ID: 1035186506

View in Genome Browser
Species Human (GRCh38)
Location 7:157130206-157130228
Sequence GTGGACCCCATGTCATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035186504_1035186506 -10 Left 1035186504 7:157130193-157130215 CCTGGGTTACGTGGTGGACCCCA No data
Right 1035186506 7:157130206-157130228 GTGGACCCCATGTCATCCCAGGG No data
1035186501_1035186506 4 Left 1035186501 7:157130179-157130201 CCAGGTGAGATGATCCTGGGTTA No data
Right 1035186506 7:157130206-157130228 GTGGACCCCATGTCATCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035186506 Original CRISPR GTGGACCCCATGTCATCCCA GGG Intergenic
No off target data available for this crispr