ID: 1035190042

View in Genome Browser
Species Human (GRCh38)
Location 7:157159055-157159077
Sequence TCTCTAGCCTTGTGAAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035190041_1035190042 0 Left 1035190041 7:157159032-157159054 CCTGTGAAAGGCGGAGACTTAAT 0: 1
1: 0
2: 1
3: 7
4: 96
Right 1035190042 7:157159055-157159077 TCTCTAGCCTTGTGAAGTCATGG 0: 1
1: 0
2: 1
3: 11
4: 165
1035190038_1035190042 30 Left 1035190038 7:157159002-157159024 CCGTTATCAATAGAGTGTGAAAT No data
Right 1035190042 7:157159055-157159077 TCTCTAGCCTTGTGAAGTCATGG 0: 1
1: 0
2: 1
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035190042 Original CRISPR TCTCTAGCCTTGTGAAGTCA TGG Intronic