ID: 1035190040 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:157159023-157159045 |
| Sequence | ATAATCACTCCTGTGAAAGG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 154 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 12, 4: 140} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1035190038_1035190040 | -2 | Left | 1035190038 | 7:157159002-157159024 | CCGTTATCAATAGAGTGTGAAAT | No data | ||
| Right | 1035190040 | 7:157159023-157159045 | ATAATCACTCCTGTGAAAGGCGG | 0: 1 1: 0 2: 1 3: 12 4: 140 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1035190040 | Original CRISPR | ATAATCACTCCTGTGAAAGG CGG | Intronic | ||