ID: 1035167574

View in Genome Browser
Species Human (GRCh38)
Location 7:157000542-157000564
Sequence GAGTGCGCCCCAGGCTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 108}

Found 22 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035167574_1035167601 28 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167601 7:157000593-157000615 GGCGGGGTGGGGGAGGGAAGGGG 0: 1
1: 5
2: 56
3: 654
4: 4836
1035167574_1035167596 18 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167596 7:157000583-157000605 CGGGGGCGGGGGCGGGGTGGGGG No data
1035167574_1035167587 7 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167587 7:157000572-157000594 CCCTCCGCTGGCGGGGGCGGGGG No data
1035167574_1035167594 16 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167594 7:157000581-157000603 GGCGGGGGCGGGGGCGGGGTGGG 0: 5
1: 124
2: 287
3: 1361
4: 8545
1035167574_1035167597 21 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167597 7:157000586-157000608 GGGCGGGGGCGGGGTGGGGGAGG 0: 5
1: 43
2: 335
3: 2470
4: 10389
1035167574_1035167580 -1 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167580 7:157000564-157000586 CAGCGCTGCCCTCCGCTGGCGGG 0: 1
1: 0
2: 4
3: 16
4: 242
1035167574_1035167584 5 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167584 7:157000570-157000592 TGCCCTCCGCTGGCGGGGGCGGG 0: 1
1: 0
2: 1
3: 20
4: 227
1035167574_1035167600 27 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167600 7:157000592-157000614 GGGCGGGGTGGGGGAGGGAAGGG 0: 1
1: 4
2: 61
3: 842
4: 5766
1035167574_1035167578 -5 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167578 7:157000560-157000582 CACTCAGCGCTGCCCTCCGCTGG No data
1035167574_1035167602 29 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167602 7:157000594-157000616 GCGGGGTGGGGGAGGGAAGGGGG No data
1035167574_1035167585 6 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167585 7:157000571-157000593 GCCCTCCGCTGGCGGGGGCGGGG 0: 1
1: 0
2: 3
3: 34
4: 270
1035167574_1035167592 12 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167592 7:157000577-157000599 CGCTGGCGGGGGCGGGGGCGGGG 0: 1
1: 4
2: 138
3: 454
4: 2468
1035167574_1035167599 26 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167599 7:157000591-157000613 GGGGCGGGGTGGGGGAGGGAAGG 0: 2
1: 10
2: 140
3: 1602
4: 10697
1035167574_1035167595 17 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167595 7:157000582-157000604 GCGGGGGCGGGGGCGGGGTGGGG 0: 5
1: 40
2: 241
3: 1261
4: 7755
1035167574_1035167579 -2 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167579 7:157000563-157000585 TCAGCGCTGCCCTCCGCTGGCGG No data
1035167574_1035167589 10 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167589 7:157000575-157000597 TCCGCTGGCGGGGGCGGGGGCGG No data
1035167574_1035167581 0 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167581 7:157000565-157000587 AGCGCTGCCCTCCGCTGGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1035167574_1035167593 15 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167593 7:157000580-157000602 TGGCGGGGGCGGGGGCGGGGTGG 0: 2
1: 32
2: 190
3: 1083
4: 5940
1035167574_1035167582 1 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167582 7:157000566-157000588 GCGCTGCCCTCCGCTGGCGGGGG 0: 1
1: 1
2: 1
3: 15
4: 162
1035167574_1035167591 11 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167591 7:157000576-157000598 CCGCTGGCGGGGGCGGGGGCGGG No data
1035167574_1035167598 22 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167598 7:157000587-157000609 GGCGGGGGCGGGGTGGGGGAGGG 0: 1
1: 15
2: 135
3: 1319
4: 7435
1035167574_1035167583 4 Left 1035167574 7:157000542-157000564 CCCTCCAAGCCTGGGGCGCACTC 0: 1
1: 0
2: 2
3: 16
4: 108
Right 1035167583 7:157000569-157000591 CTGCCCTCCGCTGGCGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035167574 Original CRISPR GAGTGCGCCCCAGGCTTGGA GGG (reversed) Intronic
900211768 1:1459710-1459732 GGGTGGGCCCCAAGCCTGGAGGG - Intronic
900224577 1:1527010-1527032 GGGTGGGCCCCAAGCCTGGAGGG - Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900600368 1:3500200-3500222 GTGTGCCCCCGAGGCTTGGTTGG - Intronic
900969922 1:5986211-5986233 GAGAGCGCGCCAGCCTTGGAAGG - Exonic
901658722 1:10785621-10785643 GGGTGCTCCCCAGGCCTGGGTGG - Intronic
901827839 1:11874207-11874229 GAGTGACCCCCAGGCGTGGCTGG - Intergenic
902218959 1:14952632-14952654 GAGTGGAGTCCAGGCTTGGAGGG - Intronic
907318750 1:53589478-53589500 GAGTTTGGCCCAGGCTAGGAGGG + Intronic
908005228 1:59720854-59720876 GAGTGAGCACCAGGCCAGGAGGG - Intronic
915596333 1:156898372-156898394 GAGTGCGCCAGAGGCTGGGCGGG - Intronic
916045657 1:160998358-160998380 GAGTGGGCCCCAGAGATGGAAGG + Exonic
923553321 1:234981199-234981221 CACTGCGCACCAGGCCTGGAAGG + Intergenic
924386452 1:243502752-243502774 GACTGAGCCCCAGGCATGGCTGG + Exonic
1065835811 10:29657245-29657267 GATTGCGCACCAGCCATGGATGG - Intronic
1066185186 10:33003496-33003518 GAGTGCACCCCATGATGGGATGG + Intronic
1070765965 10:79056609-79056631 GAGTGAGGCCCAGGGTTGAAAGG - Intergenic
1074283185 10:112072713-112072735 CAGTGTGCTCCAGGATTGGAGGG - Intergenic
1077284623 11:1760127-1760149 GGGTGAACCCCAGGCTTGGAGGG + Intronic
1081650003 11:44817585-44817607 GACTGTGCCCAAGGCTGGGAGGG - Intronic
1103988892 12:124785181-124785203 GAATGGGCCCCGGGCTGGGAGGG - Intronic
1104860111 12:131919163-131919185 AAGTGCTGCCCGGGCTTGGAAGG - Intronic
1109123599 13:58489031-58489053 GAGTGGGACCCAGGCTAGGCGGG + Intergenic
1112585686 13:100716593-100716615 GAGTGCGACCCAGCCTTGCCTGG - Intergenic
1113962807 13:114134502-114134524 CAGTGAGCACCAGGCTTGCAAGG - Intergenic
1114065087 14:19053665-19053687 GAGTGCACCCTAGGCTGGGAGGG - Intergenic
1114097175 14:19346337-19346359 GAGTGCACCCTAGGCTGGGAGGG + Intergenic
1114634200 14:24178225-24178247 GAGTGCAGCCCAGGCTTTGCCGG + Intronic
1121955044 14:98205878-98205900 GAGTCAGCCCCAGGCTTGGAAGG + Intergenic
1122119203 14:99542851-99542873 GAGAGCGCCCCAGGCCTCGCTGG - Intronic
1122433103 14:101669561-101669583 TATTGCTCCCCAGGTTTGGAAGG - Intergenic
1122975426 14:105168866-105168888 GGGGGCGCCCCAGGCTTTAAAGG + Intergenic
1123491537 15:20785489-20785511 GAGTGGACCCTAGGCTGGGAGGG + Intergenic
1123548041 15:21354583-21354605 GAGTGGACCCTAGGCTGGGAGGG + Intergenic
1130371025 15:83285074-83285096 GAGGGCGCCCCAGGGTAGGAGGG - Intergenic
1130665230 15:85863862-85863884 TGGTGCGGCTCAGGCTTGGATGG - Intergenic
1130908813 15:88257252-88257274 GAGTGCTCCCAAGCCTTGGGTGG + Intergenic
1132337120 15:101055146-101055168 GAGGGCGCCCTAGGCGTGGAGGG + Exonic
1202956371 15_KI270727v1_random:81813-81835 GAGTGGACCCTAGGCTGGGAGGG + Intergenic
1132733978 16:1376464-1376486 GAGTGCACCCCAGCCCTGGAGGG - Intronic
1137444501 16:48523527-48523549 GAGCTCGCCCCAGGCCTGGTGGG - Intergenic
1138030565 16:53556425-53556447 GGGGGCGCCCCAGGCCTGAAAGG - Intergenic
1139490726 16:67284653-67284675 GAGTGCCCAGCAGGCTTGGCAGG + Intronic
1141252253 16:82369380-82369402 GTGTGGGGCCCAGGCTGGGATGG - Intergenic
1141682344 16:85551963-85551985 GAGAGCTCCCCAGGCCTGGCTGG - Intergenic
1142743063 17:1941834-1941856 GTGGGTGCCCCAGTCTTGGACGG + Intronic
1143529754 17:7495993-7496015 GAGGCCGCCCCAAGCTTGGGGGG + Exonic
1146187299 17:30732126-30732148 GAGTGCGTGCGAGGCTTTGAGGG + Intergenic
1147165701 17:38592081-38592103 CAGAGGGCCCCAGGCTTGGAAGG + Intronic
1150864764 17:68838069-68838091 GAGGGCTGCCCAGCCTTGGAAGG + Intergenic
1151597255 17:75086136-75086158 GGGTAAGCGCCAGGCTTGGAAGG + Intergenic
1153713690 18:7824322-7824344 GAGTGCGCACCAGTCATGGTGGG + Intronic
1157320880 18:46632916-46632938 GTGGGCGCCCCAGTCTTGGCTGG - Intronic
1161068215 19:2248439-2248461 GGGTGCACCCCAGGATTTGAGGG - Exonic
1161479738 19:4504548-4504570 GGGTGTGCACCAGGCTTGGCAGG - Exonic
1162566680 19:11448628-11448650 GAGTGCGTCCCAGGAATGCAGGG + Exonic
1163012242 19:14433441-14433463 GCGTGCGCCCCGGGCGTGGCGGG - Intronic
1163695517 19:18761501-18761523 GCCTCTGCCCCAGGCTTGGAAGG + Intronic
1163790882 19:19305560-19305582 GCGTGCGCCCCTGCCTTGGCTGG + Intronic
1166782197 19:45348618-45348640 GGGGGCGCCCCAGGAATGGAGGG - Intronic
1167070920 19:47221620-47221642 CAGTGCACCCCAGGCTGGGCTGG + Exonic
1167492869 19:49802100-49802122 GGGTGGGCCCCAGGCTGGGCTGG - Exonic
926685041 2:15691671-15691693 GGGAGAGCCGCAGGCTTGGAAGG + Intronic
929860610 2:45674209-45674231 GGCTGGGCCCCAGGCTTGGAGGG - Intronic
930724242 2:54667081-54667103 GGGAGGTCCCCAGGCTTGGAAGG - Intronic
932485338 2:72081098-72081120 GACTGAGCCCCAGGCTTTTATGG - Intergenic
935586291 2:104802701-104802723 GAATGCTCCCCAGGCTGGTATGG + Intergenic
937835517 2:126467096-126467118 GAGGGTTCCCCAGGCTTGGCGGG + Intergenic
940849000 2:158670755-158670777 GGATGTGCCCCAGGCTTGGATGG + Intronic
943489917 2:188538415-188538437 GATTGCTCCCCAGGTTTGGTAGG - Intronic
945194937 2:207228800-207228822 GTGTGCACCCCAGACTGGGAGGG - Intergenic
1168924350 20:1566911-1566933 GAATGTGCCTCGGGCTTGGAAGG + Intronic
1171997985 20:31747849-31747871 GAGAGAGCCCCAGGCATGGTGGG - Intronic
1172839424 20:37893227-37893249 CAGTGCGCTTCAGACTTGGAAGG + Intergenic
1174581947 20:51578480-51578502 GGGTGGACCCCAGGCTTGGTTGG - Intergenic
1175839229 20:62016106-62016128 GAGTGCCCACCTGGCTTTGAAGG - Intronic
1176447091 21:6830323-6830345 GAGTGGACCCTAGGCTGGGAGGG - Intergenic
1176825262 21:13695349-13695371 GAGTGGACCCTAGGCTGGGAGGG - Intergenic
1179994013 21:44965669-44965691 GGGTGAGCCCCAGGCATGCAAGG - Intronic
1180483577 22:15776285-15776307 GAGTGCACCCTAGGCTGGGAGGG - Intergenic
1180618794 22:17146286-17146308 GAGGGCGCCACAGGTGTGGAGGG - Intronic
1184645181 22:45891479-45891501 GAGTGGGCCCCAGGGTGGGGGGG - Intergenic
1185207254 22:49547194-49547216 GAGGGCAACCCAGGCTTGGTAGG - Intronic
1185272833 22:49936537-49936559 GGGTGCAGCCAAGGCTTGGAGGG + Intergenic
950614197 3:14146326-14146348 GGATGCACCCCAGGCTGGGACGG - Intronic
953606397 3:44415743-44415765 TAGTGAGCCCCAGGCCTGGATGG - Intergenic
956208030 3:66774023-66774045 GAGTGTGCCCCATGATGGGAAGG - Intergenic
967880564 3:194298522-194298544 GAGCTTGCCCCAGGCTTTGAAGG - Intergenic
968951865 4:3699635-3699657 GAGGGCTCGCCAGGCTAGGAGGG + Intergenic
969540960 4:7788429-7788451 GTGTGCGCCCCATGCTGGGGAGG + Intronic
972050951 4:34732449-34732471 GAGTGTACCCCAGGCTTTGAAGG - Intergenic
974145643 4:57943931-57943953 GAGTGCGCCAGAGGCTGGGTGGG + Intergenic
985655365 5:1129014-1129036 GAGTGCTCCCAAGCCTTGCAGGG - Intergenic
990137822 5:52668633-52668655 GAGTGCCTCCCAGGCTTGGAGGG + Intergenic
990996965 5:61742268-61742290 GAGTGGACCTCAGGCCTGGATGG + Intronic
991051153 5:62273849-62273871 GATTGCTCCCTAGCCTTGGATGG + Intergenic
995048565 5:107675302-107675324 GAGTGCACCCCAGGATAGAAGGG - Intergenic
996405008 5:123095502-123095524 GCGTGCGCCCTAGGCGGGGAGGG - Intronic
996519689 5:124413288-124413310 GAGTGCCTCCCTGGCTGGGATGG - Intergenic
997816750 5:137026713-137026735 GACTGTGCTCCAGGCTTGGTTGG - Intronic
998419300 5:141969170-141969192 GAGTGGGCCCCAGGCAAGGGCGG + Intronic
998553670 5:143102249-143102271 GAGGGAGCCCCAGGCCTGGAAGG - Intronic
1002345834 5:178546995-178547017 GGATGCCCCCCAAGCTTGGAAGG - Intronic
1006183354 6:32166966-32166988 GAGTGCGCCCCCGGCTGGGGAGG + Exonic
1006190453 6:32204370-32204392 CAGTGTGCCCCAGGCTACGATGG - Exonic
1013069008 6:106711258-106711280 GAGTGAGACCCAGTCTTGAAGGG - Intergenic
1017747852 6:157462770-157462792 CAGTGCCCCCCAGCCCTGGAGGG + Intronic
1018175193 6:161172380-161172402 GTGTGTACCCCAGGCCTGGATGG - Intronic
1019016083 6:168880431-168880453 GAGTGCGCTCCAGGGTGGGGTGG + Intergenic
1019111993 6:169724158-169724180 GAGGGCGCCAAAGGCTGGGAGGG + Intronic
1019235012 6:170604478-170604500 GAGAGCCTCCAAGGCTTGGAGGG + Intergenic
1021805323 7:24349332-24349354 GAGAGGGCCCCAGGCCAGGAGGG + Intergenic
1023813393 7:43929675-43929697 CACAGGGCCCCAGGCTTGGATGG + Intronic
1025030471 7:55552665-55552687 GAGTGCCCCCCATTGTTGGAAGG - Intronic
1030093385 7:105876865-105876887 CCCTGCGCCCCAGGCTTGGGCGG - Intronic
1032077462 7:128842814-128842836 AAGTGCGCCCCAGGCGTGGTGGG + Exonic
1035167574 7:157000542-157000564 GAGTGCGCCCCAGGCTTGGAGGG - Intronic
1039702576 8:39977749-39977771 GAATGTGCCCTAGGCTTGCAGGG - Intronic
1049468456 8:142764402-142764424 CGATGGGCCCCAGGCTTGGACGG + Exonic
1049509970 8:143022450-143022472 CAGAGCACCCCAGGTTTGGAGGG + Intronic
1061444464 9:130630117-130630139 GAGTGGGCTCCAGGCATGGTTGG + Intronic
1061446106 9:130639040-130639062 GTGTGGGCCTCAGACTTGGAAGG + Intergenic
1061710444 9:132483705-132483727 GAGTGGGCCCTGGGCTGGGAAGG - Intronic
1203522099 Un_GL000213v1:54208-54230 GAGTGGACCCTAGGCTGGGAGGG + Intergenic
1186448934 X:9655949-9655971 GACAGAGACCCAGGCTTGGATGG - Intronic
1197854481 X:130900661-130900683 GAGTTTGCCCCAGGCAGGGAAGG - Intronic
1200100084 X:153685905-153685927 GGGTGCACCCCAGGCTGGGCTGG + Intronic