCGGGCACGGAGGCGACGG - Intronic
1178707649 21:34888856-34888878 AGCGCGCGGCGCGGCGGCGGGGG - Intronic
1179675070 21:42975202-42975224 TGCGGGGCGCGCGGCGGCGCAGG + Intronic
1179882664 21:44300029-44300051 CGCGCGGGGCGGGGCGGGGACGG + Exonic
1180491863 22:15855170-15855192 AGCGTGAAGCCCGGCGGCGAGGG + Intergenic
1180649979 22:17369591-17369613 CGGGCGGGGGGCGGCGGCGCGGG - Exonic
1180866532 22:19122766-19122788 GGCATGGGGCGGGGCGCCGAGGG + Intergenic
1182576521 22:31276707-31276729 CGCGGGGGGCGCGGCGTTGGCGG + Intronic
1183524935 22:38317296-38317318 CGAGCGGAGCGCGGCGGCGGCGG - Exonic
1184046759 22:41976873-41976895 CGGGGAGGGCGCGGCGGCGCGGG + Exonic
1184472133 22:44702139-44702161 CCCGGGGGGCGGGGCGGGGAAGG - Intronic
1184521307 22:44995869-44995891 CGTCTGGGGCCCGGCGGAGATGG - Intronic
1184848100 22:47101514-47101536 CCTGTGGGGCGAGGCGGCCAAGG + Intronic
1185296720 22:50058322-50058344 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1185368314 22:50446979-50447001 CGGGCGGGGCGGGGCGGGGACGG + Exonic
1185395009 22:50582433-50582455 CGCCTGGGGCGGGGCGGGGCCGG - Intronic
1203254276 22_KI270733v1_random:131039-131061 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1203262332 22_KI270733v1_random:176118-176140 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
950729786 3:14947607-14947629 CGCGCGGGCGGCGGCGGCGGCGG + Intronic
951543643 3:23806150-23806172 CGAGTCGGGGGAGGCGGCGAGGG - Intronic
951881404 3:27484201-27484223 CGCCGGGGGCTCGGCGGCGGCGG - Intronic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
954256577 3:49411716-49411738 CCGGTGGGGCGCGGCCGCGGCGG + Intronic
954812378 3:53256055-53256077 CGGGCGGGGCGGGGCGGGGATGG + Intergenic
956675046 3:71725335-71725357 GGCGGGGGGCGCGGCGGCCGGGG + Exonic
956675072 3:71725440-71725462 CGCGCGGGGCGGGGCGGGGCGGG - Intronic
959560056 3:107768996-107769018 CGGGTGGGGGGCGGCGGGGGGGG + Intronic
961352149 3:126310965-126310987 AGAGTGGGCCGCGGTGGCGATGG - Intergenic
961650743 3:128415631-128415653 AGCATGGGCCCCGGCGGCGAGGG - Intergenic
961780169 3:129316428-129316450 CGCTGCGGGCGCGGCGGCGCTGG - Intergenic
962318578 3:134373710-134373732 CGCCTGGGGCGAGCCGGTGAGGG + Intronic
962919135 3:139935420-139935442 GGCGTGGGGAGCGGCAGCGGCGG + Exonic
964129281 3:153268952-153268974 CGGGTGGGGGGGGGCGGCAAGGG - Intergenic
964252723 3:154737744-154737766 GGGGTGGGGGGCGGCGGCGGGGG + Intergenic
965558137 3:170038078-170038100 CGCGCGGGGCGGGGCGGGGCGGG + Exonic
966182196 3:177197554-177197576 CGCGAGGCCCGCGGCGGCGGCGG + Intergenic
966712033 3:182980728-182980750 GGCGGGGGGCGCGGCGGGGGAGG + Intronic
966860980 3:184230676-184230698 CGGGTGGGGCGCGGGCGCGGCGG + Intronic
967055414 3:185825371-185825393 GGCGAGGGGCGCAGCGGCGCGGG - Intergenic
967924186 3:194633381-194633403 GGCGCGGGCGGCGGCGGCGAAGG + Exonic
968515009 4:1012108-1012130 CACGTGGGGCGCGGGGGCGGGGG - Intronic
968518434 4:1024439-1024461 CGCGTGGAGTACGGCGCCGAGGG + Exonic
968803237 4:2756420-2756442 CGCGGGGGGCGGGGCTGCGTGGG - Intergenic
968879686 4:3292755-3292777 CGTTGGGGGCGCGGCGGCGCTGG - Intergenic
969436633 4:7192719-7192741 CGCGGCGAGCGCGGCGGCGGCGG - Exonic
969645821 4:8428268-8428290 CGCCAGGGGCGCGGACGCGACGG - Intronic
976184102 4:82428972-82428994 CGCGTGGGACCCGGGGGGGAGGG - Intronic
977689912 4:99894541-99894563 CGCGTGCGGGGCGGGGGGGAGGG - Intergenic
978072625 4:104491557-104491579 CGCGGCGGCCGCGGCGGCGGCGG + Exonic
979349615 4:119628832-119628854 CGCGCGGGGCGGGGCGGGGCAGG - Exonic
982042404 4:151409126-151409148 CGCGGGGGGGGCGGGGGCGGGGG - Intergenic
982468660 4:155760050-155760072 CGGCTGGGGCGGGGCTGCGAGGG + Intronic
983238685 4:165207631-165207653 CGAGTGCGGGGCGGCGGCGACGG - Intronic
983941620 4:173538842-173538864 CGCGCGGGGGGAGGCGGCGGAGG + Intergenic
985542970 5:495387-495409 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985542981 5:495422-495444 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985542992 5:495457-495479 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543003 5:495492-495514 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543014 5:495527-495549 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543025 5:495562-495584 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543036 5:495597-495619 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543047 5:495632-495654 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543058 5:495667-495689 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543069 5:495702-495724 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543080 5:495737-495759 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543091 5:495772-495794 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543102 5:495807-495829 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543113 5:495842-495864 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543124 5:495877-495899 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543135 5:495912-495934 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543146 5:495947-495969 AGCGTGGGGAGGGTCGGCGATGG - Intronic
986330518 5:6713649-6713671 CGCGGGGGCCGCGGCGGCGGCGG - Intergenic
986330663 5:6714068-6714090 GGCGTGGGCCGCGGCGGCTCGGG + Intergenic
987132347 5:14871570-14871592 GGCCTCGGGCGCGGCGGCGGCGG + Exonic
987132485 5:14872059-14872081 CGCTGAGGGCGCGGCGGGGACGG + Intergenic
990955053 5:61332413-61332435 GGCGGGTGGCGCGGCGGCGGCGG + Exonic
992939652 5:81750491-81750513 CGCGGGGAGCGCGGCGGCGGGGG - Intronic
994367135 5:98928940-98928962 CGCGCGGGAGGCGGAGGCGACGG - Exonic
997282255 5:132656484-132656506 CGCGGCGGTTGCGGCGGCGATGG - Intronic
997584091 5:135034441-135034463 CGCGGGGGGCGGGGAGGCGGCGG - Intronic
997899727 5:137753854-137753876 GGCATGGGGCGAGGCGGCCATGG + Exonic
998836094 5:146203900-146203922 GGCGTGGGGGGCGGCGCTGAGGG + Intronic
1000345844 5:160312627-160312649 CCCGCGGGGCGCGGGGGCGCCGG - Intronic
1002029274 5:176416182-176416204 CTCGTGGGGCCCGGCTGCGCGGG + Exonic
1002401697 5:178994779-178994801 CGCGCGGGGCGCGGCGGGCCGGG - Exonic
1002532822 5:179858848-179858870 TGCGTGGGGCGGGGCCGCGGCGG - Exonic
1002621971 5:180494453-180494475 GGCGTCGGTGGCGGCGGCGACGG + Exonic
1002691464 5:181053324-181053346 CGCGGGCGGCGGGGCGGGGAGGG + Intronic
1003290681 6:4776288-4776310 CGGGAGGGGCGGGGCGGCGGCGG - Intronic
1004690339 6:17987674-17987696 GGGGCGGGGCGCGGCGGCGGCGG + Intergenic
1004864219 6:19837640-19837662 CGCGCCGGGCGCGGAGGCAAAGG + Exonic
1006177310 6:32130186-32130208 CGCGTGGGGCAAGGCTCCGAGGG - Exonic
1006477155 6:34263688-34263710 AGCGGGCGGCGCGGCGGCGTCGG - Intergenic
1010414868 6:75601805-75601827 CGCGCTGGGGGCGGCGGCGTCGG + Intronic
1012400022 6:98835120-98835142 GGCGGCGGGGGCGGCGGCGACGG + Exonic
1012887262 6:104859880-104859902 CGGGAGGGACGCGGCGGCGGGGG - Exonic
1013793685 6:113860425-113860447 CGCGCCGGGCCCGGCGGCGGAGG - Exonic
1014272315 6:119348989-119349011 GGCGGGGGGCTCGGCGGCGGCGG - Exonic
1015315060 6:131808060-131808082 GGCGGGAGCCGCGGCGGCGAGGG + Exonic
1015965590 6:138693083-138693105 GGCGGCGGCCGCGGCGGCGAGGG + Intergenic
1017671824 6:156777171-156777193 CGCTCGGAGCGCGGCGGCGTGGG - Intergenic
1017672008 6:156777809-156777831 GGCGCGCGGCGCGGCGGCGGCGG + Intergenic
1019111962 6:169724080-169724102 CGCGGGGCGCGCGGCGGCAGGGG - Intronic
1019111980 6:169724132-169724154 CGCGGGCGGCGCGCTGGCGACGG - Intronic
1019381647 7:727253-727275 CTCGCGGCGCACGGCGGCGAAGG - Exonic
1019486066 7:1289754-1289776 CTCGAGGGGGGCGGCGGGGACGG + Intergenic
1020125538 7:5530864-5530886 AGCGTGGGGCGCGGGGGCCACGG - Intronic
1020210564 7:6154904-6154926 GGCGTGGGGCGCGCCTGCGCGGG - Exonic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1022207707 7:28180102-28180124 CGCGCGGGGCGCGGGGCGGAGGG - Intronic
1023861532 7:44220120-44220142 CGCGTGTGGCACCGCCGCGACGG - Exonic
1023881936 7:44325665-44325687 CGGGGCGGGCGCGGCGGCGGCGG - Intronic
1023955766 7:44885488-44885510 GGGGCGGGGCGCGGAGGCGATGG - Intergenic
1025106559 7:56175502-56175524 CGGGAGGAGCGCGGCGGCGCGGG + Intergenic
1025916885 7:65873228-65873250 CCAATGGGGCGCGGCGGCGGCGG + Intergenic
1027177789 7:75915501-75915523 CCCGTGGGGGGCGGCGGCGCGGG - Intronic
1028160106 7:87475725-87475747 CGCGTGGGGGGCGGGGGCGGGGG - Exonic
1028417473 7:90595958-90595980 CGGGAGGGGCGCGGCCGGGAGGG + Intronic
1029123191 7:98281722-98281744 GGCGGGGGACGCGGCGGCGGCGG - Exonic
1029123242 7:98281890-98281912 CGGCGGGGGCGCGGCGGGGATGG - Exonic
1030739062 7:113086560-113086582 CGCAGGGGCCGCGGCGGCGGCGG + Intronic
1031051881 7:116953438-116953460 CGCCCGGGCCGCGGCGGCGGCGG + Exonic
1032215280 7:129952690-129952712 CGTGCGGGGGGCGGCGGCGGCGG - Exonic
1034447864 7:151122614-151122636 CGCCTGGGGAGCGGCGGCAGCGG - Intronic
1034977614 7:155457612-155457634 CGCGGAGGCCGAGGCGGCGAGGG + Intergenic
1035167541 7:157000461-157000483 CGCGTGGGGCGCGGCGGCGAAGG - Intronic
1035553014 8:544653-544675 CGCCTGGGCGGCGGCGGCGGCGG + Exonic
1036811100 8:11868120-11868142 CACGTGGGGCGGGGCCGGGAGGG - Exonic
1037273834 8:17156864-17156886 CGCTGGGGGCGCCGCGGCGGGGG - Intronic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1039527761 8:38231754-38231776 CGGGCGGGGCGCGGCGGAGCAGG - Exonic
1039595452 8:38787124-38787146 CGCGGGGGCGGCGGCGGCGCCGG - Intronic
1041690374 8:60680362-60680384 CGGGGCGGGCGCGGCGGCGCGGG + Intronic
1045305041 8:100951369-100951391 CGCGCTGGGCGCTGCGGCGGCGG - Intronic
1047203173 8:122782723-122782745 CGCGCGGGGCGGGGGGCCGAGGG + Intronic
1047381876 8:124372074-124372096 CGGGCGGGGCGCGGCGGCGGCGG + Exonic
1048981172 8:139703920-139703942 GGCGGCGGGCGCGGCGGCGGCGG + Intergenic
1049452501 8:142669789-142669811 CGCGCGGGGCGGGGCGGGGTTGG - Intronic
1049532234 8:143160332-143160354 CGCGAGGGGCGGGGCGGAGCCGG + Intronic
1049616472 8:143577780-143577802 AGCGGGCGGCGCGGCGGCCACGG - Intronic
1049659997 8:143815608-143815630 AGCGCGGGGAGCGGCGGCGGCGG + Intergenic
1049684594 8:143934229-143934251 CGCCGGGGGCGGGGCGGGGAGGG + Intronic
1049697306 8:143990509-143990531 GGCGTGGGGCGAGGCGGGTAGGG - Intronic
1050437855 9:5628974-5628996 CGCGTGGGTCGGGCCGGGGAGGG - Intergenic
1050552224 9:6758279-6758301 CGCGTGGGGCACGGGGGTGCGGG + Intronic
1051711449 9:19934790-19934812 CGAGCGGGGCGTGGCGGGGAGGG + Intergenic
1052888824 9:33676951-33676973 CACGGGGGGTGCGGCGGCGGCGG + Intergenic
1052888893 9:33677196-33677218 CGGCTGAGGCGCGGCGGCGGCGG - Intergenic
1053697401 9:40650740-40650762 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054308706 9:63450186-63450208 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054407370 9:64773879-64773901 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1055090814 9:72364238-72364260 CGCGTGGGGCCTGCAGGCGAAGG - Intronic
1056710981 9:88991634-88991656 CGGGTGGCGCGCGGCGGTGCCGG - Exonic
1056992356 9:91423742-91423764 CGGGAGGCGGGCGGCGGCGAGGG + Exonic
1057259804 9:93577093-93577115 CGCTTTGTGCGCGGCGGCCAGGG - Intronic
1057995631 9:99820038-99820060 CGCGCGGGGCGGGGCGGGGCGGG - Intergenic
1057995727 9:99820531-99820553 GGCGGGGGGCGCTGCGCCGAGGG - Intergenic
1060897312 9:127225796-127225818 CGCGAGGGGCGCGGGGGCCGCGG - Intronic
1061317157 9:129803444-129803466 TGCGGGGGGCGCGGGGGCGCGGG + Intronic
1061328123 9:129876240-129876262 TGCGTGCGGCGAGGCGGCGCGGG + Intronic
1061438148 9:130579644-130579666 GGCGTCGGCGGCGGCGGCGACGG + Exonic
1061453503 9:130681629-130681651 CAGGTGGTGCGCGGCGGCGGCGG - Exonic
1062462019 9:136666074-136666096 GGCGGGCGGCGCGGCGGGGAGGG + Intronic
1062596610 9:137302515-137302537 CGCGCGGACGGCGGCGGCGACGG - Intergenic
1203470677 Un_GL000220v1:114183-114205 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1203478498 Un_GL000220v1:158155-158177 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1185505467 X:630131-630153 CGCTTGGGAGGCGGCGGCGGCGG - Intronic
1185747607 X:2584615-2584637 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1186123122 X:6384307-6384329 GGGGTGGGGGGCGGGGGCGAGGG + Intergenic
1186768058 X:12791458-12791480 CGAGGGGCGCGCGGCGGCGGAGG - Exonic
1187332647 X:18354717-18354739 CGCGGGGGGCGGGGCGGCAGTGG - Exonic
1190285225 X:48957204-48957226 CGCGCTGGGCGCAGCGGCGGCGG - Exonic
1190324889 X:49200225-49200247 GGCGCGGGGCGCGGCGGGGGCGG + Exonic
1197754310 X:129983713-129983735 CGGGCCGGGCGCGGCGGGGAGGG + Intronic
1198683348 X:139204317-139204339 CGCGGCGGCGGCGGCGGCGACGG - Intronic
1200084890 X:153599196-153599218 GGGGCGGGGCGGGGCGGCGAGGG - Intronic
1200084900 X:153599216-153599238 GGGGCGGGGCGGGGCGGCGAGGG - Intronic
1200229441 X:154436848-154436870 CGCGCGGGGCGGGGCGGGGCGGG + Intergenic