ID: 1035190038

View in Genome Browser
Species Human (GRCh38)
Location 7:157159002-157159024
Sequence ATTTCACACTCTATTGATAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035190038_1035190040 -2 Left 1035190038 7:157159002-157159024 CCGTTATCAATAGAGTGTGAAAT No data
Right 1035190040 7:157159023-157159045 ATAATCACTCCTGTGAAAGGCGG 0: 1
1: 0
2: 1
3: 12
4: 140
1035190038_1035190039 -5 Left 1035190038 7:157159002-157159024 CCGTTATCAATAGAGTGTGAAAT No data
Right 1035190039 7:157159020-157159042 GAAATAATCACTCCTGTGAAAGG 0: 1
1: 0
2: 1
3: 15
4: 186
1035190038_1035190042 30 Left 1035190038 7:157159002-157159024 CCGTTATCAATAGAGTGTGAAAT No data
Right 1035190042 7:157159055-157159077 TCTCTAGCCTTGTGAAGTCATGG 0: 1
1: 0
2: 1
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035190038 Original CRISPR ATTTCACACTCTATTGATAA CGG (reversed) Intronic