ID: 1035182483

View in Genome Browser
Species Human (GRCh38)
Location 7:157099474-157099496
Sequence CCTCTGTGGGGTCTTCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035182483_1035182489 2 Left 1035182483 7:157099474-157099496 CCAGTGTGAAGACCCCACAGAGG No data
Right 1035182489 7:157099499-157099521 CGGAGTCCGCCTGAGAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035182483 Original CRISPR CCTCTGTGGGGTCTTCACAC TGG (reversed) Intergenic