ID: 1035171972

View in Genome Browser
Species Human (GRCh38)
Location 7:157021890-157021912
Sequence GCTCCCAAGACCCCGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035171972_1035171980 3 Left 1035171972 7:157021890-157021912 CCTCCCGCCGGGGTCTTGGGAGC No data
Right 1035171980 7:157021916-157021938 TCAGCCTCGCCCTCCCTGCAGGG No data
1035171972_1035171979 2 Left 1035171972 7:157021890-157021912 CCTCCCGCCGGGGTCTTGGGAGC No data
Right 1035171979 7:157021915-157021937 CTCAGCCTCGCCCTCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035171972 Original CRISPR GCTCCCAAGACCCCGGCGGG AGG (reversed) Intergenic
No off target data available for this crispr