ID: 1035181214

View in Genome Browser
Species Human (GRCh38)
Location 7:157090773-157090795
Sequence GCCCTGAGAACAGCATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035181209_1035181214 6 Left 1035181209 7:157090744-157090766 CCAGCCAACTGCGTTTTGGGGAC No data
Right 1035181214 7:157090773-157090795 GCCCTGAGAACAGCATCTCAGGG No data
1035181205_1035181214 29 Left 1035181205 7:157090721-157090743 CCTTGCAGCTAGCAGGGGCAAGA No data
Right 1035181214 7:157090773-157090795 GCCCTGAGAACAGCATCTCAGGG No data
1035181210_1035181214 2 Left 1035181210 7:157090748-157090770 CCAACTGCGTTTTGGGGACACGG No data
Right 1035181214 7:157090773-157090795 GCCCTGAGAACAGCATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035181214 Original CRISPR GCCCTGAGAACAGCATCTCA GGG Intergenic
No off target data available for this crispr