ID: 1035181210

View in Genome Browser
Species Human (GRCh38)
Location 7:157090748-157090770
Sequence CCGTGTCCCCAAAACGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035181210_1035181213 1 Left 1035181210 7:157090748-157090770 CCAACTGCGTTTTGGGGACACGG No data
Right 1035181213 7:157090772-157090794 GGCCCTGAGAACAGCATCTCAGG No data
1035181210_1035181214 2 Left 1035181210 7:157090748-157090770 CCAACTGCGTTTTGGGGACACGG No data
Right 1035181214 7:157090773-157090795 GCCCTGAGAACAGCATCTCAGGG No data
1035181210_1035181216 3 Left 1035181210 7:157090748-157090770 CCAACTGCGTTTTGGGGACACGG No data
Right 1035181216 7:157090774-157090796 CCCTGAGAACAGCATCTCAGGGG No data
1035181210_1035181218 10 Left 1035181210 7:157090748-157090770 CCAACTGCGTTTTGGGGACACGG No data
Right 1035181218 7:157090781-157090803 AACAGCATCTCAGGGGACGCAGG No data
1035181210_1035181219 20 Left 1035181210 7:157090748-157090770 CCAACTGCGTTTTGGGGACACGG No data
Right 1035181219 7:157090791-157090813 CAGGGGACGCAGGCTGAGACAGG No data
1035181210_1035181220 25 Left 1035181210 7:157090748-157090770 CCAACTGCGTTTTGGGGACACGG No data
Right 1035181220 7:157090796-157090818 GACGCAGGCTGAGACAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035181210 Original CRISPR CCGTGTCCCCAAAACGCAGT TGG (reversed) Intergenic
No off target data available for this crispr