ID: 1035168665

View in Genome Browser
Species Human (GRCh38)
Location 7:157006000-157006022
Sequence ACTTAGAAGCAGAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 335}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035168658_1035168665 3 Left 1035168658 7:157005974-157005996 CCCTGGAATGGCCTCAGGGTGAG 0: 1
1: 0
2: 3
3: 17
4: 199
Right 1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG 0: 1
1: 1
2: 2
3: 31
4: 335
1035168659_1035168665 2 Left 1035168659 7:157005975-157005997 CCTGGAATGGCCTCAGGGTGAGA 0: 1
1: 1
2: 1
3: 15
4: 195
Right 1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG 0: 1
1: 1
2: 2
3: 31
4: 335
1035168654_1035168665 15 Left 1035168654 7:157005962-157005984 CCATTGGGTCGGCCCTGGAATGG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG 0: 1
1: 1
2: 2
3: 31
4: 335
1035168652_1035168665 17 Left 1035168652 7:157005960-157005982 CCCCATTGGGTCGGCCCTGGAAT 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG 0: 1
1: 1
2: 2
3: 31
4: 335
1035168653_1035168665 16 Left 1035168653 7:157005961-157005983 CCCATTGGGTCGGCCCTGGAATG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG 0: 1
1: 1
2: 2
3: 31
4: 335
1035168660_1035168665 -8 Left 1035168660 7:157005985-157006007 CCTCAGGGTGAGACGACTTAGAA 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG 0: 1
1: 1
2: 2
3: 31
4: 335
1035168650_1035168665 23 Left 1035168650 7:157005954-157005976 CCTGGGCCCCATTGGGTCGGCCC 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG 0: 1
1: 1
2: 2
3: 31
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035168665 Original CRISPR ACTTAGAAGCAGAATGGGGA GGG Intronic
901376574 1:8843852-8843874 AATTGGAAAGAGAATGGGGAAGG - Intergenic
902566148 1:17312893-17312915 ATTTAGAAACAAAATGGGGCTGG + Intronic
904269771 1:29342360-29342382 ACCTGGGAGAAGAATGGGGAAGG - Intergenic
904442301 1:30539694-30539716 ACTTAGAGGCTAAAGGGGGAGGG - Intergenic
906032794 1:42734344-42734366 TCCTAGAATCAGAGTGGGGAGGG - Exonic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
908840755 1:68277966-68277988 GCTTAGAAGATGAATGGGGATGG - Intergenic
909218921 1:72929189-72929211 ACTTATTAACAGAATGGGCACGG + Intergenic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909620782 1:77664267-77664289 ACCTTAAAGAAGAATGGGGAGGG + Intronic
909710028 1:78638580-78638602 GCTCAAAAGCAGAATGGAGAGGG - Intronic
910655009 1:89610219-89610241 ACTGACAAGCACAGTGGGGAGGG - Intergenic
910852021 1:91657744-91657766 ACTTAGGGGCAGGATGAGGAAGG - Intergenic
911009028 1:93260056-93260078 ACTTAGAGGCTGAGTGGGGAGGG - Intronic
912797110 1:112699992-112700014 ACTAAGAGGGAGAATGGGGTGGG - Intronic
913182724 1:116337712-116337734 CCCTAGAAGCAGAAAAGGGAAGG - Intergenic
913261352 1:117000662-117000684 AGTTAGAAGCAAGATGGAGATGG + Intergenic
915801660 1:158800039-158800061 ACTTAGAAACAGACTGAGAATGG - Intergenic
917317397 1:173739935-173739957 AATTAGAAACAAAATGGGGCTGG - Intronic
918282408 1:183020348-183020370 ACTTAGAAGAAAAATGTGAACGG - Intergenic
918596780 1:186303498-186303520 ACTGAGAAGCGGAAAAGGGAAGG + Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
923029928 1:230240969-230240991 TCTTAGTAGCAAAATGGAGATGG - Intronic
923760979 1:236843823-236843845 ACTGAGAAGCAGGTTTGGGATGG + Intronic
924511076 1:244729771-244729793 ACTTAGAAGAACAAAGGGAAAGG - Intergenic
924652869 1:245946643-245946665 ACGTACAGGCAGAGTGGGGAGGG + Intronic
924676126 1:246179817-246179839 ACTTAGAAAGAGACTGTGGATGG - Intronic
1063881338 10:10535788-10535810 CCACAGGAGCAGAATGGGGAGGG + Intergenic
1063884884 10:10567479-10567501 GCAGAGAAGCAGAATGGGGCGGG + Intergenic
1064452890 10:15459357-15459379 TCTGTGAAGCAGTATGGGGAGGG - Intergenic
1064804899 10:19119650-19119672 TCTTAGAAGCAGTTTAGGGAGGG + Intronic
1064960260 10:20955570-20955592 ATTTAGGAGCAGATTGTGGAGGG + Intronic
1066364179 10:34760625-34760647 TATTAGAAGTAGAATGGGGCTGG - Intronic
1066447263 10:35494524-35494546 ATTTAGTGTCAGAATGGGGAAGG + Intronic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068311493 10:55282868-55282890 GATTAGAAGCAAAATGGGGTTGG - Intronic
1068733641 10:60387789-60387811 ACTTGGAAGCAAAATAGGGAAGG - Intronic
1068865940 10:61896094-61896116 ACCTAGAAGCAGAGTGGGTACGG - Intergenic
1069624892 10:69861449-69861471 CCTTAACAGCTGAATGGGGATGG + Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070074512 10:73122153-73122175 TCTAAGAAACAGAAAGGGGAAGG - Exonic
1070848173 10:79540801-79540823 TCTTAGAAGCAGTTTAGGGAGGG + Intergenic
1070925604 10:80219368-80219390 TCTTAGAAGCAGTTTAGGGAGGG - Intergenic
1074879841 10:117647327-117647349 ACTGAGAAGCAGCATGGACAGGG + Intergenic
1075391417 10:122095210-122095232 GCCTAGAAGCAGAATTGGGGTGG - Intronic
1076742554 10:132494005-132494027 ACGAGGAAGCAGAGTGGGGAGGG - Intergenic
1077593351 11:3510053-3510075 ACTTAATAGTAGGATGGGGAGGG + Intergenic
1077885626 11:6385524-6385546 ACTTAGTAGGAGAAAGGGAAAGG + Intergenic
1078581974 11:12545887-12545909 ATATAGCAGCAGCATGGGGAGGG - Intergenic
1078869127 11:15327792-15327814 TCTTAGAGGGAGAAGGGGGATGG + Intergenic
1079311971 11:19374899-19374921 ACTGAGAATCAGGAAGGGGATGG - Intronic
1079525865 11:21386856-21386878 AATTAGAGTCAGAATGGTGAAGG + Intronic
1080199015 11:29646805-29646827 ACTTAGAAATAAAATGGAGAAGG + Intergenic
1083886428 11:65575717-65575739 ACTGAGACCCAGAAAGGGGAAGG - Intergenic
1084746919 11:71176953-71176975 TCTTAAAAGCAGACTAGGGAAGG + Intronic
1085880881 11:80464643-80464665 ACTTGGAGGCAGAAGAGGGAAGG - Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1088420738 11:109643224-109643246 TCTTAGATGGAAAATGGGGAAGG + Intergenic
1088774519 11:113069481-113069503 ACCTGGAAGCAGTATGGAGAAGG + Intronic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089113046 11:116072212-116072234 AATTAGAAGCAGACAGGGAAAGG - Intergenic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089389739 11:118092558-118092580 TCTTAGAAGCAGTTTGGGGAGGG + Intronic
1089999031 11:122937760-122937782 ACTAAGAAAGAGAACGGGGATGG - Intronic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG + Intronic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094527831 12:31244329-31244351 ACTAGGAAGGAGAATGGGAAGGG + Intergenic
1096502873 12:52075785-52075807 ACCAAGCAACAGAATGGGGAAGG - Intronic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1097051944 12:56229016-56229038 TCTGAGAACCAGAATGGGAATGG + Exonic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1099078602 12:78144791-78144813 GCCTAGAAGCAGAATTGGGCAGG + Intronic
1099220304 12:79906169-79906191 ACCTAGAAACAGAATTGGAATGG + Intronic
1099250014 12:80242932-80242954 TCTTAGAAGCAGAAACAGGACGG - Intronic
1099983127 12:89629827-89629849 ACTTAGAAGCAGGGTGGGGAGGG + Intronic
1100223623 12:92533831-92533853 GGTTAGAAGCAAGATGGGGACGG + Intergenic
1101521120 12:105483383-105483405 ACATGGAAGCAGAATGTGCAAGG + Intergenic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101739878 12:107492584-107492606 ACACAGAAGCAGAAGTGGGAGGG - Intronic
1103207819 12:119144024-119144046 GTTTAGAAGCAGGATGGCGAGGG - Intronic
1105554156 13:21429871-21429893 ACTGAACAGCAGAATGGAGAGGG - Intronic
1107320931 13:39187579-39187601 ATTTAGAAGCAAAATAGGGAAGG - Intergenic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1108192470 13:47956298-47956320 ACTTAACAGCAGACTGGTGATGG + Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1109504995 13:63288088-63288110 ACTTAGAGGCTGAGTTGGGAGGG + Intergenic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1111427558 13:88107543-88107565 ACTCTGAAGCATAATGGTGAAGG - Intergenic
1112832351 13:103468798-103468820 ACTTTAAAGCAGAATGGCTATGG - Intergenic
1117835518 14:59801048-59801070 ACATAGAAAAAGAATGGGGGAGG + Intronic
1120111350 14:80561034-80561056 ACTTAGAAGCAGAATGAACTTGG + Intronic
1120431277 14:84419034-84419056 ACTCAGGAGAAGAATGGGGCAGG + Intergenic
1120852750 14:89186167-89186189 ACTTGGAAGCACACTGGGGAGGG + Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121408545 14:93733983-93734005 ACCTAGAAGGAGGCTGGGGAGGG - Intronic
1121497456 14:94403974-94403996 GCTTAGAATAAGAATGGAGAAGG + Intergenic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1124017491 15:25889659-25889681 ATTTGGAAGCATTATGGGGAAGG + Intergenic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125782532 15:42282684-42282706 ATTAAGGAGCAGATTGGGGAAGG - Intronic
1126368615 15:47922208-47922230 ACTTAAGAGCAGAATGCAGATGG - Intergenic
1126684210 15:51233194-51233216 ACATAGAAAAAGAATAGGGAAGG - Intronic
1127233622 15:57023404-57023426 TTTTTCAAGCAGAATGGGGAGGG - Intronic
1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG + Intergenic
1128359653 15:66953102-66953124 GCTCAGAAGCAGCCTGGGGATGG - Intergenic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128750850 15:70148021-70148043 CCTTAGACTCTGAATGGGGAGGG - Intergenic
1129381258 15:75168897-75168919 TCTTAGAAGCAGTTTAGGGAGGG - Intergenic
1131423317 15:92325701-92325723 ACTGAGAGGCAGAATGGTTATGG - Intergenic
1131914281 15:97247183-97247205 TCTTAGAAGCAGTTTAGGGAGGG + Intergenic
1132275971 15:100564279-100564301 ACTTAGGAGCAGTTTAGGGAGGG - Intronic
1133966409 16:10535202-10535224 AGTTTGAAGCAGAACAGGGAGGG + Intronic
1134264527 16:12681832-12681854 ACTTAGAATCAGAAAGGACATGG + Intronic
1134374987 16:13663807-13663829 ACAAAGAAGCAGAATGTGAAAGG - Intergenic
1135672731 16:24389063-24389085 TCTTAGGAGCAGTATAGGGAGGG - Intergenic
1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG + Intronic
1137776419 16:51058421-51058443 ATCCAGGAGCAGAATGGGGAGGG + Intergenic
1138620228 16:58205311-58205333 CCTTAGAACCAGAATAGGCATGG + Intergenic
1138784131 16:59826106-59826128 ACTTCCAAGAAAAATGGGGAAGG - Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1141556384 16:84839308-84839330 ACCTGGAGGCAGAGTGGGGAGGG + Intronic
1144159021 17:12538857-12538879 ACTAAAAATAAGAATGGGGAAGG + Intergenic
1144399538 17:14883152-14883174 ACTTAGAATCAGAATGGAAGGGG + Intergenic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1147785445 17:42975178-42975200 ACTTGGAAGCAAGCTGGGGAGGG + Intronic
1147870384 17:43582965-43582987 GTTTAGAAACAGAATGGGAATGG - Intergenic
1148652322 17:49259199-49259221 ACTGAGGCCCAGAATGGGGAAGG + Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1149284876 17:55151229-55151251 AGTTAGAAGTAGAGTGGGGAGGG + Intronic
1149585474 17:57783326-57783348 ACTCTGATGCAGAATGAGGAAGG + Intergenic
1150316590 17:64174377-64174399 ACTAGTAAGCAGAATGGGGAGGG + Intronic
1150339792 17:64357237-64357259 ACCCAGGAGGAGAATGGGGATGG - Intronic
1150417824 17:65001698-65001720 ACTTGGAAGCAGCAGGTGGAGGG - Intergenic
1150485789 17:65542697-65542719 TCTTAAAAGCAGAATGGTCAAGG + Intronic
1150793826 17:68222097-68222119 ACTTGGAAGCAGCAGGTGGAGGG + Intergenic
1150996910 17:70329225-70329247 ACAAAGAAAAAGAATGGGGAGGG + Intergenic
1151284247 17:73098510-73098532 TCTTAGAAGCAGTTTAGGGAGGG - Intergenic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1156108514 18:33694570-33694592 ATTTAGAAGCAGTTGGGGGATGG - Intronic
1156934693 18:42689639-42689661 ACTTAGATGCTGGATAGGGAGGG + Intergenic
1157119593 18:44896480-44896502 ACTTGGATGTAGAGTGGGGAGGG - Intronic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159694279 18:71535295-71535317 ACTTAGAAGTATAATCGGCATGG + Intergenic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1166071889 19:40392857-40392879 ACTTAGATCCTGAATTGGGATGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166966233 19:46530824-46530846 ACCTGGAAGGAGAGTGGGGAGGG - Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167628397 19:50607519-50607541 ACTGAGAAAGAGGATGGGGACGG - Intergenic
1168227398 19:55005642-55005664 TCTTAGAAGCAGTTTAGGGAGGG + Intergenic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
925048679 2:794717-794739 ACTTGGAAGCTGAGTGGGGCTGG + Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
930160808 2:48154866-48154888 ACTTGGAAGAAGTATGGGAAGGG + Intergenic
930865954 2:56121996-56122018 ACTTGGTAGCAAGATGGGGATGG + Intergenic
932025899 2:68132298-68132320 AATCAGAAGCAGAATGGAAAGGG + Intronic
932569926 2:72933256-72933278 ACAGAGAGGCAGAATGGGCATGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933080395 2:77977658-77977680 ACTTAGAGGCAGCAGGGGAAGGG - Intergenic
933206209 2:79511768-79511790 ACTTGGAAGCAAAAGGGGGGAGG + Intronic
933344976 2:81071855-81071877 ACCCAGTAGCAGAATGGAGAGGG + Intergenic
939812975 2:146857476-146857498 AGTTAGTAGCACAATGGGGTAGG + Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
941751845 2:169142565-169142587 CCTTTGCAGCAGAGTGGGGATGG - Intronic
942033135 2:171983692-171983714 TCTTAGAAGCAAAGTGTGGAAGG - Intronic
942228420 2:173837109-173837131 ACTTAGAGGAAGAATGGTGAAGG + Intergenic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
946476484 2:220011285-220011307 ACTCACAATCAGAAAGGGGAGGG - Intergenic
1169770035 20:9190193-9190215 ACCTAGAAGCTGACTGGGGCTGG + Intronic
1170564696 20:17591793-17591815 AGTTAGTAGAGGAATGGGGATGG + Intronic
1170624174 20:18018906-18018928 TCTGTGCAGCAGAATGGGGATGG - Intronic
1170805046 20:19622159-19622181 ACTTGAAAGGAGACTGGGGATGG + Intronic
1172939811 20:38646369-38646391 GCTTAGAAGCGGGTTGGGGAGGG + Intronic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1176930994 21:14810014-14810036 TCTTAGGAGCAGTATAGGGACGG - Intergenic
1177058376 21:16338255-16338277 ACTCAGAAGCAGAATTGATAGGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177665394 21:24150476-24150498 TCTTATAAGCAAAATGGTGATGG - Intergenic
1178596549 21:33958685-33958707 GCTTAATAGCAGAATGGAGATGG + Intergenic
1178819312 21:35961011-35961033 ACTAAGCAGCAGGATGGGAAGGG - Intronic
1180898197 22:19352684-19352706 AATTATAATCAAAATGGGGAGGG + Intronic
1180971960 22:19820496-19820518 ACTGAGGGGCAGAATGGGGTGGG - Intronic
1181611687 22:24018143-24018165 ACTGAGAAACAGGATGGGCATGG - Intronic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1183308256 22:37095510-37095532 ACTCAAAAGGAAAATGGGGAGGG + Intronic
1183624791 22:38995221-38995243 ACTTTGCAGATGAATGGGGAGGG - Intergenic
1183867462 22:40715155-40715177 TCATAGAAACAGAAAGGGGAAGG + Intergenic
1184605333 22:45570032-45570054 ACATAGAAGAAAAATGGGGCCGG + Intronic
949167466 3:959517-959539 ATATATAAACAGAATGGGGATGG + Intergenic
949936625 3:9121038-9121060 AATTAGGAGCAGAACTGGGATGG - Intronic
950133540 3:10564372-10564394 ACTTAGCTGGAGAATAGGGATGG - Intronic
950135697 3:10579370-10579392 ACTTAGAAACAGACTGAGAAGGG + Intronic
950964715 3:17138223-17138245 ACTTTGAAACAGAGTAGGGAGGG + Intergenic
951621996 3:24612675-24612697 TCTTAGAAGCAGAATACGGTTGG + Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
954141060 3:48605798-48605820 ACTGAGAAGAATAATGGGGCAGG - Exonic
956022118 3:64944113-64944135 ACTCAGAAGCACAATGGCCAGGG + Intergenic
956105722 3:65816112-65816134 AATTAGAATCAGAATTGGGAGGG - Intronic
956540446 3:70332405-70332427 ACTTGCAACCAGAATGAGGATGG - Intergenic
956706635 3:72004815-72004837 GGTTAGAAGCAAAATGGGGTCGG - Intergenic
957063448 3:75500950-75500972 ACTTATTAGTAGGATGGGGAGGG + Intergenic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
958892670 3:99797732-99797754 CCTTAGAAGCGGACTGTGGAAGG + Exonic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961897155 3:130177389-130177411 ACTTAATAGTAGGATGGGGAGGG + Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963738417 3:149048873-149048895 ACTTAGAATCAGAAAGAAGATGG - Exonic
963779881 3:149476337-149476359 ACCTAGAAGCCTACTGGGGAGGG - Intronic
963858288 3:150279442-150279464 ACTTAAAAGAAAAATGGGGTTGG - Intergenic
964661299 3:159123432-159123454 TCTTAGAAGCTGACTGGGCAGGG - Intronic
964921207 3:161897944-161897966 TCTTAGAAGCAGTTTAGGGAGGG - Intergenic
965193881 3:165568688-165568710 ACTCAGAAACAGAAAGTGGAAGG + Intergenic
966391033 3:179452336-179452358 ACTCAGAAGAAAAATGGGGGTGG - Intergenic
966742307 3:183245248-183245270 ACATAGAAACAGAAAGGAGAAGG + Intronic
967548821 3:190765275-190765297 ACTAAGTAGCAGAAAGGGGTAGG + Intergenic
967859867 3:194142262-194142284 GGTTAGAAGCAGAAGGGTGAGGG + Intergenic
969007333 4:4030952-4030974 ACTTATTAGTAGGATGGGGAGGG + Intergenic
969334542 4:6499920-6499942 ACTTGGAAGAAGAAAGGGGAAGG - Intronic
969746279 4:9075111-9075133 ACTTAATAGTAGGATGGGGAGGG - Intergenic
969805635 4:9606520-9606542 ACTTAATAGTAGGATGGGGAGGG - Intergenic
970546940 4:17139376-17139398 ACTTAGAAGGAGAATGGTAAAGG + Intergenic
972602321 4:40583561-40583583 TCTTAAAAGCAGAATGGGCCAGG + Intronic
973091880 4:46147386-46147408 ACTTGGGAGCAGAATCAGGAGGG + Intergenic
973842150 4:54873322-54873344 TCACAGAAGCAGACTGGGGAGGG - Intergenic
975668699 4:76758401-76758423 GTTTAGAAGCAGAATGGTCATGG + Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
977150242 4:93502587-93502609 ACTTAGCAGTAGAGTGTGGAGGG - Intronic
977847819 4:101786908-101786930 ACTTAGAACATGAATGGTGAAGG + Intronic
978016246 4:103749875-103749897 ACTTAGTTGAAGAGTGGGGATGG + Intergenic
979719142 4:123878845-123878867 GCTTAGAAGCAAGATGGGGTTGG - Intergenic
980582946 4:134776013-134776035 ACTTAGAAGAAGAAAGGAGCTGG - Intergenic
982329480 4:154165260-154165282 ACTCAGCAGCAGCATGGGAAAGG - Intergenic
982717747 4:158826689-158826711 CCTTGGAACCAGAATGGGAATGG + Intronic
982762982 4:159309597-159309619 CCTTAGAAGCAGATGGGGGCAGG + Intronic
983633698 4:169876501-169876523 CCTTAAAAGCAGAATGGGGCCGG - Intergenic
984483016 4:180330219-180330241 ACTATGGAGCAGAATGGGAAGGG - Intergenic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
986851732 5:11820360-11820382 ACTTAGAAGAAGAATGGTGCCGG + Intronic
991498820 5:67255421-67255443 ACTTTAATGGAGAATGGGGAGGG + Intergenic
991989630 5:72324752-72324774 ACTTAAAAGCATTTTGGGGAGGG - Intronic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
993155161 5:84213296-84213318 AATTAGAAACAGAATGGTTAGGG - Intronic
993300682 5:86205747-86205769 ACTTAGAACCAGAATGGTTATGG - Intergenic
993603130 5:89953450-89953472 ACTTGGACGCAGAATGGGTAAGG + Intergenic
993994107 5:94699993-94700015 ACTTAAAAGCAGAATTGTAAAGG + Intronic
995486505 5:112645278-112645300 TTTTAAAAGCAGAATGGGGCCGG + Intergenic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
996246274 5:121267370-121267392 AAGTAGAAGCAGATTTGGGAGGG - Intergenic
996864012 5:128098213-128098235 ACTTAATAGCAGAATGGAAATGG - Intronic
997566742 5:134893731-134893753 AGTTAGAAGCAGAAGAGGGGGGG + Intronic
998549869 5:143067041-143067063 ACCAAGAAGCAGAAGCGGGAGGG - Intronic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
998853520 5:146373387-146373409 ACATAGATGCAGAAAGGTGAGGG + Intergenic
999291184 5:150427597-150427619 ACCAAGAAGGAGAATGGGGAAGG - Intergenic
1000203856 5:159038315-159038337 ACCTAAATGCAGAATGGAGAAGG - Intronic
1000831982 5:166113583-166113605 ACTTAGAAACAGAAGGATGAAGG + Intergenic
1000870839 5:166575130-166575152 ATTAAAAAGCTGAATGGGGAGGG + Intergenic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1001950086 5:175810259-175810281 ACTGAGACCCAGAGTGGGGAGGG + Intronic
1003000520 6:2328014-2328036 TCTCAGAAGAAGAAGGGGGAAGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1005726770 6:28656928-28656950 CATTAGGAGCAGAGTGGGGACGG + Intergenic
1005932028 6:30491235-30491257 ACCTGGCAGCAGGATGGGGAGGG + Exonic
1006093047 6:31639472-31639494 ACCTTGAAGCAGAATAGGGATGG - Intronic
1006764611 6:36493753-36493775 ACTTAGAGGCAGAGTGCTGATGG - Intergenic
1007668205 6:43529222-43529244 AATTATAAGGAGAATGGTGAAGG - Intronic
1007765717 6:44158705-44158727 ACTGAGAAGGAGAAAAGGGAAGG + Intergenic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1011194632 6:84768449-84768471 AGCTAGAAGCAGAAATGGGACGG + Intergenic
1013521265 6:110935910-110935932 TACTAGAATCAGAATGGGGAGGG - Intergenic
1013810028 6:114034256-114034278 ATTTAGAACCAGATTGTGGAGGG + Intergenic
1014588585 6:123232513-123232535 TCTGAGAAGCAGAAAGGGCAAGG + Intronic
1015340312 6:132091652-132091674 ACTTAACAGCAGATTGGAGAAGG + Intergenic
1015449817 6:133353388-133353410 ACCTAGAAGCAAAATTTGGAAGG - Intronic
1015504251 6:133965385-133965407 AATTAGAAGCATAATGGGTTTGG - Intronic
1015542429 6:134328635-134328657 ACTTAGAAAAAGAATGAGGCTGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1018552379 6:165012486-165012508 ATTTTCATGCAGAATGGGGAAGG - Intergenic
1019111359 6:169718289-169718311 ATTTAAAAGCAAAATGGGAAAGG - Intronic
1021457363 7:20844247-20844269 ACTAAGAGGCAGAATGTGGTTGG + Intergenic
1022195998 7:28067884-28067906 ACTTAGAAGCAGAAGGAGACGGG - Intronic
1022538515 7:31113850-31113872 ACTTAGAAGCAAATGGGAGAAGG + Intergenic
1022632998 7:32103207-32103229 ATTTGGAAGCAGAAAAGGGAGGG + Intronic
1023174253 7:37420387-37420409 ATTTAGAATGAGAATGGGCAGGG - Intronic
1024584788 7:50832697-50832719 ACTCAGAAGCAGACAGGGCATGG + Intergenic
1026199895 7:68205638-68205660 ACTTATGAACAGAATGAGGACGG - Intergenic
1026799574 7:73391162-73391184 TCTTAGAAGCAGTTTGGAGAGGG - Intergenic
1027661095 7:80989222-80989244 ACTTAGAAGCTGATTAGTGATGG - Intergenic
1028112261 7:86955733-86955755 ACTTGGAATCTGAATTGGGATGG - Intronic
1028150807 7:87369069-87369091 ACTTAGGAACAGAAATGGGAAGG - Intronic
1029545760 7:101209835-101209857 TCTTAAAAGAAGAATGGGGCTGG - Intronic
1031276280 7:119727591-119727613 ACTTAGGAGCCAAATGGGGGAGG - Intergenic
1031931849 7:127693797-127693819 CCTTAGTACCAAAATGGGGAGGG - Intronic
1032975890 7:137221798-137221820 ACATGGAAGCAGAATGTAGATGG + Intergenic
1033445837 7:141421203-141421225 ATTTAGAAGCATGATGGAGAAGG - Intronic
1034227552 7:149495699-149495721 ACTGAGAACTAGAATGCGGATGG + Intronic
1034849396 7:154479903-154479925 GCTGAGAAGGAGGATGGGGAGGG - Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035219562 7:157397786-157397808 ACATAGAAGCTGAATTGAGAAGG - Intronic
1035640240 8:1179254-1179276 CCTTAGATGCAGAGTGGGGGTGG + Intergenic
1035811581 8:2495937-2495959 TCTTAGGAGCAGTTTGGGGAGGG + Intergenic
1036368780 8:8145029-8145051 ACTTAATAGTAGGATGGGGAGGG - Intergenic
1036882109 8:12520613-12520635 ACTTAATAGTAGGATGGGGAGGG + Intergenic
1037864147 8:22429613-22429635 AATTGGGAGCAGCATGGGGATGG + Intronic
1039301716 8:36216657-36216679 TCTTAGAAGCAGTTTAGGGAAGG - Intergenic
1039443893 8:37614918-37614940 TCTTAGCAGCAGAATGTGGTGGG - Intergenic
1039725935 8:40216670-40216692 ACTTCAAAGCAGAGTGGGGTTGG + Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040858090 8:51970762-51970784 ACTCAGAAGTGGAAGGGGGAAGG - Intergenic
1041842425 8:62287778-62287800 GGTTAGAATCAGAATGTGGAAGG - Intronic
1042021621 8:64375741-64375763 GCCTTGAAACAGAATGGGGATGG + Intergenic
1042766449 8:72327223-72327245 ACTCAGGAGAAGAATGGAGAAGG - Intergenic
1042998217 8:74724898-74724920 GCTTACCAGCAGAATTGGGAAGG - Intronic
1043783247 8:84363323-84363345 ACTCAGAAACAGAAGGGAGATGG + Intronic
1044325330 8:90851945-90851967 ACTTAAAAACAAAATGGGGTTGG - Intronic
1044774775 8:95676930-95676952 CCTTACAAGCCAAATGGGGAAGG - Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1046888721 8:119398610-119398632 ACTTAGATTCAGGATTGGGAAGG + Intergenic
1047470481 8:125166825-125166847 ACTTCGGAGGAGAATGGAGATGG - Intronic
1047708249 8:127524045-127524067 ACTTACAAGCAGATAGGGAAAGG + Intergenic
1048275599 8:133063298-133063320 GCTTAGAAGCAGCTTGGGGGAGG - Intronic
1048696272 8:137031659-137031681 AATTAGGAGGAGAAGGGGGAGGG - Intergenic
1049519340 8:143080278-143080300 ATTTGGAAGCAGACGGGGGAGGG - Intergenic
1050101459 9:2124279-2124301 ACTGAGAATCAAAATGTGGAAGG + Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1054904551 9:70403282-70403304 ACATATATCCAGAATGGGGAAGG - Intronic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055939486 9:81636079-81636101 AATTAGAAGCAAAATGGAAAAGG + Intronic
1056041870 9:82676598-82676620 ACTCAGAAGCAGAGATGGGAGGG - Intergenic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1057847506 9:98536893-98536915 ACTGAGGAGCAGGATGGAGAAGG - Intronic
1057937664 9:99254237-99254259 AACTAGGAGGAGAATGGGGAGGG - Intergenic
1058610107 9:106766732-106766754 TCTGAGAAGTAGAATGGGTATGG + Intergenic
1058634009 9:107018939-107018961 ACTTAGAGGCTGAGTGGGGTGGG - Intergenic
1060976934 9:127770457-127770479 ACTAAGGACCAGAATGGGGCAGG + Intronic
1061177272 9:129005297-129005319 CCTTAGAACAAAAATGGGGATGG + Exonic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062652447 9:137585039-137585061 ACTCACAAGCAGTATGAGGAAGG + Intronic
1186612069 X:11147455-11147477 ACTTGGAAGCAGAATTGTGAGGG + Intronic
1186942784 X:14529224-14529246 AATTTGAAGCAGAAAAGGGAAGG - Intergenic
1187926150 X:24252103-24252125 ACTTAGAAGCCAAGAGGGGATGG - Intergenic
1188286354 X:28329377-28329399 AGTTAGAAGCAAGATGGGGTCGG + Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190480794 X:50874823-50874845 GCTAAGAAGCAGAATGGGCTTGG + Intergenic
1192205243 X:69091477-69091499 GCTGAGAACCAGAGTGGGGAAGG - Intergenic
1192619740 X:72666724-72666746 GCTAAGAAGCAGGATAGGGAAGG + Intronic
1193431108 X:81407020-81407042 ATTTAGAAGCAGTTTAGGGAGGG + Intergenic
1193703231 X:84789694-84789716 GCTTAAAAGCAGACTGGAGATGG + Intergenic
1194989294 X:100528206-100528228 ATTTAGAATCAAAATGGGGAAGG - Intergenic
1195494447 X:105514016-105514038 AAATGGCAGCAGAATGGGGAAGG + Intronic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1196988589 X:121302364-121302386 ACCTAGAAGCAAAATTGGGTGGG - Intergenic
1197209585 X:123817797-123817819 TCTTAGGAGCAGTTTGGGGAGGG + Intergenic
1198445147 X:136705990-136706012 ACTAAGATGCAGAATGGACATGG - Intronic
1199362094 X:146933097-146933119 TCTTAGAAGCAGTTTAGGGAGGG - Intergenic
1199783170 X:151081949-151081971 ACACAGAAGGAGAATGGAGAAGG + Intergenic
1201262952 Y:12178067-12178089 ACTTAGGAGCAGTTTAGGGAGGG + Intergenic
1201981613 Y:19915598-19915620 ACTTAGAAGGACAATTTGGAAGG - Intergenic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic