ID: 1035169535

View in Genome Browser
Species Human (GRCh38)
Location 7:157009940-157009962
Sequence CAGGCCCCCAGCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 2, 3: 73, 4: 491}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035169517_1035169535 17 Left 1035169517 7:157009900-157009922 CCGCGCCGCCCTGCGCGCCCCCA 0: 1
1: 0
2: 7
3: 58
4: 506
Right 1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 73
4: 491
1035169515_1035169535 26 Left 1035169515 7:157009891-157009913 CCGGGAGGCCCGCGCCGCCCTGC 0: 1
1: 0
2: 5
3: 41
4: 375
Right 1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 73
4: 491
1035169520_1035169535 12 Left 1035169520 7:157009905-157009927 CCGCCCTGCGCGCCCCCAGGGTG 0: 1
1: 0
2: 0
3: 18
4: 270
Right 1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 73
4: 491
1035169516_1035169535 18 Left 1035169516 7:157009899-157009921 CCCGCGCCGCCCTGCGCGCCCCC 0: 1
1: 0
2: 16
3: 125
4: 908
Right 1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 73
4: 491
1035169522_1035169535 8 Left 1035169522 7:157009909-157009931 CCTGCGCGCCCCCAGGGTGCAGC 0: 1
1: 0
2: 0
3: 14
4: 197
Right 1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 73
4: 491
1035169523_1035169535 0 Left 1035169523 7:157009917-157009939 CCCCCAGGGTGCAGCCCCAGCGC 0: 1
1: 0
2: 2
3: 34
4: 383
Right 1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 73
4: 491
1035169526_1035169535 -3 Left 1035169526 7:157009920-157009942 CCAGGGTGCAGCCCCAGCGCCAG 0: 1
1: 0
2: 4
3: 47
4: 441
Right 1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 73
4: 491
1035169525_1035169535 -2 Left 1035169525 7:157009919-157009941 CCCAGGGTGCAGCCCCAGCGCCA 0: 1
1: 0
2: 2
3: 30
4: 303
Right 1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 73
4: 491
1035169521_1035169535 9 Left 1035169521 7:157009908-157009930 CCCTGCGCGCCCCCAGGGTGCAG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 73
4: 491
1035169524_1035169535 -1 Left 1035169524 7:157009918-157009940 CCCCAGGGTGCAGCCCCAGCGCC 0: 1
1: 0
2: 6
3: 50
4: 431
Right 1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 73
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035169535 Original CRISPR CAGGCCCCCAGCGGCGGCGG CGG Exonic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
902234274 1:15047782-15047804 AAGCCCCCCAGCTGCGGAGGTGG + Intronic
903153267 1:21428164-21428186 CAGGCCGCCCGCAGCGGCGCGGG - Intergenic
903376229 1:22867981-22868003 CAGGCCCCCAAAGGGGGTGGTGG + Intronic
903907378 1:26696420-26696442 CAGGCTGCTGGCGGCGGCGGGGG - Exonic
903907482 1:26696758-26696780 GAGCCGCCCGGCGGCGGCGGTGG + Exonic
904189978 1:28736403-28736425 CAAGCCCCTCGCGGGGGCGGGGG + Intergenic
904245077 1:29181786-29181808 CAGCCCCCCTTAGGCGGCGGCGG + Exonic
904245089 1:29181821-29181843 CACGGCGGCAGCGGCGGCGGCGG + Exonic
904641950 1:31937939-31937961 GAGGCCCCCGGCGCCGGCGCGGG + Intronic
904822948 1:33256817-33256839 CCGGCCCAGAGCGGCGGCGGCGG + Intronic
905179267 1:36156372-36156394 CGGGGTCTCAGCGGCGGCGGCGG - Exonic
905212688 1:36385564-36385586 CAGAGCCCCAGCGGAGGAGGGGG + Intronic
905369201 1:37474396-37474418 CCGGCGCGCAGCGGCCGCGGGGG + Intergenic
905857406 1:41323089-41323111 CTGGCCACCAGCGGCGGTGATGG - Intergenic
906204392 1:43979330-43979352 ATGGCCCGCGGCGGCGGCGGCGG + Intronic
906637012 1:47416485-47416507 CCGGCCCGGGGCGGCGGCGGCGG + Exonic
906960916 1:50419094-50419116 AGGCCCCCCGGCGGCGGCGGCGG + Exonic
907010632 1:50959896-50959918 TCGGCGCCCGGCGGCGGCGGCGG - Exonic
907053506 1:51345075-51345097 GCGGCCCCTCGCGGCGGCGGCGG + Exonic
907178890 1:52553021-52553043 CCGGCCTCCAGCGGCGGCAGCGG - Intronic
909352748 1:74673659-74673681 CGGGCGCCCAGGGGCGGCGGCGG - Exonic
912505092 1:110150761-110150783 CAGGCCCCCGGCTGGGGCTGGGG - Exonic
912508902 1:110175074-110175096 CAGGCCCCCAGAGGAGGGTGTGG + Intronic
913531875 1:119739312-119739334 CAGGCCCTCAGCCCCGGCAGTGG + Intronic
913959458 1:143327596-143327618 GAGGCGCGCAGCGGCGGCGCAGG + Intergenic
914053818 1:144153169-144153191 GAGGCGCGCAGCGGCGGCGCAGG + Intergenic
914125328 1:144813196-144813218 GAGGCGCGCAGCGGCGGCGCAGG - Intergenic
914808374 1:151008406-151008428 CCCGCCCCCAGCGGCGGAGGCGG - Intronic
916065507 1:161132646-161132668 CACGGCCGCGGCGGCGGCGGCGG - Exonic
916750914 1:167722110-167722132 CAGGGACGCGGCGGCGGCGGCGG + Exonic
919847039 1:201648810-201648832 AAGGCGCCCGGCGGCGGCGGCGG + Exonic
920541840 1:206784655-206784677 CATGGCCCCGGGGGCGGCGGGGG + Intergenic
920912610 1:210232827-210232849 CAGCGCCCCAGTCGCGGCGGCGG + Exonic
921266341 1:213423786-213423808 CAGGCCCAGAGGGGAGGCGGCGG + Intergenic
922163699 1:223097403-223097425 CAGGCCCCCATCAGGGGCTGGGG + Intergenic
922526539 1:226308800-226308822 CCGGCCCCCAGCCGAGGTGGAGG - Intronic
922766246 1:228158097-228158119 GTGGCCCCGGGCGGCGGCGGAGG - Exonic
923094003 1:230760614-230760636 CAGGCCTCCTGCGCCGGCTGGGG + Intronic
923141481 1:231163786-231163808 GGCGCCCCCAGCGGAGGCGGCGG + Exonic
1062801538 10:384877-384899 CAGGCCCCCAGGGAAGGAGGAGG + Intronic
1062904233 10:1169311-1169333 CAGGGTCCCAGCGGGGGTGGAGG + Intergenic
1063407661 10:5812918-5812940 CTTGCCCCCAGCGGAAGCGGAGG - Intronic
1063848710 10:10161037-10161059 CAGGCCAGCAGCTGCGGAGGGGG + Intergenic
1064075367 10:12264413-12264435 CAGGCCACGAGCAGGGGCGGGGG + Intergenic
1064208968 10:13347771-13347793 CCGGCCCCGCGCGGCGGCGGCGG + Intronic
1064553112 10:16521715-16521737 GGTGCGCCCAGCGGCGGCGGCGG + Exonic
1065342891 10:24723395-24723417 CGGGCGCCCGGCGGGGGCGGAGG - Intronic
1066022862 10:31319887-31319909 CAGGCGGGCTGCGGCGGCGGCGG + Intronic
1066429341 10:35336882-35336904 CGGGTCAGCAGCGGCGGCGGCGG - Exonic
1066986897 10:42475969-42475991 GAGGGCCCCAGCGGTGGGGGCGG + Intergenic
1067087810 10:43252128-43252150 CAGGCCCCCAGAAGCAGAGGGGG + Intronic
1067478099 10:46579244-46579266 CTGCACCCCAGCGGGGGCGGCGG - Intronic
1067616641 10:47762543-47762565 CTGCACCCCAGCGGGGGCGGCGG + Intergenic
1070694452 10:78551761-78551783 CAGGGCCCCAGGGGCTGCGGTGG + Intergenic
1070800838 10:79243565-79243587 CCGCGCCCCGGCGGCGGCGGCGG - Intronic
1071291836 10:84194497-84194519 CAGGCTCCCAGCCGCGGGCGGGG - Intergenic
1071611006 10:87031200-87031222 CAGGCCAGCAGCTGCGGAGGGGG - Intergenic
1073414234 10:103368113-103368135 AACGGCCCCAACGGCGGCGGCGG + Exonic
1074169719 10:110919951-110919973 CGGGCCTGCGGCGGCGGCGGCGG + Intronic
1074780553 10:116799040-116799062 CAGGCCCCCAAGGGTGGCAGGGG - Intergenic
1074865727 10:117543434-117543456 GACGCCCCTACCGGCGGCGGCGG - Exonic
1075207076 10:120457177-120457199 CAGGCCGCGGGCGGGGGCGGAGG - Exonic
1075748521 10:124744340-124744362 CAGGCGGCGTGCGGCGGCGGCGG + Intronic
1076355110 10:129846972-129846994 CAGGCCCCCAGCCGCCCTGGGGG + Intronic
1076554206 10:131311514-131311536 CAGACCCAGGGCGGCGGCGGCGG + Exonic
1076747164 10:132520178-132520200 GAGGCCCCCAGGGGCTGCAGTGG - Intergenic
1076994933 11:293267-293289 CAGGTCTCCAGCTGGGGCGGGGG - Intronic
1077217932 11:1402806-1402828 CAGGCCCCCAGCAGAGGAGGCGG + Intronic
1077325648 11:1962887-1962909 CAGGGCCCCAGCGTCCACGGAGG - Intronic
1077962463 11:7089625-7089647 CCGGCTCGCAGCAGCGGCGGTGG + Exonic
1078753963 11:14191185-14191207 CAGGCCACCAGAGGCAGCAGCGG - Intronic
1078801155 11:14644636-14644658 CACGCCCCCGGAGGCGGCAGCGG + Exonic
1079689407 11:23403539-23403561 CCGTCCCGCGGCGGCGGCGGCGG - Intergenic
1081709996 11:45210342-45210364 CAGGGCCCCAGCGGCCGAGGCGG + Intronic
1082986079 11:59172356-59172378 GCGGACCCCGGCGGCGGCGGCGG + Intronic
1083396771 11:62398049-62398071 CTGGCCCCCAGCGCCTGTGGTGG - Intergenic
1083595547 11:63916960-63916982 CGGGGCACCGGCGGCGGCGGCGG + Intergenic
1083623646 11:64060928-64060950 CATGCGCACCGCGGCGGCGGCGG + Intronic
1083771307 11:64869264-64869286 CACGCCCCCAGCAGAGGCTGAGG + Intronic
1083886559 11:65576132-65576154 GCGGGCCCCAGCGGCGGCAGCGG + Exonic
1083899799 11:65638138-65638160 CGGGACCCCAGCGCGGGCGGCGG + Intronic
1084068469 11:66718912-66718934 CAGGCCCTGCGGGGCGGCGGAGG + Intronic
1084190057 11:67494700-67494722 CAGGACCCCAGGGGCGGGGCAGG + Intronic
1084258217 11:67956673-67956695 CAGGCCCCTAGCCGGGGCTGAGG + Intergenic
1084265513 11:68003509-68003531 ACGGCCCCCCGCGGCGGGGGTGG - Intronic
1084285616 11:68128663-68128685 CAGGTCCCAAGGGGGGGCGGGGG - Intergenic
1084312930 11:68327088-68327110 CAGGCCCCCACCTGCTGGGGCGG - Intronic
1085196759 11:74677262-74677284 CAGGCTTCCAGGGGCGGGGGTGG - Intergenic
1085197179 11:74679760-74679782 CAGGCCCCCAGAGCCTGAGGAGG - Intergenic
1085886957 11:80532964-80532986 CAGGCCAGCAGCTGCGGAGGGGG - Intergenic
1085982116 11:81737496-81737518 CAGGCCCCCATCAGCAGCAGTGG + Intergenic
1086887835 11:92224973-92224995 CGAACCCCCGGCGGCGGCGGCGG + Intergenic
1087385113 11:97461296-97461318 CAGCCACCCAGCTGTGGCGGTGG + Intergenic
1088172906 11:107018094-107018116 GAGGACGCGAGCGGCGGCGGAGG + Exonic
1088481069 11:110296709-110296731 GCGGCCCCCAGCGGCGGCGTTGG - Exonic
1089499906 11:118925777-118925799 CTGGCTCCGGGCGGCGGCGGTGG + Intronic
1090095824 11:123741258-123741280 CAGGCCCCAGGAGGGGGCGGAGG + Intronic
1090293886 11:125569543-125569565 CAGGGCCGGAGCCGCGGCGGCGG + Exonic
1090832190 11:130427664-130427686 GTGGCCCCCAGGGGCGGTGGCGG + Exonic
1202808628 11_KI270721v1_random:18066-18088 CAGGGCCCCAGCGTCCACGGAGG - Intergenic
1091616229 12:2053049-2053071 CGGGCCCGGAGCGGCGGCGGCGG + Intronic
1091823643 12:3493538-3493560 CAGACCCCGCGCGGCAGCGGGGG - Intronic
1091866175 12:3839154-3839176 CAGGCGGCAGGCGGCGGCGGCGG - Intronic
1092428464 12:8391474-8391496 CAGGCCCCCAGCCGGGGCTGAGG + Intergenic
1092429548 12:8397626-8397648 CAGGCCCCCAGCCGGGGCTGAGG + Intergenic
1092727681 12:11500719-11500741 CTGGGCCCCGGCGGTGGCGGCGG - Intronic
1094375403 12:29783756-29783778 CAGGGCAGCAGCGGCGGCGGCGG - Exonic
1097019089 12:56007544-56007566 CGGGCGCTCAGAGGCGGCGGTGG - Intergenic
1097057425 12:56258295-56258317 CGAGCTCCCGGCGGCGGCGGCGG + Exonic
1097107672 12:56634957-56634979 CGGGCCGCAGGCGGCGGCGGCGG + Intronic
1097264416 12:57737509-57737531 CCCTCCCCCGGCGGCGGCGGCGG + Exonic
1098426063 12:70366542-70366564 GACGCCCCCGGCGGCGGCGGCGG - Exonic
1102256515 12:111418521-111418543 CAGGGCCCGGGCGGCCGCGGCGG - Exonic
1102453320 12:113056974-113056996 CGGGCCCCCAGCGGGAGCCGGGG - Intronic
1102648756 12:114421449-114421471 CTGGCCCCCATCGGGGGCAGAGG + Intergenic
1102689193 12:114747171-114747193 CAGGCCCCCAGCTGGGGAGGGGG - Intergenic
1102853867 12:116277239-116277261 CCCTCCCCCGGCGGCGGCGGCGG - Exonic
1103509696 12:121466517-121466539 CACGGCGGCAGCGGCGGCGGCGG - Intronic
1104568133 12:129903414-129903436 GAGGCCCGCAGCGGGGCCGGTGG + Exonic
1104901110 12:132189932-132189954 CAGACGCCCAGCGGCTTCGGAGG - Intergenic
1106108965 13:26760538-26760560 CAGGCGGCCCGCGGGGGCGGGGG + Intronic
1106447650 13:29850576-29850598 CATGGCGGCAGCGGCGGCGGCGG + Exonic
1107058628 13:36131724-36131746 GAGGCCCCCACCGTCGGGGGAGG + Intergenic
1107467791 13:40665778-40665800 GAGCGGCCCAGCGGCGGCGGGGG + Exonic
1107467829 13:40665895-40665917 CAGCCCCCCGGTGGCGGCCGCGG + Exonic
1108478498 13:50843643-50843665 CGGGCCGCCAGCGGAGGCGATGG - Exonic
1108541497 13:51451735-51451757 CGGCCCGGCAGCGGCGGCGGCGG - Intronic
1110630186 13:77698179-77698201 CAGGCCCCCTGAGGCCGCGGCGG - Intronic
1111138757 13:84086496-84086518 CAGGAGCCCACCGGCGGGGGTGG + Intergenic
1112216314 13:97434310-97434332 CTGGGCGCCGGCGGCGGCGGCGG - Exonic
1113334853 13:109367870-109367892 CAGACCCCCAGAGGCTGGGGAGG + Intergenic
1113656103 13:112068506-112068528 GCCGCCCGCAGCGGCGGCGGCGG - Exonic
1113861723 13:113491175-113491197 CAGGACCCGAGGGGCGGAGGGGG - Exonic
1114031255 14:18583115-18583137 AAGGCCCCCAGCGCCGGCGCAGG + Intergenic
1114612520 14:24052097-24052119 CGGCTCCCCGGCGGCGGCGGCGG + Exonic
1115320877 14:32077560-32077582 CAGGCTCCCCTCGGCGGCCGCGG - Intronic
1115399160 14:32938868-32938890 CAGGCGACCGGCGGCGGCGGCGG - Intronic
1115754279 14:36517681-36517703 CAGGACAGCGGCGGCGGCGGGGG - Exonic
1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG + Intronic
1118607697 14:67515400-67515422 GGAGCCCCCGGCGGCGGCGGCGG + Intronic
1119003819 14:70907274-70907296 CAGGGCCCCGGGGGCTGCGGAGG - Intergenic
1122300149 14:100726894-100726916 CAGCTCCCCGGCAGCGGCGGTGG + Exonic
1122369604 14:101222064-101222086 TAGGCCCCCAGCAGGGGCAGGGG - Intergenic
1122445011 14:101761773-101761795 CAGTCCCCGGGCGGCGGCGGCGG + Intergenic
1123041293 14:105491321-105491343 CAGGCCCCGGGCCGCGGCGGAGG + Exonic
1123129201 14:105972213-105972235 CAGGCCCCAACCAGCTGCGGTGG + Intergenic
1123409725 15:20048382-20048404 CAGGCCCCAACCAGCTGCGGTGG + Intergenic
1123519057 15:21055090-21055112 CAGGCCCCAACCAGCTGCGGTGG + Intergenic
1124929148 15:34101897-34101919 CAAGCCGCCAGCGGCGGCGGTGG - Exonic
1125482622 15:40091011-40091033 CAGGCCGCCAGTGGTGGCAGTGG + Exonic
1125508787 15:40282026-40282048 CCGGGCCGCAGCGGCGGCGGCGG + Exonic
1126034923 15:44537035-44537057 CACGCCCCCTCAGGCGGCGGCGG - Exonic
1127144082 15:56007187-56007209 CAGGATCCGGGCGGCGGCGGCGG + Intergenic
1127763627 15:62164587-62164609 CGGGCCCACAGCTGCGGCGGCGG - Exonic
1128119236 15:65133555-65133577 GAGGCCTCCCGCGGCGGAGGCGG - Exonic
1128765385 15:70248119-70248141 CAGGCCCCCAGTGTTGGGGGTGG - Intergenic
1128780250 15:70354435-70354457 CAGGCCCACAGCGGGGCCGCAGG - Intergenic
1129386980 15:75201792-75201814 CAGGCTCCCAGAGGCGGGGCCGG + Intronic
1129771229 15:78204685-78204707 CCGGCCCCCATCGGAGGCTGCGG + Intronic
1130076690 15:80695617-80695639 CTGGGCCGCGGCGGCGGCGGCGG - Exonic
1130547645 15:84868457-84868479 GAGGCCCCCAGCCTCTGCGGAGG - Exonic
1132043812 15:98547866-98547888 CATGCCCCCAGCGGGGGAGTTGG - Intergenic
1132251898 15:100341039-100341061 CAGGCCGCCGGCGGCGCCGCAGG + Exonic
1132683948 16:1154435-1154457 CAGGCCCCTCGCGGGGGAGGGGG + Intronic
1132920326 16:2386246-2386268 CAGGCTCCAAGGTGCGGCGGTGG + Intergenic
1132932913 16:2467912-2467934 CGAGCCCCCAGCGCCGCCGGTGG - Intergenic
1133020546 16:2964992-2965014 CCAGCCCCCAGCGGCCGTGGGGG - Exonic
1133156584 16:3880508-3880530 CCGGAGCCCGGCGGCGGCGGCGG - Exonic
1134143604 16:11742758-11742780 CGGGCCCGAGGCGGCGGCGGCGG - Exonic
1134149868 16:11797178-11797200 CAGGCGGGCAGCGGTGGCGGCGG + Intronic
1134163959 16:11915578-11915600 CCGGGCCCTTGCGGCGGCGGCGG - Exonic
1134573200 16:15309395-15309417 CAGGGCCCCAGCTGCTGCGCTGG + Intergenic
1134729184 16:16446563-16446585 CAGGGCCCCAGCTGCTGCGCTGG - Intergenic
1134938251 16:18265301-18265323 CAGGGCCCCAGCTGCTGCGCTGG + Intergenic
1135496978 16:22961488-22961510 CAGGCCCCCAGGGGCTGAAGTGG + Intergenic
1135821519 16:25690890-25690912 CAGGCACCCAGCTGTGGCTGGGG + Intergenic
1135821885 16:25692387-25692409 CCGGCTCGCGGCGGCGGCGGCGG - Exonic
1136546533 16:30958018-30958040 CGGCCCCGCAGCGGTGGCGGCGG - Intronic
1136556498 16:31010501-31010523 CAGGCCCCCCGCAGCGGCCGCGG - Exonic
1136666736 16:31819402-31819424 GGGGCCCCGAGGGGCGGCGGTGG + Intergenic
1136861552 16:33707240-33707262 GAGGCCCACGGCGGCGGCGCAGG - Intergenic
1136871082 16:33808653-33808675 CAGGCCCCAACCAGCTGCGGTGG - Intergenic
1138360749 16:56425441-56425463 CCGGCCCGGCGCGGCGGCGGCGG - Exonic
1139371084 16:66469871-66469893 CAGGGCCCCAGGGTGGGCGGCGG - Exonic
1139594098 16:67948192-67948214 CAGGTCCCCAGCTGCCGAGGAGG - Intronic
1140187430 16:72787747-72787769 CACGTCCCCACCGGCGGCGGCGG - Exonic
1141054615 16:80804016-80804038 CGAGCCCGCGGCGGCGGCGGCGG - Intronic
1141079203 16:81035956-81035978 CGGGCCCGAGGCGGCGGCGGCGG - Exonic
1141582726 16:85011325-85011347 CCGGCCTGCGGCGGCGGCGGCGG + Exonic
1141682600 16:85553298-85553320 CCCGCCGGCAGCGGCGGCGGCGG - Intergenic
1141704553 16:85657554-85657576 CCGGCCCCCGGTGCCGGCGGAGG + Exonic
1141831332 16:86511318-86511340 CATGACCCCACCGGCGCCGGTGG - Exonic
1142020541 16:87779476-87779498 CAGGGCCCCAGCGGCTGCCTGGG - Intergenic
1142120464 16:88384020-88384042 CAGGTCCCCGGCGGGGGCGGGGG + Intergenic
1203101090 16_KI270728v1_random:1307405-1307427 CAGGCCCCAACCAGCTGCGGTGG + Intergenic
1142492121 17:286037-286059 CACCCCCCCAGCAGTGGCGGGGG - Intronic
1143119466 17:4597960-4597982 CAGGGCTCCAGCGGCGGACGGGG + Intronic
1143256241 17:5559984-5560006 CAGGCCCCCATGGGCAGCGGTGG - Exonic
1144109803 17:12020896-12020918 CCGAGCCCGAGCGGCGGCGGCGG + Exonic
1144340885 17:14309561-14309583 CAGGCCAACACCGGCGGGGGCGG - Intronic
1144724543 17:17495264-17495286 CGGGCCGGCAGCGGCGGCGGCGG - Exonic
1144828975 17:18121339-18121361 CAGAGCCCCAGGGGCGGCGAGGG - Exonic
1145089800 17:19977538-19977560 CCGGGCCTCAGGGGCGGCGGTGG - Intronic
1146183106 17:30709538-30709560 CGGCCCCCTCGCGGCGGCGGAGG - Intergenic
1146219842 17:31008732-31008754 CATGTCCCCAGCGGCGGAGGCGG - Intergenic
1146398654 17:32487290-32487312 GGGGACCGCAGCGGCGGCGGCGG + Intronic
1147150265 17:38510183-38510205 CAGTCCCCCGGCGGCGCCGGAGG + Exonic
1147150369 17:38510561-38510583 GCGGCCCCCGGCGGCGGCGCTGG + Exonic
1147200644 17:38799422-38799444 CATGCCCGGGGCGGCGGCGGCGG + Exonic
1147341385 17:39754854-39754876 GAGGCCCCGAGCGGCGTGGGCGG + Intergenic
1147393446 17:40123166-40123188 CAGGGTCCCGGCGGTGGCGGTGG - Intronic
1147786262 17:42980693-42980715 CTGGGCCCCAGTGGGGGCGGTGG + Exonic
1147829830 17:43291651-43291673 CAGGACCCCAGAGGCAGGGGTGG + Intergenic
1147862622 17:43532713-43532735 CAGGTACCCAGGGGCGGGGGTGG - Exonic
1147947138 17:44086615-44086637 CATGCCCCCAGGGGCAGCAGGGG + Exonic
1148147312 17:45373930-45373952 CAGGCCCCCAGCAGGGGAGAAGG + Intergenic
1148157565 17:45432479-45432501 CAGGCCCCCAGCGCCGACCCAGG - Intronic
1148471428 17:47896235-47896257 CAGGCTCTCGGTGGCGGCGGAGG + Exonic
1148478021 17:47941830-47941852 CAGGCCTCCTGCAGGGGCGGGGG + Intronic
1148849796 17:50549040-50549062 CAGGCCACCAGCAGCGGCGGGGG + Exonic
1149430617 17:56593730-56593752 GCGGACTCCAGCGGCGGCGGCGG - Exonic
1149721742 17:58851898-58851920 CAGGCCTCCTTCGGCTGCGGTGG + Intronic
1150338019 17:64344120-64344142 CAGGCCCACAGTGGGGGCTGGGG + Intronic
1150373502 17:64661878-64661900 CATGTCCCCGGCGGCGGGGGCGG + Exonic
1150484898 17:65536958-65536980 CAGGGCCCCAGCTCCGCCGGGGG + Exonic
1151486791 17:74406051-74406073 CAGGCCCCCAGCTGAGCCCGTGG - Intergenic
1151755337 17:76072454-76072476 CAGGTCCCAGGCGGCGGCGGCGG - Exonic
1152087992 17:78231965-78231987 CAGGGCCCCGGGGGCGGCGGGGG - Exonic
1152240205 17:79157033-79157055 CTGGCCCACAGCAGCGGCTGAGG - Intronic
1152436272 17:80278300-80278322 CAAGCCCCTAGAGGCGGAGGCGG - Intronic
1152679213 17:81656981-81657003 CAGGCCCCTAAGGGCGGGGGGGG - Intronic
1152694903 17:81739160-81739182 CAGGGCCCCGGTGGCAGCGGGGG - Intergenic
1152834378 17:82519882-82519904 CAGGCCCATGGCGGCGGCCGCGG + Exonic
1152880078 17:82809418-82809440 CAGGCCACCAGTGACGGCTGAGG - Intronic
1153180616 18:2428927-2428949 CAGGCCCTCAGTGGAGGCTGAGG - Intergenic
1153854829 18:9136168-9136190 CAGGGCCCCACCTGAGGCGGGGG + Intergenic
1153872603 18:9334684-9334706 GTGGACCCCAGCGGGGGCGGAGG + Intergenic
1154173774 18:12068430-12068452 GTGGGCCCCGGCGGCGGCGGCGG - Intergenic
1156275827 18:35581835-35581857 TAGGCGCGCGGCGGCGGCGGCGG - Intronic
1157599640 18:48886044-48886066 CAGGCCCCGGGCAGCCGCGGGGG + Intergenic
1157615766 18:48986942-48986964 CAGGCCCTCCGAGGTGGCGGTGG + Intergenic
1160719130 19:589891-589913 CCGGCCGGCGGCGGCGGCGGCGG + Exonic
1160967832 19:1754323-1754345 TAGGCGGCCAGCGGCGGGGGTGG - Exonic
1161234545 19:3191374-3191396 CAGGCTCTCAGCGACGGCCGTGG + Intronic
1161265118 19:3360222-3360244 AAGGCGCCCGGCGGCGGCCGCGG - Intronic
1161400702 19:4065457-4065479 CCCGGCCCCGGCGGCGGCGGTGG + Intronic
1161401347 19:4067261-4067283 CAGGCCCCCAGCCTCTGCGCAGG + Intergenic
1161443344 19:4304783-4304805 CGGGCCCGCAGGGGCGTCGGGGG + Intronic
1161703247 19:5805943-5805965 CGTGTCCCCGGCGGCGGCGGCGG - Intergenic
1161975979 19:7607908-7607930 CAGGCCAGCAGCGGGGGCTGGGG - Intronic
1162246618 19:9406857-9406879 CAAGCCCCCAGCGGCGCAGGTGG + Intergenic
1162418818 19:10554110-10554132 CAGCCCCCCAGAAGCGGAGGAGG - Exonic
1162731419 19:12721213-12721235 CGGGCCACAGGCGGCGGCGGCGG + Intronic
1162975688 19:14206230-14206252 CGGCCCCCTCGCGGCGGCGGAGG + Intergenic
1163106324 19:15125021-15125043 TAAGCTCCCAGCGGGGGCGGCGG + Exonic
1163162341 19:15472062-15472084 CCGCTCCCCAGCGGCAGCGGGGG + Exonic
1163282148 19:16324753-16324775 CCGGGCCAAAGCGGCGGCGGCGG - Intergenic
1163427099 19:17245750-17245772 CAGGCCCGGAGCGGCAGCCGCGG - Exonic
1163606975 19:18280978-18281000 GGGCCCCCCGGCGGCGGCGGCGG + Exonic
1163664144 19:18595194-18595216 AAGGCCAGCAGGGGCGGCGGGGG - Intronic
1164179734 19:22807760-22807782 CAGGCTCCGTGCGGCGGCGCTGG - Intergenic
1164639102 19:29811884-29811906 CAGCCCCTCAGCGGCCGCGCGGG - Exonic
1164834537 19:31349248-31349270 CAGCCCGGCAGCGGCGGCGGCGG - Exonic
1165696756 19:37906825-37906847 TAGACCCCCAGCGGAGGGGGCGG - Intergenic
1165782228 19:38441391-38441413 GAGGCCCTCGGCGGGGGCGGGGG + Intronic
1166039321 19:40192215-40192237 CAGCTCCCCAGCGGCCGCGTGGG + Exonic
1166054151 19:40278737-40278759 CAGGCCTCCTGAGGAGGCGGCGG - Intronic
1166361256 19:42253873-42253895 CCTTCCCCCGGCGGCGGCGGCGG - Intronic
1166807693 19:45496976-45496998 CAGGGCGGCGGCGGCGGCGGCGG - Exonic
1167072954 19:47231151-47231173 CGGGCGCCTGGCGGCGGCGGCGG - Intronic
1167358146 19:49016481-49016503 CAGACCCACAGAGGCAGCGGGGG - Intronic
1167359641 19:49023371-49023393 CAGACCCACAGAGGCAGCGGGGG - Intronic
1167361490 19:49032714-49032736 CAGACCCACAGAGGCAGCGGGGG + Intronic
1167362164 19:49036071-49036093 CAGACCCACAGAGGCAGCGGGGG - Intronic
1167363920 19:49044787-49044809 CAGACCCACAGAGGCAGCGGGGG + Intronic
1167364578 19:49048140-49048162 CAGACCCACAGAGGCAGCGGGGG - Intronic
1167365863 19:49054776-49054798 CAGACCCACAGAGGCAGCGGGGG - Intronic
1167391279 19:49196720-49196742 CAGGGCCTGAGCGGAGGCGGGGG + Exonic
1167750135 19:51374483-51374505 CAGGCTCCCAGAGGTGGCAGAGG + Intergenic
1168640124 19:58025588-58025610 CAGGCCACCCGAGCCGGCGGTGG - Intergenic
1202647688 1_KI270706v1_random:157299-157321 GAGGCCCACAGCGCCGGCGCAGG + Intergenic
1202693294 1_KI270712v1_random:105827-105849 GAGGCGCGCAGCGGCGGCGCAGG + Intergenic
925009145 2:468612-468634 CAGGCGCCCAGTGGCGGTGCAGG - Intergenic
926130963 2:10302903-10302925 CAGGCGGGCCGCGGCGGCGGCGG + Intronic
926202638 2:10812726-10812748 CAGGGCTGAAGCGGCGGCGGCGG - Intronic
926217097 2:10912352-10912374 CGGACCCCCAGCGGCAGCGGCGG + Exonic
926724018 2:15983636-15983658 CAGGACCCCAGCGGGGGAGGTGG - Intergenic
926796655 2:16625233-16625255 CAGGCCCCCAGAGGCTGGGCTGG + Intronic
927574582 2:24190659-24190681 CAGGCACCCAAGGGCGGAGGAGG + Exonic
927881455 2:26692704-26692726 CAGCTCCGCGGCGGCGGCGGCGG + Intronic
927964985 2:27262877-27262899 CAAGCCCCCAGCGGCTGGAGAGG + Exonic
928983220 2:37156922-37156944 CCGGCCGGCGGCGGCGGCGGCGG - Exonic
929188557 2:39120280-39120302 CAGCCCCCCAGCGCGGGCGCTGG - Intronic
930106076 2:47640521-47640543 CAGGCTGCCAGGGGCGCCGGAGG + Intergenic
932416001 2:71574290-71574312 GACGGCGCCAGCGGCGGCGGCGG - Exonic
932460106 2:71876449-71876471 CAGGCCCCCAGGGGGAGAGGTGG - Intergenic
933728299 2:85438479-85438501 CAGGCCCGCAGGGGCTGTGGAGG + Intergenic
933741636 2:85538763-85538785 GCGTCCCCCAGCGGAGGCGGCGG - Intergenic
933953274 2:87348732-87348754 GAGGCGCGCAGCGGCGGCGCAGG - Intergenic
934237505 2:90245077-90245099 GAGGCGCGCAGCGGCGGCGCAGG - Intergenic
934459929 2:94208383-94208405 GAGGCGCACAGCGGCGGCGCAGG - Intergenic
934547511 2:95230640-95230662 GAGGCACCCAGAGGCGGCGACGG - Intronic
934736236 2:96691269-96691291 CACGCGCCCAGCGCCGGCGGCGG - Intergenic
934887479 2:98037727-98037749 CAGGCCCCCAGCAGGAGTGGAGG + Intergenic
935139465 2:100339957-100339979 CAGGCACCGAGCGGCCGGGGAGG + Intergenic
935196640 2:100820234-100820256 GAGACCCGCAGCCGCGGCGGCGG + Exonic
935275775 2:101474305-101474327 CAGGCAGCGAGCGGCGGCCGTGG + Intronic
935592733 2:104856222-104856244 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
938012740 2:127841710-127841732 AAGGCCGCCTGAGGCGGCGGTGG - Intergenic
938073114 2:128318679-128318701 CAGGCCGCCCGCAGCGGCGCGGG + Intergenic
938397764 2:130963631-130963653 CAGGCCTGGAGCGGCTGCGGCGG - Intronic
940775001 2:157876054-157876076 CAGGCTGGCAGCGGCAGCGGCGG + Intergenic
940775063 2:157876232-157876254 CTTGCCCCCGGGGGCGGCGGGGG + Intergenic
941119114 2:161507860-161507882 TGGGCCCGCGGCGGCGGCGGCGG - Intronic
942045843 2:172099081-172099103 GAGGTCCCCCGCGGCGGCTGGGG + Intergenic
942151065 2:173076157-173076179 CAGGGCCCGCCCGGCGGCGGCGG + Intronic
942241111 2:173964677-173964699 CCGCCCCCCGGCGGCGGCGGCGG + Intronic
942453556 2:176123069-176123091 GAGGCGGCCAGGGGCGGCGGGGG - Exonic
943060533 2:183038113-183038135 GAGGCGGCCGGCGGCGGCGGCGG - Exonic
943571509 2:189580776-189580798 CCGGCCCACGGCGGCGGCGGCGG - Exonic
944451808 2:199851146-199851168 CGGGCCACGCGCGGCGGCGGAGG - Intronic
945431726 2:209772239-209772261 CGCGGCCTCAGCGGCGGCGGCGG - Intronic
945911144 2:215651084-215651106 CAGGCGCCCACCGGGCGCGGTGG + Intergenic
946397036 2:219448416-219448438 CAGGGCCGCAGGGGCGCCGGCGG - Exonic
947636010 2:231681082-231681104 CGAGCCCCCAGCGGCGGCCCGGG - Intergenic
947815686 2:233034751-233034773 CAGGCCCCGAGCGGGGGCTGGGG - Exonic
948248695 2:236507640-236507662 CAGGCCTCCCGCGGTGGCGCAGG - Intergenic
948870039 2:240793164-240793186 CAGGCCCCCAGCCTCCGCTGTGG - Intronic
948991730 2:241559070-241559092 CAGGACGCCAGCGGCGGAGGTGG + Intronic
1169093167 20:2873623-2873645 GAGCCCCGCGGCGGCGGCGGCGG - Intronic
1171170173 20:23008912-23008934 GAGACCCCCAGCAGCAGCGGAGG + Intergenic
1172037355 20:32019287-32019309 CAGGCGGGCAGCGGCGGGGGAGG + Exonic
1172100888 20:32483550-32483572 CAGGCGAGCAGCGGCGGCAGCGG + Intronic
1172644345 20:36460883-36460905 CAGGCCTCCAGAGGCGGAGCCGG + Intronic
1174357820 20:50010096-50010118 GGGGCCGGCAGCGGCGGCGGCGG + Intergenic
1175540467 20:59744596-59744618 CAGGCCCACAGCAGGGGAGGCGG + Intronic
1175553503 20:59831845-59831867 CAGACCCCCAGAGCCGGCGCAGG - Intronic
1175847373 20:62065830-62065852 CTCGGCCCGAGCGGCGGCGGCGG - Intergenic
1176157005 20:63626978-63627000 TAGGCACCCGGCGGGGGCGGCGG + Intronic
1176185170 20:63774489-63774511 CTGGACCCCAGCCGCGGAGGTGG + Intronic
1176207112 20:63895202-63895224 GAGACCCCGGGCGGCGGCGGCGG - Exonic
1176604164 21:8815432-8815454 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1177011059 21:15730374-15730396 CATGGCCCCCGCGGCGGCGGCGG - Exonic
1177513579 21:22120796-22120818 CAGGCTCCCAGTGGCAGCTGTGG - Intergenic
1178992481 21:37367202-37367224 CGGGGCCCGGGCGGCGGCGGCGG - Intronic
1179052088 21:37896790-37896812 CCGGGCCCCAGAGGCAGCGGAGG + Intronic
1179119177 21:38527297-38527319 CAAGCCCCCAGCTGCAGCTGAGG - Intronic
1179213716 21:39349055-39349077 GAGACCCACAGCGGGGGCGGTGG + Exonic
1179674908 21:42974752-42974774 CCGGGCGGCAGCGGCGGCGGCGG - Intronic
1179674989 21:42974970-42974992 CAGGCCCAGCGCGGCGGCGGCGG - Intronic
1180346443 22:11706981-11707003 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1180346449 22:11707010-11707032 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1180346455 22:11707039-11707061 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1180354212 22:11825134-11825156 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1180354218 22:11825163-11825185 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1180384034 22:12167192-12167214 GAGGCCCACAGCGCCGGCGCAGG + Intergenic
1180455368 22:15510173-15510195 AAGGCCCCCAGCGCCGGGGCAGG + Intergenic
1180843450 22:18969837-18969859 CCAGCCCCCAGCGGGGCCGGGGG - Intergenic
1180891406 22:19291650-19291672 CGGGACCTCGGCGGCGGCGGCGG + Exonic
1180998570 22:19977452-19977474 TAGGCTCCCAGCGCCGGAGGCGG - Exonic
1181022797 22:20112501-20112523 CAGGGCCCCAGGGGCGGGGAAGG - Exonic
1181085125 22:20436391-20436413 CAGGAATGCAGCGGCGGCGGCGG - Intronic
1181356267 22:22298064-22298086 GAGGCGCACAGCGGCGGCGCAGG + Intergenic
1181356272 22:22298093-22298115 GAGGCGCACAGCGGCGGCGCAGG + Intergenic
1181478094 22:23180838-23180860 CATGGCCCGCGCGGCGGCGGCGG - Exonic
1182658193 22:31906247-31906269 CAGGGCAGCAGCGGCGGCGGCGG + Exonic
1183149730 22:36028360-36028382 CATGCCCCGGGCGGCGGCGCCGG + Exonic
1184401969 22:44279696-44279718 CAGGAGCCCAGCAGGGGCGGGGG - Intronic
1184744409 22:46447993-46448015 CAGGTCCCCAGTGGCGGGGCAGG - Intronic
1184786160 22:46673004-46673026 CCGGCCCCCAGCTGCGGGGATGG + Intronic
1185055262 22:48575860-48575882 CTGGCCCGCCGCGGCGGCGGTGG + Intronic
1185316173 22:50180139-50180161 CGGGCCCCCCGCCGCGGCTGAGG + Exonic
1185331364 22:50253426-50253448 CTGGCCCCCAGCTGCCGGGGAGG + Exonic
1185342351 22:50297275-50297297 CAGGCCCCAGGCGTGGGCGGGGG + Intronic
950486149 3:13275044-13275066 CAGTCACCCAGTGGCAGCGGCGG - Intergenic
950523078 3:13507838-13507860 TAGGGCCCCAGCGGGGGCGGGGG + Intergenic
951613949 3:24521823-24521845 CAAGGCTCCAGCGGCTGCGGCGG - Intergenic
952867188 3:37861997-37862019 CTCGAGCCCAGCGGCGGCGGCGG + Intronic
954436799 3:50500552-50500574 CAGGCCACCACCGCCGGCTGAGG - Intronic
955768560 3:62369038-62369060 CAGGACCCAGGAGGCGGCGGCGG + Intergenic
959530732 3:107431540-107431562 CCGAGCCCCGGCGGCGGCGGCGG - Intergenic
959591897 3:108090931-108090953 CCGGACACCTGCGGCGGCGGCGG - Exonic
960096718 3:113696573-113696595 CGGGCTCGCAGCGGCTGCGGTGG - Exonic
961280915 3:125765591-125765613 CAGGCCCCCAGCCAGGGCTGAGG - Intergenic
962809816 3:138950391-138950413 CAGGCAGCCGGCGGCGGCGCGGG - Exonic
963253095 3:143120073-143120095 CGACCCCGCAGCGGCGGCGGCGG - Exonic
963904458 3:150762662-150762684 TCGGGCCCCGGCGGCGGCGGCGG - Exonic
964497183 3:157303853-157303875 CAGAACCCCAGTGGGGGCGGAGG - Intronic
964630248 3:158802220-158802242 CAGGGCTCCAGGGGCGGCCGGGG - Exonic
964720618 3:159764761-159764783 AGGACCCGCAGCGGCGGCGGCGG + Exonic
966182197 3:177197557-177197579 GAGGCCCGCGGCGGCGGCGGCGG + Intergenic
967493776 3:190120986-190121008 CAGGCTCCCCGCTGCAGCGGCGG + Intronic
967858257 3:194134276-194134298 GTGGCACCCGGCGGCGGCGGCGG + Intergenic
968514393 4:1010202-1010224 CAGGGCCGCGGCGGCGGCGCAGG + Intronic
968515133 4:1012519-1012541 AAGGCCCCCAGCAGCAGCGGCGG - Exonic
968701302 4:2059405-2059427 CGGACCCGCGGCGGCGGCGGCGG - Intergenic
968701700 4:2060637-2060659 CAGGCCCCGCGCGGGGGAGGGGG - Intronic
968955020 4:3713946-3713968 GAGGCCCACAGCGGCGGCAGCGG - Intergenic
968965150 4:3765929-3765951 CAGGGCGGCGGCGGCGGCGGCGG + Intergenic
969326916 4:6449523-6449545 CAGGGGCCAGGCGGCGGCGGGGG - Intronic
969595134 4:8144390-8144412 AAGTCCCCCAGCGGCGGCCCTGG - Intronic
969656373 4:8501085-8501107 CAGGCCCCCAGCTGTGGGGCAGG + Intergenic
969715871 4:8867843-8867865 CGGGGGCCCAGCGGCGGCTGCGG + Exonic
969796387 4:9531420-9531442 CAGGCCCCCAGCCGGGGCTCAGG - Intergenic
970195210 4:13544906-13544928 CCCACCCCCGGCGGCGGCGGCGG + Exonic
970202882 4:13627490-13627512 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
970637109 4:18021677-18021699 CCGGCACTGAGCGGCGGCGGCGG + Exonic
971195639 4:24470537-24470559 CAGGCCCCCAGCTCCAGCGCCGG + Intergenic
971195685 4:24470707-24470729 GACGCCCCCACCCGCGGCGGCGG + Intergenic
971327428 4:25655732-25655754 CAGTGCCCCGGCGGCGGCTGCGG + Intronic
973373958 4:49275517-49275539 GAGGCCCACAGCGCCGGCGCAGG + Intergenic
973383454 4:49334722-49334744 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
973387061 4:49519736-49519758 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
973387067 4:49519765-49519787 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
975342573 4:73258566-73258588 GGGCCCCCCCGCGGCGGCGGAGG - Exonic
975986118 4:80202702-80202724 CAGGACGCTGGCGGCGGCGGCGG + Exonic
976389366 4:84493332-84493354 AAGTCCAGCAGCGGCGGCGGCGG - Exonic
978777202 4:112516015-112516037 AAGAGCCCCGGCGGCGGCGGCGG + Exonic
979635255 4:122949470-122949492 CAGGCCCACAGCGGAGGAGAGGG + Intronic
981270745 4:142845724-142845746 CAGGCCGGCGGCGGCGGCGGCGG + Intronic
981300915 4:143185118-143185140 GGGCCCCCCAGCGGCGTCGGCGG - Exonic
982712208 4:158768947-158768969 CAGCCCCACGGCGGCGGCGGCGG - Intergenic
983576984 4:169270888-169270910 CGGCCCCGCAGCGGCTGCGGCGG + Exonic
987087997 5:14487562-14487584 GGGGCCCCCAGTGGCGGCAGCGG + Exonic
988346272 5:30041831-30041853 CAGTCACCCAGCCGCGGCTGTGG + Intergenic
988825325 5:34929741-34929763 CCGGGCCGAAGCGGCGGCGGCGG - Exonic
989584784 5:43066375-43066397 CAGTCCCCCGGCGGCGCCGCTGG - Intronic
990389809 5:55307528-55307550 CAAGGCTCCAGCGGCCGCGGTGG - Exonic
990510855 5:56487916-56487938 CAGGCCAGCAGCTGCGGAGGGGG + Intergenic
990955151 5:61332811-61332833 CCCGGCCCCCGCGGCGGCGGCGG - Exonic
992939521 5:81750045-81750067 CAGCCCCCGAGCGGCGGGAGGGG - Intronic
993116158 5:83722247-83722269 CACAGCCCGAGCGGCGGCGGCGG - Intergenic
993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG + Exonic
993901217 5:93585108-93585130 GCGGCCCGCGGCGGCGGCGGCGG + Exonic
995106247 5:108381036-108381058 CAGCCCCGCTGCGGCGGCGGGGG - Exonic
996442956 5:123512494-123512516 CAGTCCGTCAGCGCCGGCGGGGG - Intronic
998134539 5:139667897-139667919 CAGGGCCCCAGCAGCTGCGGTGG + Intronic
999259286 5:150228089-150228111 CAGGGCCCCAGGGGCGGCTCAGG - Intronic
999326937 5:150649595-150649617 CAGCCCCGCGGCGGCGGAGGAGG + Exonic
1000085868 5:157886989-157887011 CAGGCCAGCAGCTGCGGAGGGGG + Intergenic
1001310002 5:170603755-170603777 CAGGGCCCCAGCTGAGGCTGAGG + Intronic
1002591077 5:180291986-180292008 CACACCCACTGCGGCGGCGGCGG - Exonic
1003603807 6:7542000-7542022 GAGGTGACCAGCGGCGGCGGGGG + Exonic
1006031604 6:31180473-31180495 CAGGCCTCCAGTGGTGGTGGTGG + Intronic
1006406321 6:33847753-33847775 CAGGCACCCAGGGGAGGCTGGGG + Intergenic
1006472658 6:34237331-34237353 GGGGCCCGCGGCGGCGGCGGCGG + Intronic
1007226960 6:40321812-40321834 AAGTCACCCACCGGCGGCGGCGG - Intergenic
1008582896 6:52922373-52922395 CAGGCCCACATCCGGGGCGGGGG + Intergenic
1011931810 6:92723643-92723665 CAGGCCAGCAGCTGCGGAGGGGG + Intergenic
1012100695 6:95083445-95083467 CAGGACGCCAGCTGCAGCGGGGG + Intergenic
1012399993 6:98835066-98835088 CTGTCCCACGGCGGCGGCGGCGG + Exonic
1012427712 6:99132175-99132197 CTGGCCCCCAGAGGAGGCTGGGG + Intergenic
1014883114 6:126746803-126746825 CAGGCCCCCAGAGGCATAGGAGG - Intergenic
1015525965 6:134175511-134175533 CAAGCCCCCAGCGGGGCCGGCGG + Intronic
1016738921 6:147508448-147508470 GAGCGCGCCAGCGGCGGCGGCGG + Intergenic
1017446349 6:154510341-154510363 CGGGATCCCGGCGGCGGCGGGGG - Exonic
1017672244 6:156778738-156778760 GGGGGCCCCGGCGGCGGCGGCGG - Exonic
1019292470 7:257450-257472 CAGGCCAGCAGCGGCCGCAGAGG - Intronic
1019337139 7:490861-490883 CAGGTCCCCAGAGGCGTCTGGGG - Intergenic
1019343808 7:520202-520224 TCGGGCCCCAGCGGCGGCAGCGG + Intronic
1019474250 7:1236436-1236458 CAGCCCCGCGGCGGCGGCGGCGG - Exonic
1020105656 7:5421182-5421204 CCGGACAGCAGCGGCGGCGGGGG + Exonic
1021451120 7:20784810-20784832 GAGCCCCCCAGCGGCGCCGAAGG + Exonic
1023736166 7:43237838-43237860 CAGGCTCCAAGTGGGGGCGGCGG - Intronic
1024934293 7:54697730-54697752 CGGGTCCCCTGCGGCTGCGGAGG - Intergenic
1025069677 7:55887591-55887613 CGGGTCCACCGCGGCGGCGGCGG + Intronic
1025916910 7:65873305-65873327 CGGGCCCCGACGGGCGGCGGCGG + Intronic
1029075241 7:97929283-97929305 CAGGCCCCCAGCCGGGGCTGAGG + Intergenic
1029640535 7:101816749-101816771 GCGGCCACCGGCGGCGGCGGCGG + Intronic
1030059754 7:105613064-105613086 CTGGCCCCCAGAGGCTGGGGCGG + Intronic
1031051884 7:116953441-116953463 CCGGGCCGCGGCGGCGGCGGCGG + Exonic
1031604227 7:123749029-123749051 CCCTCCCGCAGCGGCGGCGGCGG + Exonic
1032119310 7:129144948-129144970 TAGGCCCCCGGGGGCGGTGGCGG + Exonic
1032125416 7:129189320-129189342 CAGTGGCTCAGCGGCGGCGGAGG - Exonic
1033253188 7:139777817-139777839 CCGGGCGGCAGCGGCGGCGGCGG - Intronic
1033299937 7:140176670-140176692 CGGGCGGCCGGCGGCGGCGGCGG + Intronic
1034438896 7:151076736-151076758 CAGGCCCCCAGCGCAGGCCCAGG + Exonic
1034522627 7:151632326-151632348 CGCGCCACCTGCGGCGGCGGCGG - Intronic
1034531675 7:151699798-151699820 CAGGCCCTCAGAGGAGGCAGTGG + Intronic
1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG + Exonic
1035224613 7:157426471-157426493 AAGGAACCCAGAGGCGGCGGAGG - Intergenic
1036189989 8:6661596-6661618 CAGGGCCCCTGGGGCGGCCGTGG - Intergenic
1036258509 8:7222917-7222939 CAGGCCCCCAGCCGGGGCTCAGG + Intergenic
1036259562 8:7229061-7229083 CAGGCCCCCAGCTGGGGCTGAGG + Intergenic
1036307058 8:7610463-7610485 CAGGCCCCCAGCTGGGGCTGAGG - Intergenic
1036308112 8:7616591-7616613 CAGGCCCCCAGCCGGGGCTCAGG - Intergenic
1036310564 8:7681513-7681535 CAGGCCCCCAGCCGGGGCTCAGG + Intergenic
1036357905 8:8058450-8058472 CAGGCCCCCAGCTGGGGCTGAGG - Intergenic
1036358968 8:8064592-8064614 CAGGCCCCCAGCCGGGGCTCAGG - Intergenic
1036830456 8:12016035-12016057 CAGGCCTCCAGCTGGGGCTGAGG + Intergenic
1036891990 8:12602360-12602382 CAGGCCCCCAGCCGGGGCTCAGG + Intergenic
1036893043 8:12608496-12608518 CAGGCCCCCAGCCGGGGCTGAGG + Intergenic
1036899538 8:12660335-12660357 CAGGCCCCCAGCCGGGGCTCAGG + Intergenic
1036952515 8:13154416-13154438 CAGGCCAGCAGCTGCGGAGGGGG - Intronic
1039512819 8:38105363-38105385 CCGGCCTCCCGCGCCGGCGGTGG - Exonic
1039887788 8:41665063-41665085 CAGGCCCCCCGTGGTGGCCGGGG - Intronic
1039889438 8:41674116-41674138 GAGGCCCCGAGCGGAGGCTGAGG - Intronic
1039889444 8:41674135-41674157 GAGGCCCCGAGCGGAGGCTGAGG - Intronic
1039893446 8:41699623-41699645 CAAGCCCCCAGAGGCGGAGCGGG - Intronic
1041059498 8:54022270-54022292 GAAGCCCGCGGCGGCGGCGGCGG + Exonic
1042155694 8:65841980-65842002 CAGGACTCCGGCGGCGGCGGCGG - Intronic
1042532868 8:69833007-69833029 CGCGGGCCCAGCGGCGGCGGCGG - Exonic
1044719851 8:95134299-95134321 CCGTCCCCCCGCGGCGGCGGCGG - Intronic
1045516300 8:102863633-102863655 TGTGCCCCCGGCGGCGGCGGCGG - Intronic
1045564364 8:103298795-103298817 CGGGCTCGCGGCGGCGGCGGCGG - Intronic
1045737919 8:105318452-105318474 GCGGCCCGGAGCGGCGGCGGCGG + Intronic
1045738012 8:105318839-105318861 CTGGCCAGCGGCGGCGGCGGCGG + Exonic
1047998535 8:130358435-130358457 CAGCTCCTCAGCGGCGGGGGAGG + Intronic
1048945585 8:139444075-139444097 CAGGGCCCCTGCGGCTGAGGAGG + Intergenic
1049369122 8:142255101-142255123 GAGGCCCCCAGCGGCTGAAGGGG + Intronic
1049545353 8:143228303-143228325 CAGGGCGCCAGGGGCTGCGGTGG + Intergenic
1049585304 8:143430168-143430190 CCGGGCACCGGCGGCGGCGGCGG - Exonic
1049662867 8:143828212-143828234 CAGGCCCCCAGCGGGCGGGCTGG - Intronic
1049671720 8:143873002-143873024 CAGGCCCCCAGTGGCTGCCTGGG + Exonic
1049752437 8:144291572-144291594 GAGGGCGGCAGCGGCGGCGGCGG + Intronic
1049856892 8:144867886-144867908 CAGACCCCCAGAGGCTGCAGTGG + Intergenic
1052930069 9:34048858-34048880 CAGGTAACGAGCGGCGGCGGCGG - Exonic
1052941498 9:34134749-34134771 CAGCGCGGCAGCGGCGGCGGCGG - Intergenic
1053690427 9:40584163-40584185 GAGGCGCACAGCGGCGGCGCAGG - Intergenic
1054274359 9:63053225-63053247 CGGGCGCACAGCGGCGGCGCAGG + Intergenic
1054274362 9:63053244-63053266 CAGGCGCACAGCGGCGGCGCAGG + Intergenic
1054301679 9:63385124-63385146 GAGGCGCACAGCGGCGGCGCAGG - Intergenic
1054350968 9:64016553-64016575 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1054351016 9:64016785-64016807 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1054351022 9:64016814-64016836 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1054351028 9:64016843-64016865 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1054351034 9:64016872-64016894 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1054351040 9:64016901-64016923 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1054351046 9:64016930-64016952 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1054400462 9:64711685-64711707 CAGGCGCACAGCGGCGGCGCAGG - Intergenic
1054400465 9:64711704-64711726 GAGGCGCACAGCGGCGGCGCAGG - Intergenic
1054434052 9:65195941-65195963 GAGGCGCACAGCGGCGGCGCAGG - Intergenic
1054496335 9:65825727-65825749 GAGGCGCACAGCGGCGGCGCAGG + Intergenic
1054835653 9:69672549-69672571 CGAGCCCGCGGCGGCGGCGGCGG + Intergenic
1054912555 9:70467290-70467312 CAGGCCCCCAGCAGAGGCAAAGG - Intergenic
1056243308 9:84669997-84670019 CCGGCACCCAGCGGCCGTGGCGG + Intronic
1056900813 9:90597540-90597562 CAGTCCCGCAGCGGAGGAGGAGG + Intergenic
1057171350 9:92965088-92965110 CAGGGTCCCAGCGGCAGTGGCGG + Intronic
1057245615 9:93451902-93451924 CACGCCCATGGCGGCGGCGGGGG - Exonic
1057463771 9:95292423-95292445 CGGGCCCGAGGCGGCGGCGGAGG - Intronic
1057488627 9:95506081-95506103 CAGGCGGACAGCGGCAGCGGCGG + Intronic
1059452792 9:114381262-114381284 AGGGCCCCCAGCGGCGGCGCTGG - Exonic
1059633943 9:116154356-116154378 CAGGCACCGCCCGGCGGCGGCGG - Exonic
1059769831 9:117414790-117414812 CCGGCCAGCAGCGGCGGCGGCGG + Exonic
1060970570 9:127735181-127735203 CAGGTCCCAGGCGGCGGCCGCGG + Exonic
1061251843 9:129431125-129431147 CCCGCCCCCAGCAGCGCCGGTGG + Intergenic
1061449167 9:130659474-130659496 CAGGCGCCCAGGGGCGGAGGAGG - Intergenic
1061559675 9:131394348-131394370 CGGGCCCCCGGCGGCGGCCGCGG - Intronic
1062320922 9:135990246-135990268 CAGGCCCACAGCGGGGGGCGGGG - Intergenic
1062339959 9:136089519-136089541 GAGGCCCCCAGCGCTGGGGGAGG - Intronic
1062506990 9:136882614-136882636 CAGGCCTCCAGCAGGGGCAGGGG - Intronic
1062630777 9:137462149-137462171 CCGGCCACCCGCGGCGGCGGAGG - Intronic
1203770507 EBV:47717-47739 CAGGCCCCCAGCTTCTGAGGCGG + Intergenic
1203551566 Un_KI270743v1:167558-167580 GAGGCCCACAGCGCCGGCGCAGG - Intergenic
1186496373 X:10015305-10015327 GCGGCCGGCAGCGGCGGCGGCGG + Intergenic
1187915598 X:24149963-24149985 GCTGCCCCGAGCGGCGGCGGAGG + Intronic
1189137122 X:38561520-38561542 CAGAGCTCCGGCGGCGGCGGCGG - Exonic
1189160564 X:38804837-38804859 CAGGCCCCCAGCGCGGGCCTTGG + Exonic
1192988887 X:76428820-76428842 CAGGCCCTCGGTGGCGGTGGGGG - Exonic
1195954794 X:110317830-110317852 CAGGGCTGCGGCGGCGGCGGCGG - Exonic
1198388142 X:136147721-136147743 CCAGCCCCGAGCGGCGGCGGCGG - Intronic
1199500368 X:148500672-148500694 CGGGGCGGCAGCGGCGGCGGCGG - Exonic
1199699117 X:150363501-150363523 CAGAGCTCCGGCGGCGGCGGGGG - Exonic
1199736864 X:150693536-150693558 CAGGCCGGCGGCGGCGGCGGCGG + Exonic
1200034535 X:153319136-153319158 GAGGCCCCCAGGGGCGTCGGGGG + Intergenic
1201291188 Y:12421577-12421599 CGGGCCCCCAGCGCCGGCTTTGG - Intergenic