ID: 1035192776

View in Genome Browser
Species Human (GRCh38)
Location 7:157186740-157186762
Sequence ACGAAATCACATTTTTCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 305}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035192776_1035192779 22 Left 1035192776 7:157186740-157186762 CCCGAAGAAAAATGTGATTTCGT 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1035192779 7:157186785-157186807 GTTCCAGTTGAGCACATTTATGG 0: 1
1: 0
2: 1
3: 7
4: 91
1035192776_1035192781 29 Left 1035192776 7:157186740-157186762 CCCGAAGAAAAATGTGATTTCGT 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1035192781 7:157186792-157186814 TTGAGCACATTTATGGAGACTGG 0: 1
1: 0
2: 0
3: 11
4: 255
1035192776_1035192778 -3 Left 1035192776 7:157186740-157186762 CCCGAAGAAAAATGTGATTTCGT 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1035192778 7:157186760-157186782 CGTATATGTTTGTAGTGTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035192776 Original CRISPR ACGAAATCACATTTTTCTTC GGG (reversed) Intronic