ID: 1035171245

View in Genome Browser
Species Human (GRCh38)
Location 7:157018489-157018511
Sequence AAGCGTCCACGCGGAGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035171240_1035171245 -9 Left 1035171240 7:157018475-157018497 CCTTCCCGCCTGAGAAGCGTCCA No data
Right 1035171245 7:157018489-157018511 AAGCGTCCACGCGGAGTTCCAGG No data
1035171237_1035171245 0 Left 1035171237 7:157018466-157018488 CCAGTCCTCCCTTCCCGCCTGAG No data
Right 1035171245 7:157018489-157018511 AAGCGTCCACGCGGAGTTCCAGG No data
1035171239_1035171245 -8 Left 1035171239 7:157018474-157018496 CCCTTCCCGCCTGAGAAGCGTCC No data
Right 1035171245 7:157018489-157018511 AAGCGTCCACGCGGAGTTCCAGG No data
1035171238_1035171245 -5 Left 1035171238 7:157018471-157018493 CCTCCCTTCCCGCCTGAGAAGCG No data
Right 1035171245 7:157018489-157018511 AAGCGTCCACGCGGAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035171245 Original CRISPR AAGCGTCCACGCGGAGTTCC AGG Intergenic
No off target data available for this crispr