ID: 1035170420

View in Genome Browser
Species Human (GRCh38)
Location 7:157014332-157014354
Sequence TAGAAAGCAGGCTCCCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035170420_1035170423 -6 Left 1035170420 7:157014332-157014354 CCAGCGCGGGAGCCTGCTTTCTA No data
Right 1035170423 7:157014349-157014371 TTTCTACAGGCCTCCTGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035170420 Original CRISPR TAGAAAGCAGGCTCCCGCGC TGG (reversed) Intergenic
No off target data available for this crispr