ID: 1035171239

View in Genome Browser
Species Human (GRCh38)
Location 7:157018474-157018496
Sequence GGACGCTTCTCAGGCGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035171239_1035171247 -3 Left 1035171239 7:157018474-157018496 CCCTTCCCGCCTGAGAAGCGTCC No data
Right 1035171247 7:157018494-157018516 TCCACGCGGAGTTCCAGGCCGGG No data
1035171239_1035171258 20 Left 1035171239 7:157018474-157018496 CCCTTCCCGCCTGAGAAGCGTCC No data
Right 1035171258 7:157018517-157018539 CGCTGGGGAAGGAGGTCCCGGGG No data
1035171239_1035171249 3 Left 1035171239 7:157018474-157018496 CCCTTCCCGCCTGAGAAGCGTCC No data
Right 1035171249 7:157018500-157018522 CGGAGTTCCAGGCCGGGCGCTGG No data
1035171239_1035171254 12 Left 1035171239 7:157018474-157018496 CCCTTCCCGCCTGAGAAGCGTCC No data
Right 1035171254 7:157018509-157018531 AGGCCGGGCGCTGGGGAAGGAGG No data
1035171239_1035171250 4 Left 1035171239 7:157018474-157018496 CCCTTCCCGCCTGAGAAGCGTCC No data
Right 1035171250 7:157018501-157018523 GGAGTTCCAGGCCGGGCGCTGGG No data
1035171239_1035171257 19 Left 1035171239 7:157018474-157018496 CCCTTCCCGCCTGAGAAGCGTCC No data
Right 1035171257 7:157018516-157018538 GCGCTGGGGAAGGAGGTCCCGGG No data
1035171239_1035171246 -4 Left 1035171239 7:157018474-157018496 CCCTTCCCGCCTGAGAAGCGTCC No data
Right 1035171246 7:157018493-157018515 GTCCACGCGGAGTTCCAGGCCGG No data
1035171239_1035171256 18 Left 1035171239 7:157018474-157018496 CCCTTCCCGCCTGAGAAGCGTCC No data
Right 1035171256 7:157018515-157018537 GGCGCTGGGGAAGGAGGTCCCGG No data
1035171239_1035171252 9 Left 1035171239 7:157018474-157018496 CCCTTCCCGCCTGAGAAGCGTCC No data
Right 1035171252 7:157018506-157018528 TCCAGGCCGGGCGCTGGGGAAGG No data
1035171239_1035171245 -8 Left 1035171239 7:157018474-157018496 CCCTTCCCGCCTGAGAAGCGTCC No data
Right 1035171245 7:157018489-157018511 AAGCGTCCACGCGGAGTTCCAGG No data
1035171239_1035171251 5 Left 1035171239 7:157018474-157018496 CCCTTCCCGCCTGAGAAGCGTCC No data
Right 1035171251 7:157018502-157018524 GAGTTCCAGGCCGGGCGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035171239 Original CRISPR GGACGCTTCTCAGGCGGGAA GGG (reversed) Intergenic