ID: 1035169534

View in Genome Browser
Species Human (GRCh38)
Location 7:157009939-157009961
Sequence CGCCGCCGCCGCTGGGGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 0, 2: 17, 3: 97, 4: 520}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035169534_1035169549 25 Left 1035169534 7:157009939-157009961 CCAGGCCCCCAGCGGCGGCGGCG 0: 1
1: 0
2: 17
3: 97
4: 520
Right 1035169549 7:157009987-157010009 CTGCGCCCGGATGCGCGTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 85
1035169534_1035169553 30 Left 1035169534 7:157009939-157009961 CCAGGCCCCCAGCGGCGGCGGCG 0: 1
1: 0
2: 17
3: 97
4: 520
Right 1035169553 7:157009992-157010014 CCCGGATGCGCGTGGTGGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 84
1035169534_1035169543 -10 Left 1035169534 7:157009939-157009961 CCAGGCCCCCAGCGGCGGCGGCG 0: 1
1: 0
2: 17
3: 97
4: 520
Right 1035169543 7:157009952-157009974 GGCGGCGGCGGCGGCGGCGGCGG 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
1035169534_1035169546 12 Left 1035169534 7:157009939-157009961 CCAGGCCCCCAGCGGCGGCGGCG 0: 1
1: 0
2: 17
3: 97
4: 520
Right 1035169546 7:157009974-157009996 GCGGCAGCGGCCGCTGCGCCCGG 0: 1
1: 0
2: 8
3: 100
4: 837
1035169534_1035169551 29 Left 1035169534 7:157009939-157009961 CCAGGCCCCCAGCGGCGGCGGCG 0: 1
1: 0
2: 17
3: 97
4: 520
Right 1035169551 7:157009991-157010013 GCCCGGATGCGCGTGGTGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 57
1035169534_1035169550 28 Left 1035169534 7:157009939-157009961 CCAGGCCCCCAGCGGCGGCGGCG 0: 1
1: 0
2: 17
3: 97
4: 520
Right 1035169550 7:157009990-157010012 CGCCCGGATGCGCGTGGTGGTGG 0: 1
1: 0
2: 0
3: 17
4: 106
1035169534_1035169548 22 Left 1035169534 7:157009939-157009961 CCAGGCCCCCAGCGGCGGCGGCG 0: 1
1: 0
2: 17
3: 97
4: 520
Right 1035169548 7:157009984-157010006 CCGCTGCGCCCGGATGCGCGTGG 0: 1
1: 0
2: 1
3: 8
4: 79
1035169534_1035169545 -1 Left 1035169534 7:157009939-157009961 CCAGGCCCCCAGCGGCGGCGGCG 0: 1
1: 0
2: 17
3: 97
4: 520
Right 1035169545 7:157009961-157009983 GGCGGCGGCGGCGGCGGCAGCGG 0: 104
1: 1218
2: 1745
3: 2910
4: 5735
1035169534_1035169544 -7 Left 1035169534 7:157009939-157009961 CCAGGCCCCCAGCGGCGGCGGCG 0: 1
1: 0
2: 17
3: 97
4: 520
Right 1035169544 7:157009955-157009977 GGCGGCGGCGGCGGCGGCGGCGG 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035169534 Original CRISPR CGCCGCCGCCGCTGGGGGCC TGG (reversed) Exonic
900150816 1:1178715-1178737 TGCGGCCGCCCCTGGGTGCCAGG - Intronic
900213972 1:1471506-1471528 TGCCGACGCGGCTGCGGGCCGGG + Intergenic
900269172 1:1778418-1778440 CGGCGCCGGCGCCGGGGTCCGGG - Intronic
900386429 1:2412994-2413016 CGCGGCCGGCGCTGGGAGCTCGG - Intronic
901002281 1:6154769-6154791 CGCCGCCGCCGCTGCTGCCGCGG + Exonic
901109607 1:6784845-6784867 CGCCGCTGCCGGTGGGGAGCCGG - Intergenic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
901635359 1:10667900-10667922 CACCGCAGCTGGTGGGGGCCCGG - Intronic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902247307 1:15129339-15129361 CGCCTCCTCCTCTGGGTGCCAGG + Intergenic
902916698 1:19644135-19644157 CGCCGCGGCGGCAGGGGCCCCGG - Intronic
903115535 1:21176309-21176331 CGCCGCCGCCGCTCCGGTGCCGG + Exonic
903184706 1:21622524-21622546 CAGCGCCGCCGCCGGGAGCCGGG - Intronic
903324736 1:22563445-22563467 CGCCGCCGCCGCCCCGGGCGGGG - Intergenic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903628211 1:24745937-24745959 CGCGCCCGGCGCTGGGGCCCCGG - Intronic
904245076 1:29181785-29181807 CGCCGCCGCCTAAGGGGGGCTGG - Exonic
904256905 1:29259992-29260014 CGCCCGCGCCGCGCGGGGCCTGG - Exonic
904642008 1:31938133-31938155 CGCCGCCGCCGGGCCGGGCCGGG - Exonic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904822946 1:33256816-33256838 CGCCGCCGCCGCTCTGGGCCGGG - Intronic
904837753 1:33349923-33349945 GGCCGCCTCCGCCGGGGGCGGGG + Intronic
905569329 1:38991438-38991460 CGCCGCCGCTTCGGGGAGCCGGG - Exonic
905626220 1:39491932-39491954 CGCCGCCGCCCCTGGGCCCGGGG - Exonic
905870987 1:41404561-41404583 GGCTGCAGCCGCTGGGGGCTGGG + Intergenic
906615821 1:47232207-47232229 GGCCGCCGCCGCTCAGGACCGGG - Intronic
906637010 1:47416484-47416506 CGCCGCCGCCGCCCCGGGCCGGG - Exonic
907091408 1:51729483-51729505 CGCCGGCGCTGCTGGGGGAAAGG - Intronic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
908501185 1:64745146-64745168 GTCCGCAGCCGCTGGGCGCCCGG + Exonic
908527581 1:65002685-65002707 CGCCTCCGCCGCCGCCGGCCAGG - Intergenic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG + Exonic
910450159 1:87335562-87335584 CGCGGCCGGGGGTGGGGGCCTGG + Intronic
913205526 1:116534637-116534659 CAGCGCCGCCGCGGCGGGCCTGG - Intronic
914808376 1:151008407-151008429 CGCCTCCGCCGCTGGGGGCGGGG + Intronic
915310456 1:155003691-155003713 CGCCGGCGCCGGTGGGGGGACGG - Intronic
915589009 1:156860208-156860230 CCCCGCCCGCGCTGGGTGCCTGG - Intronic
915616897 1:157045944-157045966 CGCCGCGGCGGCCGGGGGCGGGG + Intergenic
916065508 1:161132647-161132669 CGCCGCCGCCGCCGCGGCCGTGG + Exonic
917817437 1:178725254-178725276 CGCCGCCGCCGCTGCCGCTCGGG - Exonic
921046105 1:211479072-211479094 CACCGCCGCCACTGCGGTCCTGG - Exonic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922518199 1:226223741-226223763 CCCCGCCGGCGTGGGGGGCCCGG - Exonic
922579938 1:226689409-226689431 AGCAGCCGCTGCTGCGGGCCAGG + Intronic
922602913 1:226870692-226870714 CGCCTGCGGCGCTGAGGGCCCGG + Intronic
922776478 1:228216409-228216431 CCCTGGGGCCGCTGGGGGCCAGG - Exonic
922917582 1:229271184-229271206 GGCCGCAGCCGCTGGGAGACCGG + Exonic
923108101 1:230869202-230869224 TCCCGCCGCCCCTCGGGGCCAGG + Intronic
923163410 1:231337382-231337404 CGCCGCCGCCTCTGGAGGGGAGG - Exonic
923191773 1:231626894-231626916 CGCCGCCGCCGGCGGCGGCTGGG - Exonic
923622234 1:235588355-235588377 CACAGCCCCCGCTGGGGGCCAGG - Intronic
924561076 1:245156548-245156570 CGCCGCCGCTGCCGGAGCCCGGG - Exonic
1063664094 10:8051499-8051521 CGCCGCCGCCGCAGGGCCCGGGG - Intergenic
1064086506 10:12349650-12349672 CGCCGCCGCCGCCGCGGCCGCGG - Exonic
1064167857 10:13001782-13001804 CGCCCCAGCCGCAGGGGGCAGGG - Intronic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1064982009 10:21174343-21174365 CGCCACCGCCGCTGCAGGCCGGG + Intergenic
1065025354 10:21535032-21535054 CGCCGCCTGCGCCTGGGGCCGGG + Intronic
1066429342 10:35336883-35336905 CGCCGCCGCCGCTGCTGACCCGG + Exonic
1067471816 10:46543206-46543228 CACAGCCACAGCTGGGGGCCTGG + Intergenic
1068560851 10:58512979-58513001 CGCCGCCGCCACTGAGCCCCCGG - Intergenic
1070800862 10:79243664-79243686 CGCCGCGGCCGCCGCCGGCCGGG + Intronic
1072591413 10:96832044-96832066 TGCCGCCGCCTCTGGCCGCCCGG - Intergenic
1072915540 10:99535511-99535533 CGCCGCCGCCGCCGCCCGCCGGG - Exonic
1074121851 10:110498831-110498853 CGCCGCTGTCGCTGGGGTCAGGG + Intronic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1074722118 10:116272601-116272623 CGCCGCCGCCACCGAGGGCTCGG - Intronic
1075106273 10:119542205-119542227 CTCCGCCTCCGCTGCGGGCGTGG - Intronic
1075748431 10:124743982-124744004 CGCCGCCGCCGCCCGGCCCCGGG + Intronic
1075753427 10:124791996-124792018 CCCCGCCGGCGCAGGGAGCCGGG - Intergenic
1075801826 10:125159331-125159353 GCCCGCCGCCGCCGGGAGCCCGG - Intronic
1076554205 10:131311513-131311535 CGCCGCCGCCGCCCTGGGTCTGG - Exonic
1076646137 10:131956098-131956120 AGCCGCCTCCGCTGGAGGCCCGG + Exonic
1077415062 11:2420990-2421012 CACCACGACCGCTGGGGGCCTGG - Intronic
1077891169 11:6419101-6419123 CGCCTCCGCCGCTCGGGGCGCGG - Intronic
1077962461 11:7089624-7089646 CACCGCCGCTGCTGCGAGCCGGG - Exonic
1078594675 11:12675278-12675300 CGCCGCCGCCCCCCGGCGCCGGG + Intronic
1078753964 11:14191186-14191208 CGCTGCTGCCTCTGGTGGCCTGG + Intronic
1079459758 11:20669465-20669487 CGCAGCCGCAGCGGGGGGCCGGG + Intergenic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1080386261 11:31812888-31812910 CGCCGCAGCCCCTGGCAGCCGGG + Intronic
1080540434 11:33258512-33258534 TCCCGCCGCCGCTGGGGACGCGG - Intronic
1080802139 11:35618783-35618805 CGGGGCCGCCGCTCCGGGCCGGG - Exonic
1081673905 11:44957266-44957288 CGCCGCGGGTGCTGGGGGCTCGG + Intergenic
1081705682 11:45180930-45180952 CGCCGCCGGCTTTGGGGCCCCGG + Intronic
1081709995 11:45210341-45210363 CGCCTCGGCCGCTGGGGCCCTGG - Intronic
1081925749 11:46826820-46826842 CGCCGCCGCCGCCGCCTGCCGGG - Intronic
1083160804 11:60852998-60853020 CACCGCGGCCGCCGGCGGCCAGG - Exonic
1083272872 11:61580882-61580904 CGCCGCCGCCGCTGGGCATGGGG + Intronic
1083396772 11:62398050-62398072 CACCACAGGCGCTGGGGGCCAGG + Intergenic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083617966 11:64035779-64035801 CGCCGCCGCCGCGAGGGGAGAGG + Intronic
1083920856 11:65780888-65780910 TACCGCCGGCGCCGGGGGCCGGG - Intergenic
1084129032 11:67119336-67119358 CGCCGCCGCCGCTGCCGGGGAGG - Intronic
1084174293 11:67415609-67415631 CGCCGCCCCCGCTGGGCACTGGG + Intronic
1084178593 11:67435756-67435778 CGCCAGGGCAGCTGGGGGCCAGG - Exonic
1084546846 11:69818946-69818968 AGCCGCCGCCGCCGCGGGGCGGG - Exonic
1084893763 11:72250605-72250627 CGCCGCTGCCTCTTGGGCCCTGG - Intergenic
1084973034 11:72781709-72781731 CGCCGCCGCCGCAGCTGCCCGGG + Intronic
1085208099 11:74749162-74749184 CGCCGCCGACGCGGCGGGCCCGG + Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1088172954 11:107018252-107018274 CGCCGCCGCACCTTGGGGCCCGG + Exonic
1088462111 11:110093101-110093123 CGCGGCCGCCGCTAGGGCGCGGG - Intergenic
1089307928 11:117538437-117538459 CGCAGGAGGCGCTGGGGGCCCGG - Intronic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1090198777 11:124839413-124839435 CGCGGCCGGGGCTGGGGGCGGGG + Intergenic
1091381884 12:67134-67156 TGCCGCCGCCGCCAGGGCCCAGG + Exonic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091712653 12:2752863-2752885 CACCGTTGCCACTGGGGGCCAGG - Intergenic
1092727682 12:11500720-11500742 CGCCGCCACCGCCGGGGCCCAGG + Intronic
1094375404 12:29783757-29783779 CGCCGCCGCCGCTGCTGCCCTGG + Exonic
1096192641 12:49630564-49630586 GGCAGGCGCTGCTGGGGGCCGGG - Exonic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096365485 12:51025886-51025908 CGTCGGCGCCGCAGGGGGCCGGG - Intronic
1096654439 12:53079599-53079621 CGCGGACGCTGCTGGGTGCCTGG + Intergenic
1096675481 12:53223485-53223507 AGCCGCCGCCGCCAGGGCCCAGG - Intronic
1096981077 12:55728561-55728583 CCCCGCCGCCTCTGGGGCCCAGG + Intronic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097019090 12:56007545-56007567 CACCGCCGCCTCTGAGCGCCCGG + Intergenic
1097107671 12:56634956-56634978 CGCCGCCGCCGCCTGCGGCCCGG - Intronic
1097190391 12:57216784-57216806 CGGAGCCGGCGCTGGGGGCGGGG - Exonic
1097264414 12:57737508-57737530 CGCCGCCGCCGCCGGGGGAGGGG - Exonic
1097929626 12:65169829-65169851 CGCCGCCGCCGCTGGTCCCGCGG - Exonic
1099989765 12:89709325-89709347 CGCCGCCGCCGCTGCCGCCTTGG + Intergenic
1100444820 12:94650585-94650607 CGCCGCCGCCGCCGCGGGGTGGG + Intergenic
1100565623 12:95790909-95790931 CGCCGCTGCCGCTGCCGCCCGGG + Intronic
1100869443 12:98894981-98895003 CGCCGCCGCCGCTGCCGCCAGGG - Intronic
1102025972 12:109714501-109714523 CTCCGCCCGCGCTGGGAGCCCGG - Exonic
1102648755 12:114421448-114421470 CTCTGCCCCCGATGGGGGCCAGG - Intergenic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103433023 12:120904098-120904120 CGCCGCCGCCGCCGCGGGTGAGG - Exonic
1103474803 12:121210425-121210447 CGGCGCGGCGGCTGGGGCCCAGG - Intronic
1103509923 12:121467259-121467281 CGCCGCCGCCGCCGCCCGCCCGG + Intronic
1103604883 12:122079023-122079045 CGCCACCGCCGCCTCGGGCCGGG + Exonic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1104568087 12:129903231-129903253 CGCCGCGGCCGCCAGGGCCCGGG - Intronic
1105472066 13:20703731-20703753 CGCCGCCGCCGCCCCGAGCCGGG - Intronic
1106340243 13:28820240-28820262 CGCCGCCCCCGCTCGAGGGCCGG - Intergenic
1106517147 13:30465330-30465352 GGCCGCCGCCGCAGCGAGCCGGG - Intronic
1108478499 13:50843644-50843666 CATCGCCTCCGCTGGCGGCCCGG + Exonic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1110450686 13:75635782-75635804 CCCGGCCGCCGCAGGGGGCGGGG + Intronic
1110630187 13:77698180-77698202 CGCCGCGGCCTCAGGGGGCCTGG + Intronic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1113378534 13:109784448-109784470 CGCCGCCGCCGTCTCGGGCCGGG + Exonic
1113546182 13:111153298-111153320 CACCGCCGCCTCTTGGCGCCAGG - Intronic
1113811243 13:113143903-113143925 CCCCGCTGCTGCTGGTGGCCTGG - Exonic
1114866202 14:26598007-26598029 CGCCGCCGCCGCTGCCGGAGCGG + Intergenic
1115320878 14:32077561-32077583 CGCGGCCGCCGAGGGGAGCCTGG + Intronic
1116905087 14:50396634-50396656 CGCCGCCTCCGCGGGGAGCCGGG - Intronic
1117690391 14:58299346-58299368 CGCTGCCGCCACCGCGGGCCCGG + Intronic
1118186539 14:63543127-63543149 CGCCGCCGCCGCCGGGTCCGGGG - Exonic
1118849476 14:69573079-69573101 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1119260902 14:73237620-73237642 GGTCCCCGCCGCTGGGCGCCCGG - Intronic
1119290506 14:73491499-73491521 CGACGCCGTCGCAGGGGCCCCGG - Exonic
1119807161 14:77489681-77489703 TGCAGCCTCCGCTGGGTGCCAGG - Intronic
1120168030 14:81220940-81220962 CGCCGCCGCCGCCGAGAGACAGG + Intronic
1121352406 14:93184438-93184460 TGGCGTCGCCGCTGGGGGCAGGG - Intronic
1122075377 14:99231808-99231830 GGACCCCGCCTCTGGGGGCCTGG + Intronic
1122389001 14:101367735-101367757 AGCCCCCGCTGCTGGGAGCCAGG + Intergenic
1122418449 14:101561226-101561248 AGCCGCTGCCGCTGGGGACCGGG - Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122601455 14:102923784-102923806 CGCCGCCGGCGCACGGGGTCCGG - Exonic
1122883711 14:104701282-104701304 CCCCGCCTGCGCTGGTGGCCAGG + Intronic
1122889068 14:104724297-104724319 CGCCGCCTGCGCCGGGGGGCCGG - Intronic
1122904514 14:104795631-104795653 TGCCGCCGCCGCTCGGTGCCCGG + Intronic
1122975303 14:105168465-105168487 CGGCGCGGCGGCTGGGAGCCGGG - Exonic
1122987139 14:105217665-105217687 CGCCGGCGCTGCTGAGGCCCCGG + Exonic
1124500957 15:30225780-30225802 CGAGGCCGCCGCCGGGGGCAGGG - Intergenic
1124742613 15:32312887-32312909 CGAGGCCGCCGCCGGGGGCAGGG + Intergenic
1125300902 15:38252689-38252711 CGCCGCCGCTGCCCGGAGCCTGG + Exonic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1125677856 15:41512067-41512089 CGGCGCCGGCGCCGGGGGCGAGG - Intronic
1126034924 15:44537036-44537058 CGCCGCCGCCTGAGGGGGCGTGG + Exonic
1126436713 15:48645113-48645135 GGCTGCTGCCGCCGGGGGCCTGG - Intronic
1126649734 15:50908697-50908719 CCCGGCCGCCGCTGCCGGCCCGG - Exonic
1127144081 15:56007186-56007208 CGCCGCCGCCGCCCGGATCCTGG - Intergenic
1127753432 15:62068003-62068025 CGCCGCCGTAGGTGTGGGCCCGG - Exonic
1127763628 15:62164588-62164610 CGCCGCCGCAGCTGTGGGCCCGG + Exonic
1128028573 15:64460584-64460606 CGCCGCCGCCGCCGCGATCCGGG - Intergenic
1128354016 15:66911694-66911716 AGCTGGAGCCGCTGGGGGCCTGG + Intergenic
1129115202 15:73361771-73361793 AGCAGCCGCCCCTGGGGGCTGGG - Intronic
1129144231 15:73633060-73633082 CGCCGGGGCCGGAGGGGGCCCGG - Intronic
1129299418 15:74616594-74616616 CTCCGCCTCTGATGGGGGCCTGG - Intronic
1129675985 15:77632647-77632669 CGCCTCTGCCGCTGGGGCCGGGG + Intronic
1131171929 15:90184965-90184987 CGGCGCAGCCCCTGGGGACCCGG - Intronic
1131833653 15:96369651-96369673 CGACCCTGCCGCTGAGGGCCAGG - Intergenic
1132251968 15:100341298-100341320 CGTCGCCGCCGTCGGGGCCCGGG + Exonic
1132255571 15:100373478-100373500 CGCCGCCGCCGCGCCTGGCCGGG - Intergenic
1132398237 15:101489580-101489602 CGCCGCGGGCGCGGGGGGCGCGG - Exonic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1132683349 16:1152753-1152775 CGCCCCCGCAGTTGGGGGCAGGG + Intergenic
1132857509 16:2053388-2053410 CGGAGCGGCCGCTGGAGGCCCGG + Exonic
1132877964 16:2148670-2148692 CGCCGCCGCCGCCAGGGGAAGGG + Exonic
1133020549 16:2964993-2965015 CCCCACGGCCGCTGGGGGCTGGG + Exonic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1135821887 16:25692388-25692410 CGCCGCCGCCGCCGCGAGCCGGG + Exonic
1136141853 16:28293261-28293283 GGACGCCGCGGCAGGGGGCCTGG - Exonic
1136153678 16:28368186-28368208 CGAGGCCGCCGCCGGGGGCAGGG - Intergenic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1136546534 16:30958019-30958041 CGCCGCCACCGCTGCGGGGCCGG + Intronic
1136683936 16:31983319-31983341 GGCCTCCTCCTCTGGGGGCCTGG + Intergenic
1136784563 16:32926871-32926893 GGCCTCCTCCTCTGGGGGCCTGG + Intergenic
1136885220 16:33926935-33926957 GGCCTCCTCCTCTGGGGGCCTGG - Intergenic
1137261121 16:46830956-46830978 CGCCGCCGCCGGCGGGCCCCAGG + Intronic
1137426442 16:48384966-48384988 CGCCCCCGCCCCTGGAGCCCCGG - Intronic
1137988718 16:53131323-53131345 CGCCGCCGCCGCTGCTCGGCCGG + Intronic
1138327881 16:56191091-56191113 CGCCGCCGGCGCGTGGGGCGGGG + Intergenic
1138360751 16:56425442-56425464 CGCCGCCGCCGCGCCGGGCCGGG + Exonic
1138360805 16:56425614-56425636 CGGCGCGACCGCTGGGGGCGGGG - Intergenic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139371085 16:66469872-66469894 CGCCGCCCACCCTGGGGCCCTGG + Exonic
1140454213 16:75095418-75095440 CGCCGTCTCCGCTTGGGACCAGG + Intronic
1141054616 16:80804017-80804039 CGCCGCCGCCGCCGCGGGCTCGG + Intronic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141608590 16:85169273-85169295 CGCCGCCGCCGCCGCGTTCCGGG + Intergenic
1141608608 16:85169325-85169347 CGCCGCCGCCGGGGGGTGCTCGG + Intergenic
1141682619 16:85553371-85553393 GGCCGCCGGCGCCGAGGGCCTGG + Intergenic
1141719770 16:85749930-85749952 CGCCCCCACCGCTGGGGACCCGG - Intronic
1142246116 16:88970829-88970851 TGCAGCCGACGCTGGGGGCCGGG + Intronic
1142262171 16:89048138-89048160 GGCCGGCGCTGCTGGGGGCCAGG + Intergenic
1142395345 16:89828556-89828578 CGCCGCCGCAGCTGCCCGCCCGG - Exonic
1203087222 16_KI270728v1_random:1190877-1190899 GGCCTCCTCCTCTGGGGGCCTGG + Intergenic
1142627859 17:1203617-1203639 CGCCGCCGCTGCGAGGAGCCCGG + Intronic
1142811796 17:2399017-2399039 TGCCGCCGCCGCGGCGGGCGGGG - Intronic
1143030309 17:3963984-3964006 CGGCGCCGGGGCTGGGGGCTGGG - Intronic
1143036623 17:4003340-4003362 TGCAGCCGTGGCTGGGGGCCGGG + Intergenic
1143499458 17:7330358-7330380 CGCCCCCACCGCTGCCGGCCGGG - Intergenic
1143724034 17:8833147-8833169 CTCCGCTGCCCCTGGGGGCCCGG + Intronic
1143742582 17:8965417-8965439 CGCTGCCCCCGCGGTGGGCCAGG + Intronic
1144340886 17:14309562-14309584 CGCCCCCGCCGGTGTTGGCCTGG + Intronic
1144682746 17:17206238-17206260 GGCCGCGGCGGCTGTGGGCCTGG - Exonic
1145163087 17:20589072-20589094 CGTGACCCCCGCTGGGGGCCGGG + Intergenic
1145925655 17:28644952-28644974 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1146183037 17:30709330-30709352 CGCCGCCGTCGGAGGGGGCTGGG + Intergenic
1147134883 17:38428831-38428853 CTGCCCAGCCGCTGGGGGCCTGG - Intronic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147971015 17:44219175-44219197 CGCCGCCCCCTCCGGCGGCCGGG + Intronic
1148262241 17:46193556-46193578 CGCCGCCCCCGCGGGCCGCCAGG + Intronic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1148698631 17:49575659-49575681 CGCCGCCGCCGCCGGTGGGAGGG + Intergenic
1148787200 17:50151115-50151137 CGCAGCCGCCGCTGGGGGACTGG + Intergenic
1148849794 17:50549039-50549061 CCCCGCCGCTGCTGGTGGCCTGG - Exonic
1149294415 17:55249060-55249082 GGCAGCAGCCGCTGGGGGCTGGG - Intergenic
1149678499 17:58487738-58487760 CGCCGCCGCCCGCGGGGCCCCGG - Exonic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150624819 17:66835082-66835104 CGCCGCCGCAGCTCGCGCCCCGG - Intergenic
1152049144 17:77958956-77958978 CGCCGCCGCCGCCTAGGACCCGG + Intergenic
1152240206 17:79157034-79157056 CTCAGCCGCTGCTGTGGGCCAGG + Intronic
1152436273 17:80278301-80278323 CGCCTCCGCCTCTAGGGGCTTGG + Intronic
1152687769 17:81703061-81703083 CGACGGCGGCACTGGGGGCCCGG + Intronic
1153238923 18:3013379-3013401 CGCCCCCGCCGCCGAGCGCCAGG + Intergenic
1155007507 18:21741525-21741547 CGCCGCCGCCGCTGCCGCCGGGG - Exonic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1155257880 18:24014517-24014539 GGCGGCCGCCGCTCGGGGACCGG + Intronic
1155443280 18:25884365-25884387 TGCCGCTGCTGCTGGGGGCTGGG - Intergenic
1155928810 18:31685100-31685122 CGCGGCGGCCGCGGGGCGCCGGG - Intronic
1157095099 18:44680204-44680226 CGCCGCCGCCTCCGCGCGCCCGG + Intronic
1157545201 18:48541383-48541405 CGCCGCCGCTGCTGGAGCCAGGG + Intronic
1157794103 18:50559625-50559647 GGCTGCAGCCGCCGGGGGCCCGG - Intergenic
1158954699 18:62526615-62526637 CGCCGCCGCCGCCGCGCACCCGG + Intronic
1160719059 19:589741-589763 CGCCGCCTCCGCTCGGCGCCGGG - Intergenic
1160725624 19:616690-616712 CGAGGCCGCCGCCGGGGGCAGGG - Exonic
1160830773 19:1104137-1104159 CGCCGCGGCCGTTGCCGGCCCGG + Intronic
1160960605 19:1719048-1719070 TGCCGCCGCCGCAGCGGGGCTGG + Intergenic
1161059755 19:2209082-2209104 CCCTGCCGCCCCTCGGGGCCCGG + Intronic
1161241159 19:3224704-3224726 CGCCGCCGCCGCCGCCGGCTCGG + Exonic
1161422599 19:4184160-4184182 GGCGGCCGCCCCAGGGGGCCGGG - Intronic
1161453598 19:4359717-4359739 CACCGCTGCCCCTGGGAGCCAGG + Intronic
1161513201 19:4683061-4683083 CCCCGCCGCCGCAGAGGGCCGGG + Intronic
1161703248 19:5805944-5805966 CGCCGCCGCCGCCGGGGACACGG + Intergenic
1161799880 19:6411726-6411748 CGATGACGACGCTGGGGGCCTGG - Intergenic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162246617 19:9406856-9406878 CACCTGCGCCGCTGGGGGCTTGG - Intergenic
1162731778 19:12722476-12722498 CGCCGCTGCTGCCCGGGGCCGGG - Intronic
1163154469 19:15432486-15432508 CGCCACCGCCGCCGCGGGACGGG - Intronic
1163577279 19:18118126-18118148 CGCCGCAGCCGCCCGAGGCCGGG - Intronic
1163655668 19:18543527-18543549 GGCGGCCGCGGCTGGGGGCGGGG - Exonic
1163743896 19:19033493-19033515 CGCCGCCGCCGCGCGAGGCGGGG + Intronic
1164722797 19:30444555-30444577 CGCCACCGCCGTTGGGGCCCTGG - Exonic
1164834726 19:31349766-31349788 CGCAGCCGCCGCCGCGGCCCGGG + Intergenic
1164834729 19:31349772-31349794 CGCCGCCGCGGCCCGGGGCTCGG + Intergenic
1165333379 19:35153889-35153911 CGCCGCCGCCACCAGGGGCTGGG - Exonic
1165349792 19:35269313-35269335 CGCCGCCGAGGCCGGGGGCCGGG - Intronic
1165772867 19:38388771-38388793 CGTCGCCGCCGCTCGGAGCCCGG + Intronic
1165938314 19:39402933-39402955 CCCGGCCGCCGCTGGGGCCGCGG + Intergenic
1165943680 19:39428611-39428633 TTCCGACGCCGCTGGGAGCCTGG - Intergenic
1166100359 19:40567979-40568001 CTCCGCCGCCGCGGGGGTCGCGG - Exonic
1166218464 19:41351492-41351514 CCCCGCCTCCGCCGGGGGCATGG + Intronic
1166367456 19:42284604-42284626 GGCCGTCGCCGCTTGGGCCCGGG - Intronic
1166749665 19:45158893-45158915 AGCCGCTGCCGCAGGGGGCTGGG + Exonic
1166782884 19:45351552-45351574 CACCACCGCCGCTGGGAACCAGG + Exonic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167557120 19:50203532-50203554 CGGCCCCGCCCCTGGGGGACGGG - Intronic
1167696628 19:51019085-51019107 CTCCGCCGCCTCTGGCGCCCGGG - Exonic
1168253384 19:55154093-55154115 TGCAGGCGCTGCTGGGGGCCCGG - Exonic
926217096 2:10912351-10912373 CGCCGCTGCCGCTGGGGGTCCGG - Exonic
926581438 2:14634969-14634991 CGCGTCCGCCGCCGGTGGCCCGG + Exonic
926724019 2:15983637-15983659 CACCTCCCCCGCTGGGGTCCTGG + Intergenic
927698286 2:25252065-25252087 CGCCGCGGCTGCTGCGGGCCGGG + Intronic
927714046 2:25341433-25341455 CGCCGCTGCCGCAGGGGCCCCGG - Intronic
928964874 2:36966491-36966513 TGCCTCCGCTGCTGGGCGCCGGG - Intergenic
931253503 2:60552413-60552435 CGCCGCCGCCGCCGAAGGGCAGG - Intronic
931602531 2:64019028-64019050 GGCCGCCGCCGCCCGGCGCCCGG + Exonic
931671606 2:64653474-64653496 CGCCGCCGCGGGAGGGAGCCGGG - Intronic
932345883 2:70994884-70994906 CGCCGCCGCCGAGAGGAGCCCGG + Exonic
932599299 2:73112879-73112901 CGCCGCCGCAGCTGCGGGCTGGG + Exonic
932725802 2:74178783-74178805 GGCCGCCGCCGCTCGGAGCCGGG + Exonic
933491028 2:82985845-82985867 AGCCGCCTCCCCTGGGGGCAGGG - Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
934993307 2:98936304-98936326 CGCCGCCTCCGCAGCTGGCCCGG + Intergenic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
935622819 2:105144078-105144100 AGCCGCAGCTGCCGGGGGCCGGG - Intergenic
935746510 2:106194084-106194106 CCCCGGCGCCGCGGTGGGCCGGG - Intronic
937917692 2:127107009-127107031 CGCGGCCGGGGCTGGGGGCTGGG - Exonic
940640760 2:156342379-156342401 TGCCGCAGCCGCCGGGGGCCGGG - Intergenic
941367086 2:164621745-164621767 CCCCGGCGCCGCTGGAGGCGGGG + Exonic
941476152 2:165953809-165953831 CGCCCCTCCCGCTGGGGCCCGGG - Exonic
942046519 2:172102301-172102323 CGCCGCCGCCGCCGCCCGCCGGG + Exonic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942453544 2:176123019-176123041 CGCCGCCGCTGCCGGGGGCTGGG - Exonic
942464000 2:176189092-176189114 TGCCGCGGCAGCTGGGGGCGCGG + Exonic
943060675 2:183038571-183038593 CGCCGCCGCCGCTCTGGCCCTGG + Exonic
943185162 2:184598306-184598328 CGCCGCTGCCGCAGAGGGCCGGG - Intergenic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
944675846 2:202033872-202033894 CGCCGCCGCCGCCGCCCGCCGGG - Intergenic
945699480 2:213152038-213152060 CCCCGCCCCCGACGGGGGCCAGG + Intronic
946397037 2:219448417-219448439 CGCCGGCGCCCCTGCGGCCCTGG + Exonic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
947218085 2:227767696-227767718 CTCCGTCACCGCTGGGGTCCTGG - Intergenic
947636012 2:231681083-231681105 CCGGGCCGCCGCTGGGGGCTCGG + Intergenic
947815688 2:233034752-233034774 CCCAGCCCCCGCTCGGGGCCTGG + Exonic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
948496659 2:238354501-238354523 AGCCGCTGCTGCTGGGAGCCAGG - Intronic
948836409 2:240628189-240628211 GGCAGCCCCCGCTGGGGGCCAGG - Intronic
1169132552 20:3173595-3173617 TGCCGCAGCCGCTGGTGGGCGGG - Intergenic
1169171827 20:3471349-3471371 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1171779664 20:29408059-29408081 TCCCGCCGTCGCCGGGGGCCAGG - Intergenic
1171908824 20:30922189-30922211 CGCCGCCCCTGGTGGCGGCCCGG + Intergenic
1172100887 20:32483549-32483571 CGCTGCCGCCGCTGCTCGCCTGG - Intronic
1172587269 20:36093477-36093499 CGCCGCCGCCGCTGGGAGCTGGG + Intronic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1172654369 20:36528006-36528028 CGCCGCCGCCGCTGGCTCTCGGG + Exonic
1173166205 20:40688864-40688886 CGCAGCCGCCGCTGCCGCCCGGG + Exonic
1173454158 20:43189991-43190013 CGCCGCCGCCGCCGCCCGCCCGG + Intergenic
1173672872 20:44810292-44810314 CGCCGCCGCCGCCGCGGCCGAGG - Intronic
1174386805 20:50192144-50192166 TGCCGGCGCCGCCGGGGGCGGGG - Exonic
1174417844 20:50379295-50379317 TTCCGGGGCCGCTGGGGGCCTGG - Intergenic
1174494729 20:50931307-50931329 CGCCGCCGCCTCCGCCGGCCCGG - Intergenic
1175268711 20:57718770-57718792 AGCCGCCGCCGCTGCAGCCCCGG - Intergenic
1175399482 20:58692601-58692623 GGGCGGCGCCGCTGGAGGCCGGG + Exonic
1175540466 20:59744595-59744617 CGCCTCCCCTGCTGTGGGCCTGG - Intronic
1175847007 20:62064803-62064825 CGCAGCCGCCGCGCCGGGCCCGG + Exonic
1176185169 20:63774488-63774510 CACCTCCGCGGCTGGGGTCCAGG - Intronic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176283318 20:64327699-64327721 TGCCGCCGCCGCCAGGGCCCAGG - Intergenic
1176380510 21:6110394-6110416 CGCCAGCGCCGCTGAGGGCCGGG + Intergenic
1176550059 21:8217092-8217114 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176568986 21:8400127-8400149 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176576900 21:8444362-8444384 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1178334712 21:31732443-31732465 CGCCGCCCCCGCCGGGTGCAGGG - Intergenic
1178922591 21:36748123-36748145 CGCCGCAGCCCCGGGAGGCCGGG - Exonic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1178992502 21:37367304-37367326 AGCAGCCGCCGCTCGGCGCCCGG + Intronic
1179052086 21:37896789-37896811 CTCCGCTGCCTCTGGGGCCCGGG - Intronic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1179742962 21:43427846-43427868 CGCCAGCGCCGCTGAGGGCCGGG - Intergenic
1179784863 21:43723824-43723846 AGCCGCCGAGGCTGGGTGCCAGG + Intronic
1180064337 21:45405132-45405154 AGCCGCCGCCGCTGGGAGGCCGG - Intronic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1181017706 22:20080562-20080584 CGCCTCCGGGGCTGGGGGGCGGG + Intronic
1181085126 22:20436392-20436414 CGCCGCCGCCGCTGCATTCCTGG + Intronic
1181478095 22:23180839-23180861 CGCCGCCGCCGCGCGGGCCATGG + Exonic
1181572031 22:23772944-23772966 AGCCGCCGCCGCTGCTGGCCCGG + Exonic
1182226176 22:28800431-28800453 CGCCTCCGCCGCCGGAGCCCCGG - Exonic
1182429012 22:30289373-30289395 CGCCGCAGCCGGTGCGCGCCCGG - Exonic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183486387 22:38089462-38089484 CGCCGCCCCCCGCGGGGGCCCGG - Intronic
1183665586 22:39244145-39244167 CGGCTCCGTCGCTGGGGGGCAGG + Exonic
1183702166 22:39457106-39457128 CTCCGCCGCCGCGCCGGGCCGGG - Intergenic
1184766972 22:46577181-46577203 CCCCGGCGCCGCTGGGCTCCCGG + Intronic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1184786158 22:46673003-46673025 CATCCCCGCAGCTGGGGGCCGGG - Intronic
1184807323 22:46803460-46803482 CGCCTCAGCTCCTGGGGGCCGGG - Intronic
1184863431 22:47189713-47189735 CGCAGCCCCTCCTGGGGGCCGGG + Intergenic
1184889276 22:47369564-47369586 GGCCTCTGCCGCTGGGGCCCTGG - Intergenic
1185055261 22:48575859-48575881 CACCGCCGCCGCGGCGGGCCAGG - Intronic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185313760 22:50170295-50170317 CGCCGCCCGCGCTCCGGGCCGGG + Intergenic
1185313821 22:50170427-50170449 CGCCGCCGCCCCCGGGGTCAGGG - Intergenic
1185316172 22:50180138-50180160 CTCAGCCGCGGCGGGGGGCCCGG - Exonic
1185331363 22:50253425-50253447 CTCCCCGGCAGCTGGGGGCCAGG - Exonic
1203254949 22_KI270733v1_random:133418-133440 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203263005 22_KI270733v1_random:178497-178519 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
949970248 3:9397678-9397700 CGCCGCCGCTGCCGGGGGAGGGG + Intronic
950316395 3:12004941-12004963 CGCCGCCGCCCTCGGGGGTCGGG + Intronic
950534458 3:13571110-13571132 GGCAGCAGCCGCTGTGGGCCTGG - Exonic
951217767 3:20040603-20040625 CGCCGCTGCCGCCGGGGGCTCGG + Exonic
951613950 3:24521824-24521846 CGCCGCAGCCGCTGGAGCCTTGG + Intergenic
951717483 3:25664604-25664626 CGCGGGCGCCGCTGCAGGCCGGG + Intronic
952167027 3:30761408-30761430 CGCCACCGACACTGGGTGCCTGG - Intronic
952241225 3:31532941-31532963 CGCCGCCGCCGCCTGGTGCGAGG - Exonic
954717407 3:52533560-52533582 CGGCGCCGCTGGTGGGTGCCTGG + Exonic
956978972 3:74614603-74614625 CGCCGCCGCCGCCAAGCGCCAGG + Intergenic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
960577076 3:119240588-119240610 CGCCGCCTCTGCTGCGGGCCGGG - Exonic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
960925972 3:122795224-122795246 GGCAGCCGCTGCTGGGGCCCGGG + Exonic
961202401 3:125055578-125055600 CGCTCCCGCCTCTGGGGGCCCGG + Exonic
961355015 3:126332098-126332120 AGGCGCCACCGCTGGGGGCAGGG + Intergenic
961827257 3:129605652-129605674 CGCCGCCGGCGCCGTGGGGCAGG + Exonic
963503913 3:146161272-146161294 ACCCGCCGCCGCTGCGCGCCCGG + Intronic
964570789 3:158105835-158105857 CGCCGCCTCCGCCGGCCGCCCGG + Exonic
966732553 3:183162858-183162880 CGGCGCAGCCGCCGGGGCCCGGG + Exonic
967493775 3:190120985-190121007 CGCCGCTGCAGCGGGGAGCCTGG - Intronic
967924184 3:194633377-194633399 CGCCGCCGCCGCCCGCGCCCGGG - Exonic
968514415 4:1010271-1010293 CGCAGCCGCCGCTGTGCACCCGG - Intronic
968556643 4:1249174-1249196 CGCCGCCCGCGCTGGGAACCAGG - Intronic
969113952 4:4859989-4860011 CCGCGGCGGCGCTGGGGGCCTGG - Exonic
969360232 4:6658688-6658710 CGCCGCCCACGCGGGGCGCCGGG - Intergenic
969609277 4:8218000-8218022 CACCGCCACCCCTGTGGGCCTGG - Intronic
969715870 4:8867842-8867864 CGCAGCCGCCGCTGGGCCCCCGG - Exonic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
970333284 4:15004656-15004678 CGCCGGGGCCGCGGGCGGCCGGG + Intronic
971195638 4:24470536-24470558 CGGCGCTGGAGCTGGGGGCCTGG - Intergenic
971257901 4:25030790-25030812 TGCCGCCGCCGCTGCTGGCGAGG + Exonic
975166712 4:71186583-71186605 CGCCGCCTCCGCCGGGGGCTTGG - Intergenic
975701999 4:77075737-77075759 GGCCGCCGCCGCTCGAGCCCGGG + Exonic
975778959 4:77819604-77819626 CGCCGCCGCCGCCCGGACCCCGG - Intronic
975986117 4:80202701-80202723 CGCCGCCGCCGCCAGCGTCCTGG - Exonic
976629345 4:87220606-87220628 AGCCGCGGCCTCTGGGGGCGGGG + Exonic
979231503 4:118352908-118352930 CGCGGCCGCCGCCAGGGGACAGG - Exonic
980130062 4:128809965-128809987 CGCCGTCGCCGCCGCGGGACCGG - Intronic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
981530924 4:145752996-145753018 CGTGGCCGCTGCTGGGGGCTGGG + Intronic
981550606 4:145937751-145937773 CGCCGCTGCCGCCGGCGGCTCGG + Intronic
982157417 4:152535854-152535876 TGCAGCCGCCGCTGCCGGCCGGG + Exonic
983904362 4:173168974-173168996 CGCTGCCGCCGGAGGGGGCCGGG - Intronic
984462989 4:180059155-180059177 CGCCGCCGCGGCCGGGCGCAGGG - Intergenic
985011486 4:185587455-185587477 AGCCGCCGCTGCTGTGAGCCTGG - Exonic
985727595 5:1524109-1524131 GGCCGGGGCCGCTGGGGACCGGG + Intergenic
986721191 5:10563019-10563041 TGGCGCAGCCGCTGGGGACCAGG - Intergenic
987050760 5:14144767-14144789 AGGCGCCGCCGCTGGGGTACCGG - Intronic
988734654 5:34008107-34008129 CGGCGCCGCGGCTGGGGGCGTGG - Intronic
988825327 5:34929742-34929764 CGCCGCCGCCGCTTCGGCCCGGG + Exonic
988825346 5:34929783-34929805 GGCGGCCGGCGCTGGGGCCCGGG - Exonic
990308584 5:54517718-54517740 AGCCGCCGCCGGTCGGGGGCGGG - Intergenic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
991587355 5:68215086-68215108 CACCGCCGCCTCCGGGAGCCAGG - Intergenic
992530216 5:77645658-77645680 CGCTGCGCCCCCTGGGGGCCGGG - Intergenic
992627632 5:78649066-78649088 CGCCGCCGCCGCTGCCCGGCGGG - Intronic
992663743 5:78985414-78985436 CGCCACAGCAGCCGGGGGCCCGG - Exonic
993116159 5:83722248-83722270 CGCCGCCGCCGCTCGGGCTGTGG + Intergenic
995048173 5:107672470-107672492 CGCTGCTGCCGCTGCGGCCCGGG + Intergenic
995052738 5:107724771-107724793 GGCCGCCGCCGCCGGGGGCCGGG - Intergenic
995106327 5:108381292-108381314 CGCCGCCGCCGCTGCCGCCTCGG - Exonic
995650411 5:114362363-114362385 CGCCCCCGCCGCCGGGGCACCGG - Exonic
995735486 5:115296303-115296325 CGCCTCCCCTGCTCGGGGCCTGG - Intronic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997975422 5:138439131-138439153 CGCCGCCGCCGCTCGGCCTCAGG + Exonic
998134538 5:139667896-139667918 CACCGCAGCTGCTGGGGCCCTGG - Intronic
999062886 5:148654380-148654402 TGCCGCCCCCACTGGGCGCCAGG + Intronic
1000220521 5:159209541-159209563 CGCGGCCGCCGCAGAGCGCCGGG - Intronic
1000305022 5:159987074-159987096 CTCCCCCGCCGCTGGGGGCAGGG - Intergenic
1002784519 6:391662-391684 CGCCGAGGCCTGTGGGGGCCGGG - Intergenic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1003049356 6:2765821-2765843 AGCCGCCGCCTCTTGGCGCCGGG - Exonic
1003139173 6:3456800-3456822 AGCCGCGGCGGCTGAGGGCCCGG - Intronic
1003645414 6:7910248-7910270 GGGCGCCGCGGCTCGGGGCCGGG - Intronic
1003645535 6:7910648-7910670 CGCCGCCGCCTCCTGGGCCCGGG + Exonic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1005040345 6:21595191-21595213 CGCCGCCGCCGCCGCCTGCCAGG - Exonic
1005320199 6:24646054-24646076 CGCCGCCGCCGCTCTGCGCGGGG + Exonic
1005940475 6:30556273-30556295 AGCCCCCGCCGCAGGGGCCCGGG + Exonic
1005953501 6:30647798-30647820 CGCCGTCTCTGCTGGGGGCGTGG - Exonic
1006107799 6:31727229-31727251 CGCCCCCACAGCTGAGGGCCTGG - Exonic
1006137144 6:31902038-31902060 CGCCGCCGCCGCCGCGCGCGCGG - Intronic
1006472508 6:34236742-34236764 CGCCGCCGCCGCTGCCGCGCGGG - Intergenic
1007250651 6:40492699-40492721 CACCTCCTCTGCTGGGGGCCAGG + Intronic
1007473380 6:42104758-42104780 CTACGCCGGGGCTGGGGGCCTGG - Exonic
1007614332 6:43171514-43171536 CGCGGCCGCCGCTGCGAACCCGG - Exonic
1007788915 6:44297791-44297813 TGCCGCTGCCGCTGCGCGCCAGG + Intronic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1009437724 6:63636471-63636493 CCCCGCCGCCGCTGAGGCGCGGG + Intronic
1010379241 6:75206864-75206886 CGAAGCCTCCGCTCGGGGCCAGG - Intergenic
1011128741 6:84033713-84033735 CGCCGCCTCCGCTGCGGGTCGGG + Intergenic
1015148923 6:130018504-130018526 CGCCGCCGCCGCTGCCGGGGAGG - Exonic
1015525964 6:134175510-134175532 CGCCGGCCCCGCTGGGGGCTTGG - Intronic
1017311559 6:152982713-152982735 CGCTGCCGCCGCCCGAGGCCGGG + Intronic
1017446351 6:154510342-154510364 CCCCGCCGCCGCCGGGATCCCGG + Exonic
1017672410 6:156779287-156779309 CGCCGCCGCCGCCTGGGACTGGG - Exonic
1017842334 6:158232163-158232185 CACCGCCGCCGCCGCCGGCCCGG - Intergenic
1018686281 6:166307296-166307318 CGCGGCTGCCGCGCGGGGCCGGG - Exonic
1018945574 6:168345478-168345500 CGCCGCCTCCCCTGGGGGTGGGG + Intergenic
1019430668 7:997538-997560 CTCCTCCGGCGGTGGGGGCCGGG - Exonic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1019536129 7:1530785-1530807 CGCCGCCGCCGCCTGGCGCTCGG - Exonic
1019562585 7:1665936-1665958 CGCCGGCTCCGCTGGGCTCCGGG + Intergenic
1019883113 7:3880771-3880793 AGCCGCAGCCTCTGGAGGCCCGG - Intronic
1020111945 7:5452326-5452348 CCCAGCCGCTCCTGGGGGCCTGG + Intronic
1020275538 7:6622402-6622424 CGCCGCCGCCGCTGCCGTGCAGG - Exonic
1022285963 7:28956534-28956556 CGTCGCTGCCGCCGCGGGCCCGG - Exonic
1023810349 7:43906619-43906641 CGCGGCCGCGGCTCGGCGCCGGG + Exonic
1024579946 7:50793331-50793353 CGCCGGCGGCGCGGGGCGCCCGG - Intronic
1024963802 7:55004602-55004624 CGCCGCGGCCGCGGGGAGCAGGG + Intergenic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1026732753 7:72925568-72925590 CGCCGCCGCTCCGGAGGGCCAGG + Intronic
1028477158 7:91265071-91265093 CTCCGCTGCTGCTGGGGGTCCGG + Exonic
1029168943 7:98617494-98617516 CGCCGTGGCCGCTGGGGCCCAGG + Exonic
1029524234 7:101085496-101085518 GGCCGCCGTTGCTGGGTGCCTGG - Exonic
1029535277 7:101154337-101154359 CGCCGACGCCGCGGGGAGCGCGG - Intergenic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1031629852 7:124033039-124033061 CGCCGCCGCTGCCGGGTGCGCGG + Intergenic
1032525585 7:132576739-132576761 CGCCGCCGCTGCTCGGGCTCCGG - Exonic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1034129076 7:148699088-148699110 CGACACCGCGGCTCGGGGCCGGG - Intronic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034522628 7:151632327-151632349 CGCCGCCGCCGCAGGTGGCGCGG + Intronic
1034618022 7:152435854-152435876 CGCCGCCGCCGCTGCTGCTCGGG + Exonic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1035169567 7:157010041-157010063 CGCCGCCGCCGCCCGCGCCCAGG + Exonic
1036195271 8:6708499-6708521 CCGCGCCGCCGCCCGGGGCCGGG - Exonic
1036432327 8:8702376-8702398 CGCCGTCGGCGCGGCGGGCCGGG + Exonic
1036723693 8:11200968-11200990 CGCCGCCGCCGCAGGTGGAGCGG - Exonic
1036733238 8:11284570-11284592 CGCCGCTGCCGTTGGGCTCCGGG - Exonic
1036789502 8:11708672-11708694 CGCCGCCGCTGCCGCGGCCCGGG + Exonic
1037947736 8:22999728-22999750 GGCCGCCGCCGCTACGCGCCCGG - Intronic
1038429857 8:27491324-27491346 CGCCGCCGCCGCAGTGGGTCGGG + Intronic
1040850786 8:51898903-51898925 CGCCGCCGCCAGTGGGGGCTCGG - Intronic
1041690085 8:60679355-60679377 CGCCCCCGCCGCCGCCGGCCCGG - Intronic
1041690272 8:60680037-60680059 AGCTGCCGCCGCCGGCGGCCCGG - Intronic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1042532869 8:69833008-69833030 CGCCGCCGCCGCTGGGCCCGCGG + Exonic
1042785098 8:72537388-72537410 CGCCGCCGCCGCTGCGCCTCGGG + Exonic
1043053357 8:75407973-75407995 CTCCGCCGCCGCCCGGGGCCCGG + Intronic
1043502807 8:80873844-80873866 CGCCGCCGCCGCGCAGCGCCGGG - Intronic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1044599707 8:93991551-93991573 TGCCCCCGCCGCGGGGAGCCGGG - Intergenic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1045336270 8:101206186-101206208 CGCCGGGCTCGCTGGGGGCCGGG - Intronic
1045564365 8:103298796-103298818 CGCCGCCGCCGCCGCGAGCCCGG + Intronic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1048072991 8:131040799-131040821 CTCCGCGGCTGCAGGGGGCCTGG + Exonic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1048554032 8:135457770-135457792 GGTCCCCGCCGCTGGGGGCGCGG + Exonic
1049419579 8:142510843-142510865 CGGAGCCGCCGCTCGGGGGCCGG + Intronic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049668387 8:143858949-143858971 CGCCGCCGCCGCCCGCCGCCAGG - Exonic
1049669633 8:143863752-143863774 CGCCGCCGCCGCCCGCCGCCAGG - Exonic
1049670043 8:143865345-143865367 CGCCGCCGCCGCCCGCCGCCAGG - Exonic
1049711145 8:144063936-144063958 AGCTGCCGCCGCTGGCTGCCAGG - Intergenic
1049761049 8:144332166-144332188 GCCCGCCGACGCCGGGGGCCTGG - Exonic
1049762195 8:144336647-144336669 CGCCGCCGCCCCCGGGGGCATGG - Intergenic
1049784651 8:144444568-144444590 CGCCGCCGCCGTCGAGGGGCGGG - Intergenic
1049788577 8:144462775-144462797 CGCCGCCGCCTCAGTGGGCCCGG + Intronic
1053114611 9:35490123-35490145 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1053239999 9:36487625-36487647 CGCCACCGCTGCTGCCGGCCGGG - Intergenic
1054798675 9:69325549-69325571 CGCCGCTGCCGCCGCGGCCCCGG + Intronic
1055514729 9:77023211-77023233 CGGCGCCTCCGCTGGGGCCTGGG + Intergenic
1056386275 9:86099579-86099601 CGCCGGCGCTGCTCGGGGGCGGG - Intronic
1056992331 9:91423693-91423715 GGCCGCCGGCGCTCGGGGCTCGG + Exonic
1057488626 9:95506080-95506102 CGCCGCTGCCGCTGTCCGCCTGG - Intronic
1057489129 9:95508310-95508332 TGCCGCCGCCGCCGCGGTCCTGG + Exonic
1057489149 9:95508373-95508395 CGCCGCCGCCGCCGCGGGGACGG + Exonic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057533484 9:95875728-95875750 CGCCGCCGCCGGAGGAGGACAGG - Exonic
1057596226 9:96418040-96418062 GGCCGCCGGAGCTGGGGGTCGGG - Exonic
1057600089 9:96450255-96450277 CGCCGCGACCACTGCGGGCCCGG - Exonic
1057881526 9:98796300-98796322 TGCCCCCGCCGCTGCGGCCCCGG + Exonic
1057921997 9:99105178-99105200 CGCCGCCACCGCCTGTGGCCCGG - Exonic
1057997148 9:99828723-99828745 CGCAGCCGCCGCGGGCAGCCAGG + Exonic
1059375232 9:113876171-113876193 CGGCGCGGCCGGTGCGGGCCGGG + Intergenic
1059414796 9:114155976-114155998 CGCCGCCGCCGCTGTGCCTCGGG - Exonic
1059633944 9:116154357-116154379 CGCCGCCGCCGGGCGGTGCCTGG + Exonic
1059769782 9:117414623-117414645 CGCCGCCGCCGCCGCGTCCCCGG - Exonic
1060514604 9:124258048-124258070 CTCGGCTGCCGCTGGGGGACCGG - Exonic
1060629546 9:125143374-125143396 AGCCCCCGCACCTGGGGGCCAGG + Exonic
1060634561 9:125189734-125189756 CGCCGCCGCCGCTGTTGCCGCGG - Exonic
1060811706 9:126614158-126614180 AGCCGCCGCCGCCGGGTTCCGGG + Intergenic
1060970569 9:127735180-127735202 CGCGGCCGCCGCCTGGGACCTGG - Exonic
1061015869 9:127980632-127980654 CGCCCCCGCACCTGGGTGCCGGG + Intergenic
1061061006 9:128250556-128250578 CGTTGGCGCCGCTGGGGGCGGGG + Intronic
1061261398 9:129482708-129482730 CGCCGCCGCGGCGTGGGGGCGGG + Intergenic
1061449168 9:130659475-130659497 CTCCTCCGCCCCTGGGCGCCTGG + Intergenic
1061540738 9:131276925-131276947 CGCCGCGGCCGCCGAGGACCTGG + Intergenic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061802763 9:133121185-133121207 CGCCGCCCCCGCCGCGCGCCGGG - Intronic
1061841764 9:133362625-133362647 AGCCGCAGCCGCTGTGGGCAGGG - Exonic
1062022764 9:134326955-134326977 CGCGGCTGCAGCTGGGCGCCGGG - Intronic
1062076352 9:134592083-134592105 CGCCACCGCCTCTGGGTGCAGGG - Intergenic
1062442741 9:136578459-136578481 CGCCCCCACCGCTGTGGCCCAGG + Intergenic
1062472489 9:136712582-136712604 AGCGGCGGCCGCTGCGGGCCGGG + Exonic
1062562018 9:137145911-137145933 CGGCGCCGCGGGTGGGCGCCTGG + Intronic
1062611093 9:137373776-137373798 GACCACCGCCCCTGGGGGCCTGG - Intronic
1062612072 9:137379892-137379914 CACAGCTGCCACTGGGGGCCTGG - Intronic
1062626044 9:137441849-137441871 GGCCGCCGCCGTCGGGGTCCGGG + Intergenic
1203471351 Un_GL000220v1:116564-116586 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203479172 Un_GL000220v1:160536-160558 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1186496505 X:10015720-10015742 CCGCGCCGCCGCCGCGGGCCCGG + Exonic
1186660568 X:11664690-11664712 CGCAGCCGCCGATCAGGGCCGGG + Exonic
1186669939 X:11758157-11758179 CGCCGTGGCCGGGGGGGGCCGGG - Exonic
1189324042 X:40102456-40102478 CGACGCCGCCGCGCTGGGCCGGG + Intronic
1189325561 X:40109015-40109037 CGCCGCCGCCGCCGCGTTCCCGG - Intronic
1189821591 X:44873834-44873856 CGCCGCCTCCGCTGGGGCCTCGG + Intronic
1195138207 X:101931892-101931914 CGCCGCCGCCGCTGCCGCGCAGG + Intronic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1196214627 X:113035936-113035958 TGCCGCCACTGCTGGGGGACTGG + Intergenic
1196684026 X:118495708-118495730 CGCCGCCGACGCCGTGGGGCAGG + Intergenic
1196684069 X:118495886-118495908 GGCCGCGGCCGCCGCGGGCCGGG + Intronic
1197754474 X:129984232-129984254 CGCCGCCGCCGCTTCTGGGCGGG + Intronic
1198276379 X:135098619-135098641 CGCCGACGCCGCCATGGGCCCGG + Intergenic
1198310131 X:135422124-135422146 CGCCGACGCCGCCATGGGCCCGG - Intergenic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic
1200100986 X:153688975-153688997 CGCCGCTGCCGCTCGGTGGCCGG + Intronic
1200292483 X:154886325-154886347 CGCCGCCGCAGCTGGCGGGCGGG - Intronic
1200339327 X:155382065-155382087 CGCCGCCGCAGCTGGCGGGCGGG - Intergenic
1200347143 X:155458628-155458650 CGCCGCCGCAGCTGGCGGGCGGG + Exonic
1201291189 Y:12421578-12421600 CAAAGCCGGCGCTGGGGGCCCGG + Intergenic