ID: 1035181218

View in Genome Browser
Species Human (GRCh38)
Location 7:157090781-157090803
Sequence AACAGCATCTCAGGGGACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035181210_1035181218 10 Left 1035181210 7:157090748-157090770 CCAACTGCGTTTTGGGGACACGG No data
Right 1035181218 7:157090781-157090803 AACAGCATCTCAGGGGACGCAGG No data
1035181209_1035181218 14 Left 1035181209 7:157090744-157090766 CCAGCCAACTGCGTTTTGGGGAC No data
Right 1035181218 7:157090781-157090803 AACAGCATCTCAGGGGACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035181218 Original CRISPR AACAGCATCTCAGGGGACGC AGG Intergenic
No off target data available for this crispr