ID: 1035181220

View in Genome Browser
Species Human (GRCh38)
Location 7:157090796-157090818
Sequence GACGCAGGCTGAGACAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035181215_1035181220 -1 Left 1035181215 7:157090774-157090796 CCCTGAGAACAGCATCTCAGGGG No data
Right 1035181220 7:157090796-157090818 GACGCAGGCTGAGACAGGACAGG No data
1035181217_1035181220 -2 Left 1035181217 7:157090775-157090797 CCTGAGAACAGCATCTCAGGGGA No data
Right 1035181220 7:157090796-157090818 GACGCAGGCTGAGACAGGACAGG No data
1035181209_1035181220 29 Left 1035181209 7:157090744-157090766 CCAGCCAACTGCGTTTTGGGGAC No data
Right 1035181220 7:157090796-157090818 GACGCAGGCTGAGACAGGACAGG No data
1035181210_1035181220 25 Left 1035181210 7:157090748-157090770 CCAACTGCGTTTTGGGGACACGG No data
Right 1035181220 7:157090796-157090818 GACGCAGGCTGAGACAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035181220 Original CRISPR GACGCAGGCTGAGACAGGAC AGG Intergenic
No off target data available for this crispr